ID: 1187764703

View in Genome Browser
Species Human (GRCh38)
Location X:22628321-22628343
Sequence AATTTAATGGGATGAAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187764703_1187764708 29 Left 1187764703 X:22628321-22628343 CCCTCACTTCATCCCATTAAATT No data
Right 1187764708 X:22628373-22628395 CTTAACCTGGTGCATATAATAGG No data
1187764703_1187764707 16 Left 1187764703 X:22628321-22628343 CCCTCACTTCATCCCATTAAATT No data
Right 1187764707 X:22628360-22628382 TTTTAAAATTGTTCTTAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187764703 Original CRISPR AATTTAATGGGATGAAGTGA GGG (reversed) Intergenic
No off target data available for this crispr