ID: 1187823812

View in Genome Browser
Species Human (GRCh38)
Location X:23315103-23315125
Sequence CTCCGTGGCCCTCTGAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187823804_1187823812 7 Left 1187823804 X:23315073-23315095 CCCATTTCAACCAGACCAAAATC No data
Right 1187823812 X:23315103-23315125 CTCCGTGGCCCTCTGAGCTCTGG No data
1187823806_1187823812 -3 Left 1187823806 X:23315083-23315105 CCAGACCAAAATCCCTACTCCTC No data
Right 1187823812 X:23315103-23315125 CTCCGTGGCCCTCTGAGCTCTGG No data
1187823805_1187823812 6 Left 1187823805 X:23315074-23315096 CCATTTCAACCAGACCAAAATCC No data
Right 1187823812 X:23315103-23315125 CTCCGTGGCCCTCTGAGCTCTGG No data
1187823807_1187823812 -8 Left 1187823807 X:23315088-23315110 CCAAAATCCCTACTCCTCCGTGG No data
Right 1187823812 X:23315103-23315125 CTCCGTGGCCCTCTGAGCTCTGG No data
1187823803_1187823812 21 Left 1187823803 X:23315059-23315081 CCTTCTAACAACTTCCCATTTCA No data
Right 1187823812 X:23315103-23315125 CTCCGTGGCCCTCTGAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187823812 Original CRISPR CTCCGTGGCCCTCTGAGCTC TGG Intergenic