ID: 1187826936

View in Genome Browser
Species Human (GRCh38)
Location X:23340928-23340950
Sequence AATTAAGGAGAGACTGAGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 379}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187826936 Original CRISPR AATTAAGGAGAGACTGAGAT CGG Intronic
903166037 1:21521125-21521147 AATTCACGAGTGACTCAGATGGG - Intronic
903242251 1:21991072-21991094 AATATAGCAGAGACTCAGATAGG + Intronic
903245761 1:22014260-22014282 AATATAGCAGAGACTCAGATAGG + Intergenic
903348202 1:22701272-22701294 CATTCAGGAGAGACTGGGATTGG - Intergenic
904155065 1:28476168-28476190 AATTTAGGAATGACTGAGGTAGG - Exonic
904345735 1:29867729-29867751 AATTCAGGAGAGGCTTAGCTGGG + Intergenic
904428510 1:30446972-30446994 GGTTAAGGAGACACAGAGATGGG + Intergenic
905572417 1:39016281-39016303 AATTGGGGAGAGACTGAGCCAGG - Intergenic
906012292 1:42539304-42539326 AACAAAGGTGAGACTGAGTTAGG + Exonic
909087816 1:71188203-71188225 AAATAAGGAGAAATTGAGATTGG - Intergenic
909423958 1:75499681-75499703 AAATAAGAAGAGAAAGAGATAGG - Intronic
909790000 1:79664424-79664446 GATTAAGGAAAAACAGAGATAGG - Intergenic
909821121 1:80062432-80062454 TATTAAGAAGAGACAGAGTTAGG + Intergenic
909867501 1:80692708-80692730 AAATAAGGAGAGAAGGAAATAGG - Intergenic
911238711 1:95440628-95440650 AATTAAGAAGAGACTGCCTTGGG - Intergenic
911456658 1:98132966-98132988 AATTAGAGAGAAAGTGAGATAGG + Intergenic
911567611 1:99482240-99482262 AATGAAGGAAAGAGTGAGAGAGG + Intergenic
913185263 1:116364942-116364964 AATAAATGAGAGTCTGAGGTGGG + Intergenic
915530883 1:156501308-156501330 AATTAAGGGGAGACTGGAAGTGG + Intergenic
915891296 1:159776511-159776533 AATTCAGGAGAGGCTTAGCTGGG + Intergenic
915940156 1:160113922-160113944 TGTTAAGGAGAGAGTGAGAGGGG - Intergenic
916501766 1:165393433-165393455 AATTAAGGAGTTACTGGGAGGGG - Intergenic
917789423 1:178490015-178490037 CATTGAGGATAGAATGAGATGGG - Intergenic
917947991 1:179996626-179996648 AATGAAGAAAAGACTGAGAGCGG + Exonic
918194326 1:182207416-182207438 AAGTAAGGAGACACTGACTTAGG + Intergenic
919237910 1:194870160-194870182 AAGAAAGGAGAGACAGAGATGGG + Intergenic
922393008 1:225166930-225166952 AATTAAAGAGATACTCAGACAGG - Intronic
923794483 1:237140882-237140904 AATAAAGAAGACACTGAGCTCGG - Intronic
1063430599 10:5985025-5985047 CATTCAGGAGAGACTCAGGTGGG + Intergenic
1063891968 10:10639838-10639860 AATGAAGGAGAGACTGAAGGAGG + Intergenic
1064270335 10:13859630-13859652 AATGAAGAGGAGACAGAGATTGG - Intronic
1065105736 10:22382145-22382167 AATTATGGAAAAACTGAGAGAGG + Intronic
1065543228 10:26791305-26791327 AAATAAGGAAACAGTGAGATAGG + Intronic
1066571217 10:36774659-36774681 TATGAAGGAGAGAATGAGAAGGG - Intergenic
1067233062 10:44425523-44425545 AATGAATGAGAAACAGAGATAGG + Intergenic
1067556234 10:47275043-47275065 ATTTAAAGAGAGAGAGAGATTGG + Intergenic
1067854438 10:49780172-49780194 AAAGAAGGAGAGACAGAGAAAGG - Intergenic
1067854442 10:49780201-49780223 AAAGAAGGAGAGACAGAGAAAGG - Intergenic
1068795104 10:61070899-61070921 AAGGAAGGAGAGAGAGAGATAGG - Intergenic
1069114468 10:64488271-64488293 AATTAAGAAGAGACTAAGAGTGG - Intergenic
1069237815 10:66100056-66100078 CAATAAGCAGAGTCTGAGATTGG + Intronic
1069496812 10:68912146-68912168 AATTAGGAAAAGACTGAAATAGG + Intronic
1069691508 10:70356169-70356191 ACTGAAGAAGAAACTGAGATTGG - Intronic
1070227687 10:74527490-74527512 AATTAAGGAGAGAATGTGGAGGG + Intronic
1070478334 10:76852368-76852390 AATTCTGGAGAGACAAAGATAGG + Intergenic
1070801282 10:79245715-79245737 GAGTAAGGAGTGACTGAGCTGGG + Intronic
1071172607 10:82884966-82884988 AAGTGAGGACATACTGAGATGGG + Intronic
1071247446 10:83780345-83780367 ACTTAAGGAGACACAGATATTGG - Intergenic
