ID: 1187814018

View in Genome Browser
Species Human (GRCh38)
Location X:23211445-23211467
Sequence ATGACGGCCTCAACTCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187814015_1187814018 -9 Left 1187814015 X:23211431-23211453 CCACCAGCTGAGGAATGACGGCC No data
Right 1187814018 X:23211445-23211467 ATGACGGCCTCAACTCTCAAGGG No data
1187814014_1187814018 -8 Left 1187814014 X:23211430-23211452 CCCACCAGCTGAGGAATGACGGC No data
Right 1187814018 X:23211445-23211467 ATGACGGCCTCAACTCTCAAGGG No data
1187814012_1187814018 -7 Left 1187814012 X:23211429-23211451 CCCCACCAGCTGAGGAATGACGG No data
Right 1187814018 X:23211445-23211467 ATGACGGCCTCAACTCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187814018 Original CRISPR ATGACGGCCTCAACTCTCAA GGG Intergenic
No off target data available for this crispr