ID: 1187757670

View in Genome Browser
Species Human (GRCh38)
Location X:22545368-22545390
Sequence TGGCCATGAGTCAGTTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187757666_1187757670 1 Left 1187757666 X:22545344-22545366 CCACTAAGTTAAGGGTGGACCTT No data
Right 1187757670 X:22545368-22545390 TGGCCATGAGTCAGTTCTCTGGG No data
1187757658_1187757670 25 Left 1187757658 X:22545320-22545342 CCTCTGAGCCACTAGCCTCCGCT No data
Right 1187757670 X:22545368-22545390 TGGCCATGAGTCAGTTCTCTGGG No data
1187757657_1187757670 26 Left 1187757657 X:22545319-22545341 CCCTCTGAGCCACTAGCCTCCGC No data
Right 1187757670 X:22545368-22545390 TGGCCATGAGTCAGTTCTCTGGG No data
1187757665_1187757670 2 Left 1187757665 X:22545343-22545365 CCCACTAAGTTAAGGGTGGACCT No data
Right 1187757670 X:22545368-22545390 TGGCCATGAGTCAGTTCTCTGGG No data
1187757660_1187757670 10 Left 1187757660 X:22545335-22545357 CCTCCGCTCCCACTAAGTTAAGG No data
Right 1187757670 X:22545368-22545390 TGGCCATGAGTCAGTTCTCTGGG No data
1187757659_1187757670 17 Left 1187757659 X:22545328-22545350 CCACTAGCCTCCGCTCCCACTAA No data
Right 1187757670 X:22545368-22545390 TGGCCATGAGTCAGTTCTCTGGG No data
1187757663_1187757670 7 Left 1187757663 X:22545338-22545360 CCGCTCCCACTAAGTTAAGGGTG No data
Right 1187757670 X:22545368-22545390 TGGCCATGAGTCAGTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187757670 Original CRISPR TGGCCATGAGTCAGTTCTCT GGG Intergenic
No off target data available for this crispr