1071800274 10:89052434-89052456 AATTAAAGAGAGAAAGAGAGAGG - Intergenic
1073703562 10:105957264-105957286 AATTAAGGAGTGAGTGAAATTGG - Intergenic
1073733771 10:106322393-106322415 AATAAAGGATGGAATGAGATTGG + Intergenic
1075538850 10:123295335-123295357 TAGTCAGGAGAGACTGGGATTGG + Intergenic
1075587981 10:123671096-123671118 ATTTAAGGAGTGACTCAGATTGG - Intronic
1076516518 10:131048139-131048161 AATGAAGGAGACACTGATAAAGG - Intergenic
1077373925 11:2196412-2196434 AATTAGAGAGAGACAGAGATGGG - Intergenic
1078003430 11:7514955-7514977 AATTAAGGAGGGGTTGAGAAAGG - Intronic
1079393480 11:20042254-20042276 GATTAAATAGAGGCTGAGATCGG + Intronic
1079720049 11:23799614-23799636 GATTAAGGAGAGAATGCCATAGG + Intergenic
1079975626 11:27087739-27087761 AATTTAGGAGAGGCTCATATTGG + Intronic
1080703981 11:34670950-34670972 AATTATGAAAAGACTGATATTGG + Intergenic
1081018798 11:37916605-37916627 AATTCAGGAAAGACTCAGCTGGG - Intergenic
1083070190 11:59970936-59970958 AATACAGAAGAGACTGAAATAGG - Intergenic
1084607422 11:70180634-70180656 AATAAACAAGAGACAGAGATAGG + Intronic
1085938985 11:81185611-81185633 AATGAAGGAGAGACTAAAAGGGG - Intergenic
1088351726 11:108897347-108897369 ATTAAAGGAGACAGTGAGATAGG + Intronic
1088472494 11:110201358-110201380 AATTTAGGAGAGCATGAGAAAGG + Intronic
1089043065 11:115472131-115472153 AATAAAGGGGAAACTGAGAATGG + Intronic
1090512044 11:127385731-127385753 AATTAATGAGAGACAAATATTGG - Intergenic
1091096155 11:132824035-132824057 AATGAAGGAGAGACGTAGGTAGG - Intronic
1091130354 11:133141514-133141536 AATGAAGGAGAGAGAGAGACAGG - Intronic
1091340555 11:134809470-134809492 AATTGAGGGAAGACTGGGATTGG + Intergenic
1094328322 12:29264654-29264676 AATAAAGGAGAGAGAGAGAGAGG + Intronic
1095716210 12:45349578-45349600 AAGAAAGTAAAGACTGAGATTGG + Intronic
1096169852 12:49459130-49459152 ATTTAAGCAGAGAAGGAGATGGG + Intronic
1098023990 12:66183703-66183725 AACAAAGGAGAGACACAGATAGG + Intergenic
1098646591 12:72909312-72909334 ATTTAGGGAGAGCCTGAGATAGG + Intergenic
1099101575 12:78447920-78447942 CATTAAGCAGAGATTGAGAGAGG + Intergenic
1099138066 12:78933825-78933847 AGTGAAAGAGAGATTGAGATGGG + Intronic
1100796610 12:98188642-98188664 CATTAAGGAGAGCCTGAAAATGG - Intergenic
1102621120 12:114195314-114195336 CATTAAGGGGAGACTGAAACTGG + Intergenic
1103551278 12:121739215-121739237 AATTCACGAAAGACAGAGATTGG + Intronic
1103807688 12:123585983-123586005 AATTATGGAGAGGCTTAGCTGGG + Intronic
1104042991 12:125142630-125142652 AAAACAGGAGAGCCTGAGATGGG - Exonic
1104631074 12:130402580-130402602 AATTATGGAGGGACTGAGGAGGG - Intronic
1106202971 13:27558441-27558463 AATTAAGGAGAGTTTGCTATAGG + Intronic
1106322650 13:28656775-28656797 CATGAAGGACAGACTAAGATTGG - Intergenic
1107560420 13:41552676-41552698 AATTAAGGTGAAACAGAGAGGGG - Intergenic
1108010958 13:46009475-46009497 AGTTAAGTAGAGTCTGAAATAGG + Intronic
1108843282 13:54648357-54648379 CAAGAAGCAGAGACTGAGATGGG + Intergenic
1109147679 13:58801753-58801775 AATAAAGGAGAGAAAGAGATAGG + Intergenic
1109545422 13:63836950-63836972 AGTTAAGAAGACACGGAGATTGG + Intergenic
1110647645 13:77906754-77906776 AATTAAGGAGTGGCTTAGTTGGG - Intronic
1110999680 13:82164215-82164237 AATTCCGGACACACTGAGATAGG - Intergenic
1111361478 13:87184197-87184219 AATTAATAACATACTGAGATGGG + Intergenic
1112563654 13:100534390-100534412 AATTAAGGAGAACCTGGGGTAGG + Intronic
1113267829 13:108639171-108639193 ATTAAAGGAGAGACTGAAAATGG + Intronic
1114768042 14:25397135-25397157 AATAAAGGAGAGAATCAGAAAGG - Intergenic
1114894173 14:26965137-26965159 AATTGAGGATATACAGAGATAGG + Intergenic
1115528440 14:34304083-34304105 AAGTGAGGAGAGAATGACATAGG - Intronic
