ID: 1187823808 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:23315088-23315110 |
Sequence | CCAAAATCCCTACTCCTCCG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1187823805_1187823808 | -9 | Left | 1187823805 | X:23315074-23315096 | CCATTTCAACCAGACCAAAATCC | No data | ||
Right | 1187823808 | X:23315088-23315110 | CCAAAATCCCTACTCCTCCGTGG | No data | ||||
1187823804_1187823808 | -8 | Left | 1187823804 | X:23315073-23315095 | CCCATTTCAACCAGACCAAAATC | No data | ||
Right | 1187823808 | X:23315088-23315110 | CCAAAATCCCTACTCCTCCGTGG | No data | ||||
1187823803_1187823808 | 6 | Left | 1187823803 | X:23315059-23315081 | CCTTCTAACAACTTCCCATTTCA | No data | ||
Right | 1187823808 | X:23315088-23315110 | CCAAAATCCCTACTCCTCCGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1187823808 | Original CRISPR | CCAAAATCCCTACTCCTCCG TGG | Intergenic | ||