ID: 1187823804

View in Genome Browser
Species Human (GRCh38)
Location X:23315073-23315095
Sequence GATTTTGGTCTGGTTGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187823804_1187823808 -8 Left 1187823804 X:23315073-23315095 CCCATTTCAACCAGACCAAAATC No data
Right 1187823808 X:23315088-23315110 CCAAAATCCCTACTCCTCCGTGG No data
1187823804_1187823813 8 Left 1187823804 X:23315073-23315095 CCCATTTCAACCAGACCAAAATC No data
Right 1187823813 X:23315104-23315126 TCCGTGGCCCTCTGAGCTCTGGG No data
1187823804_1187823812 7 Left 1187823804 X:23315073-23315095 CCCATTTCAACCAGACCAAAATC No data
Right 1187823812 X:23315103-23315125 CTCCGTGGCCCTCTGAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187823804 Original CRISPR GATTTTGGTCTGGTTGAAAT GGG (reversed) Intergenic