1116960149 14:50960642-50960664 AATTAAAAAAAGACTGACATTGG + Intergenic
1117928183 14:60807312-60807334 ATTAAAGGAAAGAGTGAGATGGG + Intronic
1120398660 14:84000794-84000816 AATTAAGGAGAGAGGGCTATTGG - Intergenic
1121724518 14:96137415-96137437 AATTGAGGGGAGGCTGAGCTCGG + Intergenic
1127516952 15:59705086-59705108 AAAAAAGGAGACACTGAAATAGG + Intergenic
1128878808 15:71224402-71224424 CATTAAGGAGAAATTTAGATGGG - Intronic
1133690378 16:8208712-8208734 AAATACGGAGAGAAAGAGATTGG + Intergenic
1133708426 16:8377990-8378012 AAATAAGGAGTGATTGAGAGTGG + Intergenic
1134494720 16:14723742-14723764 AATTAGGGATATACTGAGAATGG + Intronic
1134500103 16:14762862-14762884 AATTAGGGATATACTGAGAATGG + Intronic
1134526644 16:14949478-14949500 AATTAGGGATATACTGAGAATGG + Intronic
1134545759 16:15106867-15106889 AATTAGGGATATACTGAGAATGG - Intronic
1134580477 16:15366188-15366210 AATTAGGGATATACTGAGAATGG - Intronic
1134714222 16:16347951-16347973 AATTAGGGATATACTGAGAATGG + Intergenic
1134722096 16:16391315-16391337 AATTAGGGATATACTGAGAATGG + Intronic
1134945331 16:18320554-18320576 AATTAGGGATATACTGAGAATGG - Intronic
1134952595 16:18360707-18360729 AATTAGGGATATACTGAGAATGG - Intergenic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1136150546 16:28345306-28345328 AATTAGGGATATACTGAGAATGG - Intronic
1136166783 16:28459144-28459166 AATTAGGGATATACTGAGAATGG - Intronic
1136196192 16:28655888-28655910 AATTAGGGATATACTGAGAATGG + Intronic
1136212533 16:28770013-28770035 AATTAGGGATATACTGAGAATGG + Intronic
1136257254 16:29049921-29049943 AATTAGGGATATACTGAGAATGG + Intronic
1137422832 16:48350695-48350717 AATTCAGGAGAGGCTGAGCTGGG + Intronic
1137425139 16:48373006-48373028 AGCTGAGGAGTGACTGAGATAGG - Intronic
1137849824 16:51730663-51730685 TATTCAGGAGTGACTGAGTTGGG + Intergenic
1138313470 16:56048104-56048126 AAATAAAGAGAGACAGAGAGGGG - Intergenic
1138730422 16:59187992-59188014 AATTAAGCAGAGACGATGATAGG + Intergenic
1139855787 16:69978819-69978841 AATTAGGGATATACTGAGAATGG - Intergenic
1140366944 16:74389256-74389278 AATTAGGGATATACTGAGAATGG + Intronic
1141806154 16:86343033-86343055 AAATGAGGAGAGACTGGAATGGG - Intergenic
1143900043 17:10167459-10167481 GATTAAGGAGAGAATGGGCTGGG + Intronic
1143982210 17:10879849-10879871 AGTTAAGCAGACACTGAGCTGGG - Intergenic
1144415130 17:15039195-15039217 AAGGAAGGAGAGAAAGAGATGGG + Intergenic
1144535578 17:16086503-16086525 AATTCAGGAATGACTGAGAGAGG - Intronic
1146076025 17:29730072-29730094 ACTTCGGGAGAGGCTGAGATGGG + Intronic
1146562863 17:33886661-33886683 AATTTAGGAGAAAGTGAGTTTGG - Intronic
1146725407 17:35151745-35151767 AACTAAGGAGAGATTCAGAGAGG + Intronic
1148319803 17:46740906-46740928 AATTAAGAAGATATTGAGACGGG - Intronic
1148725205 17:49784280-49784302 AGACAAGGAGAGACTGAAATAGG - Intronic
1149820294 17:59770408-59770430 AATTGAGAAGAGAATGAGAAAGG - Intronic
1150819416 17:68423281-68423303 AATTCAGGCATGACTGAGATGGG + Intronic
1151838963 17:76603727-76603749 AAAAAAAGAGAGACAGAGATGGG + Intergenic
1152907600 17:82977363-82977385 TATTCAGGAGTGACTGAGGTCGG + Intronic
1154105938 18:11523174-11523196 AATCAAGAAGGGACTGAGTTGGG - Intergenic
1154117260 18:11622028-11622050 AATTAGGGATATACTGAGAATGG - Intergenic
1155291492 18:24347038-24347060 TAAAAAGGAGAGACTGAGTTTGG - Intronic
1155899882 18:31375995-31376017 TATTAAGGAGAAACTGAAGTTGG - Intergenic
1156064300 18:33120488-33120510 AATTAAGGAAAGACTGTTAATGG + Intronic
1156412630 18:36847594-36847616 TATTAAGAAGAGAATGTGATGGG - Intronic
1158326125 18:56315468-56315490 AATTATTGAGAGAATGAGAGAGG - Intergenic
1158569152 18:58582084-58582106 CATTCAGGAGCGGCTGAGATTGG + Intronic
1158826526 18:61226475-61226497 ATTTAAAGAGAGAATGAGAAAGG + Intergenic
