ID: 1187824210

View in Genome Browser
Species Human (GRCh38)
Location X:23318445-23318467
Sequence CAGAGAAGGGAGAAGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187824210_1187824218 28 Left 1187824210 X:23318445-23318467 CCAACCTCCTTCTCCCTTCTCTG No data
Right 1187824218 X:23318496-23318518 ATGTCTCTTGAGTGTAGGAGTGG No data
1187824210_1187824215 23 Left 1187824210 X:23318445-23318467 CCAACCTCCTTCTCCCTTCTCTG No data
Right 1187824215 X:23318491-23318513 TCCCAATGTCTCTTGAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187824210 Original CRISPR CAGAGAAGGGAGAAGGAGGT TGG (reversed) Intergenic
No off target data available for this crispr