ID: 1187764708

View in Genome Browser
Species Human (GRCh38)
Location X:22628373-22628395
Sequence CTTAACCTGGTGCATATAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187764704_1187764708 28 Left 1187764704 X:22628322-22628344 CCTCACTTCATCCCATTAAATTT No data
Right 1187764708 X:22628373-22628395 CTTAACCTGGTGCATATAATAGG No data
1187764705_1187764708 17 Left 1187764705 X:22628333-22628355 CCCATTAAATTTATGACAAAAAA No data
Right 1187764708 X:22628373-22628395 CTTAACCTGGTGCATATAATAGG No data
1187764703_1187764708 29 Left 1187764703 X:22628321-22628343 CCCTCACTTCATCCCATTAAATT No data
Right 1187764708 X:22628373-22628395 CTTAACCTGGTGCATATAATAGG No data
1187764706_1187764708 16 Left 1187764706 X:22628334-22628356 CCATTAAATTTATGACAAAAAAT No data
Right 1187764708 X:22628373-22628395 CTTAACCTGGTGCATATAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187764708 Original CRISPR CTTAACCTGGTGCATATAAT AGG Intergenic
No off target data available for this crispr