1159168133 18:64727595-64727617 AATTAATGAGAAATTGAAATAGG - Intergenic
1159545866 18:69839209-69839231 AGTTAGGGAGAGACTGGGAGAGG - Intronic
1159616743 18:70589534-70589556 AAAGAGGGAGAGACTGAGAGAGG - Intergenic
1162108610 19:8387259-8387281 AAATCAGGAGAGAGAGAGATGGG + Intronic
1162230953 19:9265885-9265907 AACTAAGAAGACACAGAGATGGG + Intergenic
1163468705 19:17484691-17484713 AATGAAGGAGAGAATGAGGGAGG + Intronic
1165332747 19:35150463-35150485 AATAAAGAAGGGAATGAGATTGG + Intronic
1165401055 19:35600565-35600587 AAGTAGGGAGAGAGTGAGAAAGG + Intergenic
1165545858 19:36535346-36535368 CATTTAGGAGAAACAGAGATAGG - Intronic
1165702494 19:37949174-37949196 GATAAAGAAGAGACAGAGATGGG - Intronic
1165907919 19:39204883-39204905 AAATAAGGAAAGACTGGGAGGGG + Intergenic
1166295399 19:41886984-41887006 ACTCAAGGAGAGACAAAGATGGG + Intronic
1166311967 19:41967895-41967917 ACATAGGGAGAGACAGAGATGGG + Intronic
1166470163 19:43072911-43072933 GATTAGGGAGAGACTGGGAGGGG - Intronic
1166569259 19:43783289-43783311 AGATCAGGAGAGACTGAGACAGG - Intergenic
1167672248 19:50859939-50859961 AAGCAGGGAGAGAGTGAGATAGG - Intronic
1168327526 19:55545830-55545852 AAGGAAGGAGAGACTGGGGTTGG - Intergenic
1168471067 19:56641395-56641417 GATTATGGAAGGACTGAGATTGG - Intergenic
925287217 2:2723673-2723695 AGATATGGAGGGACTGAGATGGG - Intergenic
928461424 2:31476745-31476767 AATTTGGGAGAGACTCAGCTGGG - Intergenic
928767253 2:34661952-34661974 GATTAAGGTGAAACTGGGATGGG + Intergenic
928886768 2:36158155-36158177 AATTAAAGTGAGACAGTGATTGG - Intergenic
929163691 2:38859382-38859404 AAATGAGGAGAGACTGCTATGGG + Intronic
929302773 2:40325033-40325055 TATTAAGGAAAGAGTGAGAAGGG - Intronic
929342936 2:40844864-40844886 GATAAAGGAGAGACTCAGCTGGG - Intergenic
931040064 2:58287477-58287499 TATGAAGGAGAGGGTGAGATGGG + Intergenic
931509869 2:62979791-62979813 GACTAAGAAGAAACTGAGATGGG - Intronic
932037778 2:68264692-68264714 AATCAAGGAGTGATAGAGATGGG + Intergenic
932921706 2:75922877-75922899 AAATAGAGACAGACTGAGATAGG - Intergenic
935419950 2:102856625-102856647 GATAAAGGAGAGTCTGAAATAGG + Intergenic
938701544 2:133884364-133884386 AATTCAGGAGAGATGCAGATGGG - Intergenic
938977536 2:136494361-136494383 AGGTGAGGAGAGAGTGAGATAGG + Intergenic
940018486 2:149131975-149131997 ATTTATGGAGAAACTGAGACCGG + Intronic
940027928 2:149228330-149228352 AAACAAAGAGAGACAGAGATGGG - Intergenic
940360624 2:152792322-152792344 AACTAAAGAGAGCCTCAGATGGG + Intergenic
941439098 2:165511294-165511316 AATTAGGGTGATAGTGAGATGGG + Intronic
942599069 2:177621492-177621514 AATTATGGAAAGAATGAAATAGG + Intergenic
943665222 2:190602121-190602143 AGGGAAGGAGAGACTGAGATAGG + Intergenic
943670316 2:190653275-190653297 CATTAATGAAAGATTGAGATGGG - Intronic
943830857 2:192459794-192459816 GCTTTGGGAGAGACTGAGATAGG - Intergenic
943851309 2:192726398-192726420 AATCAAGTAGAGACTCTGATAGG - Intergenic
945497517 2:210526752-210526774 AATTAAGGAGAGCCTTTGAATGG + Intronic
945915402 2:215698596-215698618 AATTCTGGAGAGACTTAGCTGGG + Intergenic
946718442 2:222578345-222578367 AATTAAAAAGAGACTGTGGTAGG + Intronic
946797914 2:223375740-223375762 AATCAAGGACAAACTGAGAGTGG + Intergenic
946811114 2:223526801-223526823 AAAAAAGGAGAGAGAGAGATTGG + Intergenic
947003251 2:225482594-225482616 GAGTAAGGAGAGAATGAGAAAGG - Intronic
947237430 2:227957082-227957104 AAGGAAGGAGAGAGTGAGAAGGG + Intergenic
1169174291 20:3495917-3495939 GATTAAGGAGAGAGAGAGAATGG + Intronic
1169602185 20:7274296-7274318 AGTTAAAGAGAGATTGAGAGAGG - Intergenic
1169840473 20:9930175-9930197 AGTTCAGGAGAGAATGAGAAAGG - Intergenic
1172383796 20:34518463-34518485 AAAGGAGGAGAGACTGAGACTGG - Intronic
