ID: 1187768602

View in Genome Browser
Species Human (GRCh38)
Location X:22670455-22670477
Sequence CTGTGTCCTCAAAGGTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187768602_1187768608 17 Left 1187768602 X:22670455-22670477 CCATGTTACCTTTGAGGACACAG No data
Right 1187768608 X:22670495-22670517 AAACTCCTTGAGATTGTCTAAGG No data
1187768602_1187768604 -6 Left 1187768602 X:22670455-22670477 CCATGTTACCTTTGAGGACACAG No data
Right 1187768604 X:22670472-22670494 ACACAGATTACTCCATTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187768602 Original CRISPR CTGTGTCCTCAAAGGTAACA TGG (reversed) Intergenic
No off target data available for this crispr