ID: 1187787107 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:22904185-22904207 |
Sequence | TGATTAATGCAGATGAAACA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1187787103_1187787107 | 29 | Left | 1187787103 | X:22904133-22904155 | CCCTAAATAAGTGGCTCTCAAAC | No data | ||
Right | 1187787107 | X:22904185-22904207 | TGATTAATGCAGATGAAACATGG | No data | ||||
1187787104_1187787107 | 28 | Left | 1187787104 | X:22904134-22904156 | CCTAAATAAGTGGCTCTCAAACT | No data | ||
Right | 1187787107 | X:22904185-22904207 | TGATTAATGCAGATGAAACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1187787107 | Original CRISPR | TGATTAATGCAGATGAAACA TGG | Intergenic | ||
No off target data available for this crispr |