ID: 1187817484

View in Genome Browser
Species Human (GRCh38)
Location X:23248474-23248496
Sequence TTGTCCCACTAGAGGAGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187817484_1187817489 22 Left 1187817484 X:23248474-23248496 CCCTATCTCCTCTAGTGGGACAA No data
Right 1187817489 X:23248519-23248541 GTATAATTCTATTGCAAGGAGGG No data
1187817484_1187817488 21 Left 1187817484 X:23248474-23248496 CCCTATCTCCTCTAGTGGGACAA No data
Right 1187817488 X:23248518-23248540 TGTATAATTCTATTGCAAGGAGG No data
1187817484_1187817487 18 Left 1187817484 X:23248474-23248496 CCCTATCTCCTCTAGTGGGACAA No data
Right 1187817487 X:23248515-23248537 AGATGTATAATTCTATTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187817484 Original CRISPR TTGTCCCACTAGAGGAGATA GGG (reversed) Intergenic
No off target data available for this crispr