ID: 1187779055

View in Genome Browser
Species Human (GRCh38)
Location X:22796655-22796677
Sequence GAAGTTGATTTCCCTACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187779054_1187779055 -9 Left 1187779054 X:22796641-22796663 CCAGCTAAAGAGGTGAAGTTGAT No data
Right 1187779055 X:22796655-22796677 GAAGTTGATTTCCCTACTCCTGG No data
1187779052_1187779055 12 Left 1187779052 X:22796620-22796642 CCATGTAACTTTTTAGTTTTTCC No data
Right 1187779055 X:22796655-22796677 GAAGTTGATTTCCCTACTCCTGG No data
1187779051_1187779055 28 Left 1187779051 X:22796604-22796626 CCAGGCAGACAATTTTCCATGTA No data
Right 1187779055 X:22796655-22796677 GAAGTTGATTTCCCTACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187779055 Original CRISPR GAAGTTGATTTCCCTACTCC TGG Intergenic
No off target data available for this crispr