ID: 1187829331

View in Genome Browser
Species Human (GRCh38)
Location X:23364988-23365010
Sequence AAGTACTTCTTGAAGAGTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187829329_1187829331 1 Left 1187829329 X:23364964-23364986 CCATTCCTGGCAGGATGCAGGTC 0: 1
1: 0
2: 0
3: 18
4: 206
Right 1187829331 X:23364988-23365010 AAGTACTTCTTGAAGAGTTACGG 0: 1
1: 0
2: 0
3: 28
4: 204
1187829330_1187829331 -4 Left 1187829330 X:23364969-23364991 CCTGGCAGGATGCAGGTCTAAGT 0: 1
1: 0
2: 0
3: 12
4: 119
Right 1187829331 X:23364988-23365010 AAGTACTTCTTGAAGAGTTACGG 0: 1
1: 0
2: 0
3: 28
4: 204
1187829325_1187829331 16 Left 1187829325 X:23364949-23364971 CCATCTCACAGCTCTCCATTCCT 0: 1
1: 0
2: 7
3: 50
4: 523
Right 1187829331 X:23364988-23365010 AAGTACTTCTTGAAGAGTTACGG 0: 1
1: 0
2: 0
3: 28
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187829331 Original CRISPR AAGTACTTCTTGAAGAGTTA CGG Intronic
901144479 1:7055829-7055851 AAGTACTTCATCAAGACTCATGG - Intronic
902258300 1:15205200-15205222 AAGTTCATCTTGAAGACTCAAGG - Intronic
904896935 1:33824607-33824629 AAGTACTTATTGAGGAGAGAAGG - Intronic
905999276 1:42410055-42410077 ACGTACTTCTGGAACAGGTAGGG - Exonic
906288031 1:44600889-44600911 AAGTACTTGTTGAAGAGATGAGG - Intronic
908512380 1:64859830-64859852 TAGTACTTCTTGATCAGCTATGG + Intronic
911219092 1:95228309-95228331 AAGTGCTTGTTGAAGAATAAAGG + Intronic
916508991 1:165454653-165454675 AAGTAGTTCTTGAACAGCCATGG + Intergenic
917853662 1:179085117-179085139 GACTACTTTTTGAAGAGTTTGGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919115740 1:193278291-193278313 AGGTTCTTCTTGAAATGTTAGGG + Intergenic
919252646 1:195078041-195078063 AAGTACTTCCTGAAGTGCTCTGG + Intergenic
919365921 1:196660684-196660706 AAGTACTATTTGAAGAGAAAAGG + Intronic
921376049 1:214474949-214474971 AAGTACATCTTGAATACTTATGG + Intronic
921404458 1:214764346-214764368 CTTTATTTCTTGAAGAGTTAGGG + Intergenic
922653601 1:227361782-227361804 AAGTAATTCTGGAAGAGTTGAGG + Intergenic
922949516 1:229547018-229547040 AAATACTGGTTGAAGAGGTAAGG + Intronic
923288677 1:232522363-232522385 AAATACATCTTGAAGAGATGTGG - Intronic
923811517 1:237323046-237323068 ATCTACTATTTGAAGAGTTATGG - Intronic
924219731 1:241861420-241861442 AAGTGCTATTTGAAGAGCTATGG - Exonic
1066067505 10:31772987-31773009 AATTACTTTTTGTAGAGTTGAGG - Intergenic
1068491240 10:57726935-57726957 AAGCATTTCCTGAAGAGTTATGG - Intergenic
1068711609 10:60141142-60141164 AAGTGCCTCTTGGAGAGTTATGG - Intronic
1068834102 10:61533360-61533382 AACTATTTTTTGAAGAGCTATGG - Intergenic
1069441276 10:68430448-68430470 GAGTTCTTCTAGAAGAGCTAAGG + Exonic
1070069988 10:73079033-73079055 AACTACTTCTTTAAAAGTTTAGG - Intronic
1071587478 10:86838827-86838849 AAGAACTTATTTAAGACTTAGGG - Intronic
1074803224 10:117023459-117023481 AAGTACTTTGTAAAAAGTTATGG + Intronic
1076031482 10:127162915-127162937 AAGGAATTCTTGATGGGTTAAGG + Intronic
