ID: 1187790723

View in Genome Browser
Species Human (GRCh38)
Location X:22947189-22947211
Sequence CTGCTTTCCTTGGTCAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187790721_1187790723 16 Left 1187790721 X:22947150-22947172 CCAGACATCAATAACTAGTGGAT No data
Right 1187790723 X:22947189-22947211 CTGCTTTCCTTGGTCAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187790723 Original CRISPR CTGCTTTCCTTGGTCAAGAC TGG Intergenic
No off target data available for this crispr