1173721694 20:45264189-45264211 AATTCTGGAGAGACTGAGAAAGG + Intergenic
1174388993 20:50205748-50205770 GGTCAAGGAGAGACTGAGAAAGG + Intergenic
1174659529 20:52199509-52199531 AATTTAGGCTAGACTAAGATAGG - Intronic
1175370961 20:58490826-58490848 AATTAAGGACAGTATGAGAGAGG + Intronic
1175755277 20:61525653-61525675 AAGTAAGGAGAAAACGAGATCGG - Intronic
1178111106 21:29371092-29371114 AACTAAGGAGCTACTGCGATGGG + Intronic
1178593646 21:33933213-33933235 ATTCAAGAAGACACTGAGATGGG + Intergenic
1178969842 21:37163679-37163701 ACTTAAAGTGAGACTGAGACTGG - Intronic
1179311160 21:40197406-40197428 AATTAAGGAGAGGCTGGGCGCGG - Intronic
1179824497 21:43956653-43956675 AATTCAGGAGCGACTTAGCTGGG + Intronic
1180621056 22:17162250-17162272 AATTCAGGAGTGACTTAGCTGGG - Intronic
1180697257 22:17759800-17759822 AAATAAGGAGACAGTGAGAATGG + Intronic
1180923804 22:19538244-19538266 AAAGAAGGAGAGACGGAGAGAGG + Intergenic
1181770100 22:25119000-25119022 AAATAAGTATAGAATGAGATAGG - Intronic
1181965287 22:26652329-26652351 AAATAAAGAGAGAGAGAGATAGG - Intergenic
1182524586 22:30907279-30907301 AGTTCAGGGGACACTGAGATGGG - Exonic
1182751892 22:32648176-32648198 TATTAAGGAGAGTCTTAGTTTGG + Intronic
1183919087 22:41149696-41149718 AATTAAGGAAATACTTACATAGG - Intronic
951358709 3:21700233-21700255 AATTAAGGTGATACTGGTATAGG + Intronic
953297453 3:41734622-41734644 AACAAAGAAGAGACTGAGGTGGG + Intronic
953557318 3:43956822-43956844 AAGAAAGCAGAGCCTGAGATGGG + Intergenic
953740412 3:45533768-45533790 AATGAAGGACAGACTGATAGAGG - Intronic
953992322 3:47493653-47493675 ATTTAAGGGGAGGCTGAGACGGG + Intergenic
954144435 3:48627425-48627447 ACTTAATTAGAGACTGAGACAGG - Intronic
955424449 3:58773175-58773197 AACTAAGGAGAGAGTGAAGTGGG + Intronic
956454188 3:69404753-69404775 AATCAAGAAGACACTGAGAAGGG + Intronic
956565256 3:70629602-70629624 AAGAAAGGAGAGAATGAGAGAGG + Intergenic
957279433 3:78130746-78130768 GATTAAAGATAGACTGAGAGGGG + Intergenic
957383764 3:79468775-79468797 AATCAGTGAAAGACTGAGATTGG - Intronic
959312278 3:104754501-104754523 CACCAAGCAGAGACTGAGATAGG - Intergenic
960645214 3:119872936-119872958 AATTAAGCAGAGACAGAGATTGG - Intronic
961462827 3:127063541-127063563 AATTACAGGGAGGCTGAGATGGG - Intergenic
961554564 3:127689256-127689278 AAAGAAGAAGAGAGTGAGATGGG + Exonic
962060357 3:131920358-131920380 AATTAAGGAGTGACTAACAAAGG - Intronic
962377881 3:134873928-134873950 TAGCAAGGAGAGACTGAGAAAGG + Intronic
963241716 3:143009611-143009633 AATGAAAGAAAGAATGAGATGGG + Intronic
964437851 3:156673484-156673506 AACTAAGGTGAGAATGATATGGG - Intronic
964937581 3:162110645-162110667 AATTCAAGAGAGATTCAGATGGG + Intergenic
966036025 3:175416008-175416030 AGTTACCGAGAGGCTGAGATGGG + Intronic
966826134 3:183966605-183966627 CAGTGAGGAGAGACAGAGATGGG - Intronic
967121988 3:186390401-186390423 AAGTAAGGAGAGAGTGAGAGTGG + Intergenic
967785674 3:193491713-193491735 AATTGAGGAGAGACAGAGTTGGG - Intronic
968422049 4:493749-493771 AATAAATGAGACACTGATATTGG - Intronic
971856645 4:32053271-32053293 GATTTAGGAGAGACTGGGGTTGG - Intergenic
972076034 4:35088200-35088222 GATTAAGGAAAGACTGTGGTTGG + Intergenic
973058516 4:45690113-45690135 AATTGAGGAGAGGCTTAGCTGGG - Intergenic
974057421 4:56998009-56998031 AATTAATTAGAGACAGAGAAAGG + Intronic
974436389 4:61862456-61862478 AGTTCAGGAGAGAAGGAGATGGG + Intronic
975001620 4:69230417-69230439 AATAACAGAGAGACAGAGATGGG + Intergenic
975003823 4:69261700-69261722 AATAACAGAGAGACAGAGATGGG - Intergenic
975242883 4:72082344-72082366 AATTAAAGAGAGACTCAGAGAGG - Intronic
975432332 4:74308549-74308571 AATAAAAGATAGACTGATATTGG - Exonic
975462678 4:74672675-74672697 AACTAAGGAGCGACTGGGAAGGG - Intergenic