1077863566 11:6204282-6204304 AAGGACTCCTTGAACAGATAAGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078779504 11:14423548-14423570 AAGCACTTCTTGACGGGTTCAGG + Intergenic
1080047645 11:27826433-27826455 AAGAATTTCTAGAAGATTTAAGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1084926617 11:72518491-72518513 AATTACTTCTTTTAGAATTAAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087542891 11:99543474-99543496 AAGTAAGTCTAGCAGAGTTATGG - Intronic
1088160066 11:106858176-106858198 AAATAAGTCTTGGAGAGTTATGG + Intronic
1088895946 11:114078422-114078444 AGGTGCTTCTTGAAGAGCCAAGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090828956 11:130407685-130407707 ATGTACTTCCTGCAGAGTAAGGG - Intronic
1092216497 12:6687563-6687585 AAGTAGGTCTGGAAGAGTTTCGG - Intronic
1092928294 12:13291830-13291852 AAGAACTTCCTGAAGAAGTAGGG - Intergenic
1094737634 12:33253142-33253164 AAGTACTTGTTTCAGAGATAAGG - Intergenic
1097118458 12:56716475-56716497 AAGTACTTCTTTCAGAGCTGTGG + Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097810065 12:64009363-64009385 ATGTGTTTCTTGAAGAGCTAGGG + Intronic
1098895491 12:76055681-76055703 AATTTCTCCTGGAAGAGTTAAGG + Intronic
1099684976 12:85873834-85873856 TGGAAGTTCTTGAAGAGTTAGGG - Intergenic
1100586335 12:95983433-95983455 AAGTATTGATTAAAGAGTTATGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1108412075 13:50159696-50159718 AATTGCTTCTTGAAGAGAAAAGG + Intronic
1108979080 13:56487559-56487581 AAGTTGTTATTGAAGACTTAAGG + Intergenic
1109157788 13:58932654-58932676 AAGTTCTTCTAGAAAAGTTAAGG - Intergenic
1109762629 13:66849808-66849830 TAGCTCTTCTTGAAGACTTACGG - Intronic
1110671428 13:78184329-78184351 AAGTACATTTTGAGGATTTAGGG - Intergenic
1111142522 13:84138806-84138828 AAGGACTTATTGAAGAGTGGAGG + Intergenic
1112198566 13:97251752-97251774 AAGTATTGTTTGAAAAGTTAAGG - Intronic
1112543565 13:100341908-100341930 AAGTAATTATTGAATAATTATGG - Intronic
1112696447 13:101954263-101954285 AATTAGTCCCTGAAGAGTTATGG + Intronic
1113007058 13:105718222-105718244 AATTACTTTTTGTAGAGGTAGGG + Intergenic
1117621460 14:57591277-57591299 AAGTACTTGTTGAGGAGCTGGGG + Intronic
1118133229 14:62991339-62991361 AAGGAATTCTGGAAGTGTTAAGG + Intronic
1121474463 14:94184428-94184450 AAGTTTTTTTTGTAGAGTTAGGG + Intronic
1122611765 14:102989057-102989079 AAATACTTCTTTAAGAATTGGGG + Intronic
1123958897 15:25373055-25373077 AATTAGTTCTTAAAGAGTTAAGG - Intronic
1127662276 15:61111249-61111271 AAGTAGTTCTAGAGGAGGTAGGG + Intronic
1128825664 15:70713623-70713645 AGGGACTTCTTGAAGGATTAAGG + Intronic
1129224542 15:74160795-74160817 AAGTCCTTATTGAATATTTAAGG - Intergenic
1130890759 15:88132006-88132028 GGGCGCTTCTTGAAGAGTTATGG - Intronic
1131338030 15:91569123-91569145 AAGTAACTCTTGAAGAAATAAGG - Intergenic
1131687955 15:94791587-94791609 AGGTACTTATTAAAGTGTTATGG + Intergenic
1134829539 16:17312078-17312100 AAGGCCTTCTAGAAGAGTCAAGG + Intronic
