ID: 1187777450

View in Genome Browser
Species Human (GRCh38)
Location X:22778105-22778127
Sequence CTGTGAATATGTGAAGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187777450_1187777452 15 Left 1187777450 X:22778105-22778127 CCAATTTCTTCACATATTCACAG No data
Right 1187777452 X:22778143-22778165 TTGTGAGTAGCCATGCTAATGGG No data
1187777450_1187777451 14 Left 1187777450 X:22778105-22778127 CCAATTTCTTCACATATTCACAG No data
Right 1187777451 X:22778142-22778164 TTTGTGAGTAGCCATGCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187777450 Original CRISPR CTGTGAATATGTGAAGAAAT TGG (reversed) Intergenic
No off target data available for this crispr