ID: 1187819735

View in Genome Browser
Species Human (GRCh38)
Location X:23274646-23274668
Sequence GGCTAAAGGCCTACTTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187819735_1187819739 7 Left 1187819735 X:23274646-23274668 CCCACACAAGTAGGCCTTTAGCC No data
Right 1187819739 X:23274676-23274698 TATTTCTGACCATGACAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187819735 Original CRISPR GGCTAAAGGCCTACTTGTGT GGG (reversed) Intergenic
No off target data available for this crispr