975621552 4:76301933-76301955 AGTTAATGAGTGACTGAGCTAGG - Intronic
975973190 4:80067246-80067268 AATAGGGGAGACACTGAGATAGG - Intronic
975975667 4:80093113-80093135 AAGTACGGAGAGACTGAGTTAGG - Intronic
976800932 4:88991250-88991272 AACTCTTGAGAGACTGAGATAGG + Intronic
976891556 4:90054206-90054228 AGTAAAGGAGAGATTGAGAGAGG - Intergenic
977750335 4:100602604-100602626 AACTAAGGTGAGATAGAGATTGG - Intronic
977839596 4:101686575-101686597 AATGAAGGAAAGAATGAGCTAGG - Intronic
978705326 4:111702237-111702259 AATTGAGGAGAGAATCAGAGTGG - Intergenic
979762501 4:124424181-124424203 AATTAAGGAGTGAGTGAATTTGG + Intergenic
980869450 4:138594331-138594353 AATAAAGGAGAGACTTTTATAGG + Intergenic
981105027 4:140870892-140870914 ATTTCAGGAGAGACTGGGAGTGG + Intronic
982339993 4:154286375-154286397 AATCCTGGAGAAACTGAGATAGG + Intronic
982458364 4:155637017-155637039 AGTTAAGGAGAGCCTGAGCTGGG - Intergenic
982782795 4:159508572-159508594 AATTGGGGACAGAATGAGATGGG + Intergenic
984777382 4:183493818-183493840 AATTAAAGAGAGATTAAAATTGG - Intergenic
985641712 5:1066432-1066454 ACTTCAGGAGACACTGAGATGGG + Intronic
985669333 5:1198745-1198767 AGACAAGGAGAGACAGAGATAGG - Intergenic
987654155 5:20783783-20783805 AAGTAAGGAGAAACTGGGAGAGG - Intergenic
988120490 5:26954921-26954943 AATTTAGGAGAGTCTGAGGTGGG + Intronic
988381521 5:30502677-30502699 GATAAAGGAGAAGCTGAGATGGG + Intergenic
988741422 5:34077708-34077730 AAGTAAGGAGAAACTGGGAGAGG + Intronic
989743825 5:44804220-44804242 GATTAAGGAGTCAGTGAGATGGG - Intergenic
991044170 5:62205694-62205716 AATTAAGAAGACAGTGAGATGGG - Intergenic
991338304 5:65575539-65575561 AAATAAGGATAGAATTAGATGGG + Intronic
992100253 5:73400899-73400921 GATTGAGGAGAGAATGAGAAAGG - Intergenic
992630911 5:78679328-78679350 AAATAAGGACAGACTCAGAAAGG + Intronic
992694139 5:79267999-79268021 ACTTTGGGAGAGACTGAGGTGGG + Intronic
992714044 5:79491629-79491651 AGTTAAGAAGAAAATGAGATCGG - Intronic
992936626 5:81713725-81713747 ATTTAAGGAGAGCCTGAAATAGG + Intronic
994140312 5:96334299-96334321 AACTAAGCAGTGACTGTGATAGG - Intergenic
994307647 5:98226403-98226425 AAGTAAGGAGAGAGAGAGAAAGG + Intergenic
995090560 5:108170930-108170952 AATTATGGAGAAATTGAGAGGGG - Intronic
996585911 5:125088420-125088442 GCTTCATGAGAGACTGAGATTGG + Intergenic
1000954038 5:167521079-167521101 CATTCTGGAGAGACTGAGGTTGG + Intronic
1000997993 5:167978192-167978214 TATTAAGGAGACCCTGAGACTGG - Intronic
1002785459 6:396610-396632 AGTGCAGGAGAGGCTGAGATAGG - Intronic
1002785468 6:396662-396684 AGTGCAGGAGAGGCTGAGATAGG - Intronic
1002785485 6:396766-396788 AGTGCAGGAGAGGCTGAGATAGG - Intronic
1002785501 6:396870-396892 AGTGCAGGAGAGGCTGAGATAGG - Intronic
1002785510 6:396922-396944 AGTGCAGGAGAGGCTGAGATAGG - Intronic
1002785527 6:397026-397048 AGTGCAGGAGAGGCTGAGATAGG - Intronic
1003356848 6:5381555-5381577 AATTTACTACAGACTGAGATTGG - Intronic
1003753105 6:9084323-9084345 AATTAAAGAGACAGGGAGATGGG + Intergenic
1003947466 6:11088569-11088591 AATTACGGACACACTCAGATGGG + Intergenic
1004112673 6:12735041-12735063 AATTAAGGAGAGTCTTAGCTGGG + Intronic
1004296273 6:14414317-14414339 ACTTTAGGAGAGGCTGACATGGG + Intergenic
1004492800 6:16132387-16132409 AATAAAGGAGAGACCAAGACAGG - Intronic
1004865090 6:19845598-19845620 TTTAAAGGAGAGACTGAGAAGGG + Intergenic
1005514645 6:26542288-26542310 AACTTAGGAGAAACTGAGGTGGG - Intronic
1005655457 6:27930970-27930992 AATTAATGAGCTACTGAGCTAGG + Intergenic
1006336709 6:33424896-33424918 AATGAAGGAATGACAGAGATAGG + Intronic
1007022100 6:38530653-38530675 AATCCTGGAGAGACAGAGATAGG + Intronic
1007887283 6:45244448-45244470 AATGAAGGAGAGCATAAGATTGG - Intronic
