ID: 1187799340

View in Genome Browser
Species Human (GRCh38)
Location X:23042948-23042970
Sequence AAGAATAACTGGATGGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187799333_1187799340 25 Left 1187799333 X:23042900-23042922 CCAGGATGGGAGAACACAGTCAA No data
Right 1187799340 X:23042948-23042970 AAGAATAACTGGATGGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187799340 Original CRISPR AAGAATAACTGGATGGAGTG GGG Intergenic
No off target data available for this crispr