ID: 1187774091

View in Genome Browser
Species Human (GRCh38)
Location X:22735476-22735498
Sequence TCTACTCAAGATTTGGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187774084_1187774091 15 Left 1187774084 X:22735438-22735460 CCATGTTGATTAGCCTGCTTAGA No data
Right 1187774091 X:22735476-22735498 TCTACTCAAGATTTGGCATATGG No data
1187774088_1187774091 -9 Left 1187774088 X:22735462-22735484 CCTCCTATGGGCTGTCTACTCAA No data
Right 1187774091 X:22735476-22735498 TCTACTCAAGATTTGGCATATGG No data
1187774087_1187774091 2 Left 1187774087 X:22735451-22735473 CCTGCTTAGAGCCTCCTATGGGC No data
Right 1187774091 X:22735476-22735498 TCTACTCAAGATTTGGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187774091 Original CRISPR TCTACTCAAGATTTGGCATA TGG Intergenic
No off target data available for this crispr