1008797846 6:55326599-55326621 AATTAAGAAGAGATAGGGATGGG - Intergenic
1009400436 6:63248561-63248583 AAATAATGAGAGCCTGAGGTAGG - Intergenic
1010923947 6:81720516-81720538 GATTCAGGAGAGAATGAGAGTGG - Intronic
1011052804 6:83172288-83172310 TACTCAGGAGAGGCTGAGATGGG + Intronic
1011411058 6:87066887-87066909 ACTTAAGCTGAGAGTGAGATTGG + Intergenic
1012794746 6:103745016-103745038 AACCAAGGAGAGACAGAGCTGGG + Intergenic
1013284415 6:108668542-108668564 AATTAAGGTGAGACTGAAGCTGG - Intronic
1013434925 6:110094176-110094198 AATTCAGGAGAGCCTGTGAATGG + Intergenic
1013481353 6:110555566-110555588 AATTAAGCAGAGTCTGAAAGTGG + Intergenic
1013662064 6:112308064-112308086 AAATCAGGAGAGACTGGGGTAGG + Intergenic
1014772884 6:125476910-125476932 AATTAAAGAGAAACTGATCTGGG - Intergenic
1014788025 6:125640185-125640207 AATTAAGCAGGGCCTGAGACTGG - Intergenic
1015333406 6:132007195-132007217 AATTATGGAGGGATTGAAATAGG + Intergenic
1015976952 6:138800070-138800092 AAATGAGGAGAGACACAGATTGG + Intronic
1016023438 6:139259594-139259616 AAGTAAGGAGAAACTGAGAAGGG - Intronic
1016057962 6:139598736-139598758 AAAAAAGGAGAGACAGATATGGG + Intergenic
1016197593 6:141364862-141364884 AAATAAGGAAAGTCTGAGAAAGG - Intergenic
1018219308 6:161562447-161562469 AAGAAAGGAGAGACCGTGATTGG - Intronic
1018444265 6:163840965-163840987 AATTAAGGACAGACTAAGGACGG - Intergenic
1020140509 7:5608955-5608977 AAGAAAGGAGAGACTGGGCTGGG + Intergenic
1020457946 7:8395501-8395523 AATTCACCAGAGACTGAGGTAGG - Intergenic
1020950210 7:14666320-14666342 AATTTAAGAGAAACTGAGAAGGG + Intronic
1021493934 7:21251328-21251350 ACATAAGGAGAGAGTAAGATAGG + Intergenic
1023112954 7:36832567-36832589 AAATCAGGAGAGGCTGAGCTAGG - Intergenic
1023816904 7:43958176-43958198 AATTAAGAAGAGGCTGAGTGAGG + Intergenic
1024425620 7:49222779-49222801 AATAAAGAAGATAGTGAGATAGG + Intergenic
1026544411 7:71309334-71309356 AATTTAGCAGGGAATGAGATGGG - Intronic
1026634271 7:72067538-72067560 AATTATGGAGTGGCTGAGAGTGG - Intronic
1027882591 7:83860366-83860388 AAATAAGGAGAGGATGAGAGGGG - Intergenic
1028055614 7:86238399-86238421 TATTAAGGAGAAATTGAGAAAGG + Intergenic
1028154958 7:87419220-87419242 AGTTTAGGAGATACTGAAATAGG + Intronic
1029865204 7:103620372-103620394 AGTTATGGATAGCCTGAGATCGG - Intronic
1030224823 7:107138657-107138679 TACTCAGGAGAGGCTGAGATTGG - Intronic
1030624613 7:111831076-111831098 AGTTCAGGAGAGAGAGAGATGGG - Intronic
1030941761 7:115659699-115659721 GTTTATGGAGAGACTGAGCTTGG + Intergenic
1031189774 7:118533394-118533416 AATTAAGGAGAGCTTTAAATTGG + Intergenic
1034067995 7:148155189-148155211 ATTTAGGAAGAGACAGAGATGGG + Intronic
1034629726 7:152521724-152521746 AATTCAGGAGAGCCTTAGCTGGG + Intergenic
1035925301 8:3721598-3721620 AATTAAGGTAGGACTGAGAAAGG - Intronic
1036150437 8:6292233-6292255 ACATAAGGAGAGTCTGAGTTTGG + Intergenic
1036214376 8:6866810-6866832 AAGTAAGGTGAGGCTGAGATGGG + Intergenic
1038114581 8:24539086-24539108 GCTTAGGGAGAGACAGAGATTGG - Intergenic
1038716902 8:29999209-29999231 AGAACAGGAGAGACTGAGATAGG + Intergenic
1038837711 8:31146474-31146496 AAATAATGAGAGATTGAAATAGG - Intronic
1039287639 8:36060029-36060051 AATTAAGAAAAGAGTGTGATAGG + Intergenic
1039365664 8:36925651-36925673 AATAAAGGAGACAATGAGATTGG - Intronic
1039653863 8:39376778-39376800 ATTTAAGGAGAAGGTGAGATGGG + Intergenic
1040893473 8:52341000-52341022 AATACAGGAGTGAATGAGATTGG + Intronic
1041700931 8:60788240-60788262 AAAAAAAGAGAGACTGAGGTGGG - Intronic
1042554392 8:70021941-70021963 ATTTAAGAAGAGACTGGAATGGG + Intergenic
1043219681 8:77644914-77644936 ACTGAAGAAGAGTCTGAGATTGG - Intergenic
1043621206 8:82194488-82194510 AATCAAGGAGAGACAAAGAAAGG + Intergenic
