ID: 1187821952

View in Genome Browser
Species Human (GRCh38)
Location X:23297356-23297378
Sequence ACACCTCCATGTTGTCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187821950_1187821952 -10 Left 1187821950 X:23297343-23297365 CCAGGGATGCAGGACACCTCCAT No data
Right 1187821952 X:23297356-23297378 ACACCTCCATGTTGTCATCAGGG No data
1187821949_1187821952 -1 Left 1187821949 X:23297334-23297356 CCAGGCAATCCAGGGATGCAGGA No data
Right 1187821952 X:23297356-23297378 ACACCTCCATGTTGTCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187821952 Original CRISPR ACACCTCCATGTTGTCATCA GGG Intergenic