ID: 1187807693

View in Genome Browser
Species Human (GRCh38)
Location X:23139187-23139209
Sequence CCTGCTGGGCACCTTGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187807693_1187807701 0 Left 1187807693 X:23139187-23139209 CCAAGATCAAGGTGCCCAGCAGG No data
Right 1187807701 X:23139210-23139232 TTTGGTGCCTGGTGGGTACTTGG No data
1187807693_1187807700 -7 Left 1187807693 X:23139187-23139209 CCAAGATCAAGGTGCCCAGCAGG No data
Right 1187807700 X:23139203-23139225 CAGCAGGTTTGGTGCCTGGTGGG No data
1187807693_1187807699 -8 Left 1187807693 X:23139187-23139209 CCAAGATCAAGGTGCCCAGCAGG No data
Right 1187807699 X:23139202-23139224 CCAGCAGGTTTGGTGCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187807693 Original CRISPR CCTGCTGGGCACCTTGATCT TGG (reversed) Intergenic
No off target data available for this crispr