ID: 1187775654

View in Genome Browser
Species Human (GRCh38)
Location X:22753791-22753813
Sequence ATTTGGTAGCGGAAAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187775650_1187775654 22 Left 1187775650 X:22753746-22753768 CCTTGAGACATAACAGGAAAGAA No data
Right 1187775654 X:22753791-22753813 ATTTGGTAGCGGAAAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187775654 Original CRISPR ATTTGGTAGCGGAAAGAAGA TGG Intergenic
No off target data available for this crispr