ID: 1187823813

View in Genome Browser
Species Human (GRCh38)
Location X:23315104-23315126
Sequence TCCGTGGCCCTCTGAGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187823803_1187823813 22 Left 1187823803 X:23315059-23315081 CCTTCTAACAACTTCCCATTTCA No data
Right 1187823813 X:23315104-23315126 TCCGTGGCCCTCTGAGCTCTGGG No data
1187823804_1187823813 8 Left 1187823804 X:23315073-23315095 CCCATTTCAACCAGACCAAAATC No data
Right 1187823813 X:23315104-23315126 TCCGTGGCCCTCTGAGCTCTGGG No data
1187823806_1187823813 -2 Left 1187823806 X:23315083-23315105 CCAGACCAAAATCCCTACTCCTC No data
Right 1187823813 X:23315104-23315126 TCCGTGGCCCTCTGAGCTCTGGG No data
1187823807_1187823813 -7 Left 1187823807 X:23315088-23315110 CCAAAATCCCTACTCCTCCGTGG No data
Right 1187823813 X:23315104-23315126 TCCGTGGCCCTCTGAGCTCTGGG No data
1187823805_1187823813 7 Left 1187823805 X:23315074-23315096 CCATTTCAACCAGACCAAAATCC No data
Right 1187823813 X:23315104-23315126 TCCGTGGCCCTCTGAGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187823813 Original CRISPR TCCGTGGCCCTCTGAGCTCT GGG Intergenic
No off target data available for this crispr