ID: 1187823804 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:23315073-23315095 |
| Sequence | GATTTTGGTCTGGTTGAAAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1187823804_1187823808 | -8 | Left | 1187823804 | X:23315073-23315095 | CCCATTTCAACCAGACCAAAATC | No data | ||
| Right | 1187823808 | X:23315088-23315110 | CCAAAATCCCTACTCCTCCGTGG | No data | ||||
| 1187823804_1187823813 | 8 | Left | 1187823804 | X:23315073-23315095 | CCCATTTCAACCAGACCAAAATC | No data | ||
| Right | 1187823813 | X:23315104-23315126 | TCCGTGGCCCTCTGAGCTCTGGG | No data | ||||
| 1187823804_1187823812 | 7 | Left | 1187823804 | X:23315073-23315095 | CCCATTTCAACCAGACCAAAATC | No data | ||
| Right | 1187823812 | X:23315103-23315125 | CTCCGTGGCCCTCTGAGCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1187823804 | Original CRISPR | GATTTTGGTCTGGTTGAAAT GGG (reversed) | Intergenic | ||