ID: 1187821182

View in Genome Browser
Species Human (GRCh38)
Location X:23290118-23290140
Sequence CACCTACCATTGCTGAGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187821174_1187821182 -10 Left 1187821174 X:23290105-23290127 CCCCACTCCCCACCACCTACCAT No data
Right 1187821182 X:23290118-23290140 CACCTACCATTGCTGAGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187821182 Original CRISPR CACCTACCATTGCTGAGGTT AGG Intergenic
No off target data available for this crispr