ID: 1187787107

View in Genome Browser
Species Human (GRCh38)
Location X:22904185-22904207
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187787103_1187787107 29 Left 1187787103 X:22904133-22904155 CCCTAAATAAGTGGCTCTCAAAC No data
Right 1187787107 X:22904185-22904207 TGATTAATGCAGATGAAACATGG No data
1187787104_1187787107 28 Left 1187787104 X:22904134-22904156 CCTAAATAAGTGGCTCTCAAACT No data
Right 1187787107 X:22904185-22904207 TGATTAATGCAGATGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187787107 Original CRISPR TGATTAATGCAGATGAAACA TGG Intergenic
No off target data available for this crispr