1044878116 8:96692867-96692889 AATTCTGGAGATACAGAGATAGG + Intronic
1044890515 8:96830344-96830366 AAATCAGGAGAGACTGAGATTGG + Intronic
1045257117 8:100535554-100535576 TGTTAAGGAGAGACTGGCATGGG - Intronic
1045446524 8:102270844-102270866 AACTTAGGAGAGAATGATATGGG + Intronic
1046204178 8:110968537-110968559 AATTAAAGAGAAACAGAGAATGG - Intergenic
1046569384 8:115943853-115943875 AACTAAGGGGAGACTGCAATGGG + Intergenic
1047027863 8:120844094-120844116 AATTGAGGGGAGACCGAGAAAGG + Intergenic
1047833138 8:128657885-128657907 ACTTAAAGTGAGACTGAGAGAGG + Intergenic
1048067602 8:130986188-130986210 AATTCAGGAGAGACTGGGACAGG - Intronic
1048225676 8:132583031-132583053 AATCAAAGAGAGACAGAGAGAGG + Intronic
1049356387 8:142190893-142190915 AGTTAGGGAGAGACAGAGACAGG - Intergenic
1051255901 9:15213156-15213178 AGAGAAGGAGAGACTGAGAGAGG + Intronic
1051510162 9:17868653-17868675 AGTTAAGGACAGACTTAGATAGG - Intergenic
1051762412 9:20482118-20482140 AATTCAGGAGTGACTAATATAGG - Intronic
1051999839 9:23265434-23265456 AATTAAGTAGAGAAAGAAATAGG + Intergenic
1052319145 9:27149102-27149124 AATAAATGAGTGAGTGAGATTGG - Intronic
1052379022 9:27750082-27750104 AAGGAAGGAGAGACTGAAAAAGG - Intergenic
1052702000 9:31949138-31949160 AATTAAAGAGAGGCTGAGCATGG + Intergenic
1053380614 9:37647064-37647086 AAAAAAGGAGAGACTCAGAGAGG + Intronic
1057123379 9:92597378-92597400 AATAAGGGAGATTCTGAGATTGG - Intronic
1058566198 9:106287778-106287800 AGCGAAGGAGAGACAGAGATGGG - Intergenic
1058580026 9:106445993-106446015 AACTCAGGAGAGACTGAGGCAGG - Intergenic
1058799800 9:108534544-108534566 AATTAAGTAGAATCTGAGAATGG + Intergenic
1059754179 9:117276792-117276814 AGCTAGGGAGAGACTGAGCTGGG - Intronic
1059790773 9:117639716-117639738 AATGAAGGTGAGGCTGAGAATGG + Intergenic
1059866241 9:118517318-118517340 AATTAAGAAGACACAGATATAGG - Intergenic
1060275805 9:122181569-122181591 AACAAAAGAGAGACTGAGTTAGG + Intronic
1060722464 9:125988232-125988254 AATTCTGGAGAGGCTGAGATAGG + Intergenic
1060834711 9:126746306-126746328 ACATAAAGAAAGACTGAGATAGG - Intergenic
1061533410 9:131232320-131232342 AATTAAGGTGAGACTCAAAAAGG - Intronic
1186501883 X:10057880-10057902 AATTTAGGAGACACTTAAATGGG - Intronic
1186576789 X:10775232-10775254 AATGAAGAAGAGAATGTGATTGG + Intronic
1186841078 X:13485150-13485172 AATTAAGGAGAGAGTGGAGTAGG - Intergenic
1187179701 X:16932300-16932322 AATTCAGGAGTGACTTAGCTGGG - Intergenic
1187556575 X:20357774-20357796 AATTAAGAAGGTACTAAGATTGG + Intergenic
1187826936 X:23340928-23340950 AATTAAGGAGAGACTGAGATCGG + Intronic
1188160678 X:26798031-26798053 AATTAAGCATATACTGATATAGG + Intergenic
1188308511 X:28587708-28587730 AGAAAAGGAGAGACTGAGAGAGG - Exonic
1188422093 X:30002611-30002633 AAATAAAGAGAGAGAGAGATTGG - Intergenic
1188935416 X:36169993-36170015 AAGAAGGGAAAGACTGAGATTGG - Intergenic
1189004883 X:36985325-36985347 AACTAATGAGAGACTGAAAAAGG + Intergenic
1189401004 X:40668434-40668456 ACTTATGGAGAGACTGAGATTGG + Intronic
1189517834 X:41733188-41733210 AAAAAAGGAGAGAGAGAGATAGG + Intronic
1190439533 X:50463436-50463458 AGGTAGGGAGAGACTGAGATAGG - Intronic
1191646768 X:63489563-63489585 AATCCTGGAGAGACAGAGATAGG + Intergenic
1191711934 X:64159030-64159052 AGTCAAGGGGAGATTGAGATGGG + Intergenic
1193416312 X:81229129-81229151 AATTAAGGAGATTCTGAAATGGG + Intronic
1195138630 X:101935638-101935660 AATTAAGGAAAGCCTGCTATGGG + Intergenic
1198225475 X:134641279-134641301 AAGAAAGAAAAGACTGAGATAGG + Intronic
1198944883 X:141999929-141999951 AATTATGGAAAGACTGAAATGGG - Intergenic
1202328232 Y:23716269-23716291 AATTGACAAGAGACTGAGGTGGG - Intergenic
1202542538 Y:25953783-25953805 AATTGACAAGAGACTGAGGTGGG + Intergenic