ID: 1187820654

View in Genome Browser
Species Human (GRCh38)
Location X:23284458-23284480
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187820652_1187820654 -10 Left 1187820652 X:23284445-23284467 CCATGTGTGAACACAACCACTTA No data
Right 1187820654 X:23284458-23284480 CAACCACTTATAACAACGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187820654 Original CRISPR CAACCACTTATAACAACGCT GGG Intergenic
No off target data available for this crispr