ID: 1187766601

View in Genome Browser
Species Human (GRCh38)
Location X:22649357-22649379
Sequence TAGTGACTCGTGCTCATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187766601_1187766602 2 Left 1187766601 X:22649357-22649379 CCAGGGATGAGCACGAGTCACTA No data
Right 1187766602 X:22649382-22649404 TATTATTCACATGCATGCCACGG No data
1187766601_1187766603 3 Left 1187766601 X:22649357-22649379 CCAGGGATGAGCACGAGTCACTA No data
Right 1187766603 X:22649383-22649405 ATTATTCACATGCATGCCACGGG No data
1187766601_1187766605 29 Left 1187766601 X:22649357-22649379 CCAGGGATGAGCACGAGTCACTA No data
Right 1187766605 X:22649409-22649431 TCCATCAAAACAAGTCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187766601 Original CRISPR TAGTGACTCGTGCTCATCCC TGG (reversed) Intergenic
No off target data available for this crispr