ID: 1187794861

View in Genome Browser
Species Human (GRCh38)
Location X:22992873-22992895
Sequence ATGCCCTTTTTGTAGAATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187794861_1187794863 19 Left 1187794861 X:22992873-22992895 CCATCATTCTACAAAAAGGGCAT No data
Right 1187794863 X:22992915-22992937 AGTCATTCACTCTGTTGCCCAGG No data
1187794861_1187794864 22 Left 1187794861 X:22992873-22992895 CCATCATTCTACAAAAAGGGCAT No data
Right 1187794864 X:22992918-22992940 CATTCACTCTGTTGCCCAGGTGG No data
1187794861_1187794862 -4 Left 1187794861 X:22992873-22992895 CCATCATTCTACAAAAAGGGCAT No data
Right 1187794862 X:22992892-22992914 GCATTTTTTTTTTTTTAAGACGG No data
1187794861_1187794865 23 Left 1187794861 X:22992873-22992895 CCATCATTCTACAAAAAGGGCAT No data
Right 1187794865 X:22992919-22992941 ATTCACTCTGTTGCCCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187794861 Original CRISPR ATGCCCTTTTTGTAGAATGA TGG (reversed) Intergenic
No off target data available for this crispr