1136986608 16:35112337-35112359 AAGTACTACTTCAAAAGTTCTGG - Intergenic
1149052410 17:52322286-52322308 AAGAACTTCTTGAAGACTGAAGG + Intergenic
1150018201 17:61581458-61581480 AGGTACTTCTGGAACAATTAGGG - Intergenic
1152669860 17:81596802-81596824 AAGAACTTCTTGAAAAATAATGG + Intronic
1153244408 18:3059354-3059376 AAGTACTTTTTGTAGAGATTAGG - Intergenic
1156129285 18:33950612-33950634 AATTTCTTCTTGAAGAGCTAAGG + Intronic
1156258109 18:35418528-35418550 AATTACTTCTTGAAGTAATAAGG - Intergenic
1162258248 19:9510584-9510606 AAGTTCTTCTGAAAGTGTTATGG - Intergenic
1162329457 19:10018674-10018696 AAGTAATGCTAGAAGAGTGAGGG + Intronic
1164921622 19:32092757-32092779 AAACACTTTTTGAAGAGTTACGG - Intergenic
1164967081 19:32494684-32494706 AAGAACCTCTTGAGGAGCTAAGG - Intergenic
1165106605 19:33473594-33473616 AAGTACCTCTGGAAGCGTCAGGG - Intronic
1167062051 19:47155295-47155317 AAGCACTTCTTGAAGGGGTGGGG + Intronic
1167635425 19:50651740-50651762 AAGTACTTATTGAAAAATTGAGG - Intronic
1168006616 19:53495032-53495054 AAATACTTCTTGTAAAGTTTGGG + Exonic
1168385264 19:55957845-55957867 AAGATCTTCTGGAAGAGTTTTGG - Intronic
925818454 2:7776247-7776269 AAGTACATCTTGGAGTGTGAGGG + Intergenic
925951497 2:8916857-8916879 ATGCACTTATTGAAAAGTTAGGG + Intronic
929237732 2:39624384-39624406 AAGTACTTGGAGAAGAGTTCTGG + Intergenic
929628092 2:43431104-43431126 GAGTAATTCTTTAATAGTTATGG - Intronic
929858934 2:45658944-45658966 AATTATTTATTGAAGAGGTATGG + Intronic
931544429 2:63365933-63365955 AAGTTCTCATTGAACAGTTAAGG - Intronic
932388091 2:71357167-71357189 AAGGACTTCTGCCAGAGTTATGG - Intronic
934120792 2:88837457-88837479 AAATACTTCATGCAGAGCTAAGG - Intergenic
936388617 2:112053541-112053563 AAGTTCTACAAGAAGAGTTAAGG - Intergenic
938643166 2:133303176-133303198 AAATACTCCTTGTAGAGATAAGG - Intronic
939951130 2:148474645-148474667 ATGTATATCTTTAAGAGTTAAGG - Intronic
940513157 2:154645418-154645440 AATTGGTTATTGAAGAGTTATGG + Intergenic
941053762 2:160764375-160764397 AATTACATTTTCAAGAGTTAAGG - Intergenic
941395299 2:164966337-164966359 AAGGACAGCTTGAAGGGTTAAGG + Intergenic
941829910 2:169944353-169944375 AAGTAATTCATGAAAAATTAAGG + Intronic
945229808 2:207574750-207574772 AAGAATTTCTACAAGAGTTAGGG + Intronic
945702361 2:213188154-213188176 AAGAACTTCTTTAAGATTTGTGG - Intergenic
947080062 2:226386114-226386136 AAGTGCTTATAGAAGATTTAAGG - Intergenic
1170067003 20:12322704-12322726 AAGTGGTTCTTGAAGAGTGTAGG - Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1172915297 20:38439068-38439090 AAGTGCTTCTTAATGAGTTAAGG - Intergenic
1176416127 21:6475802-6475824 AAATACTTTTTGTAGAGATAGGG + Intergenic
1176890432 21:14311315-14311337 AAGTACTACATTAAGAGGTATGG - Intergenic
1177110612 21:17023233-17023255 AGGTACTTTTTGAACATTTAGGG - Intergenic
1177314713 21:19442989-19443011 AAGTACTTCTGGAATAGTAGAGG - Intergenic
1178180420 21:30154505-30154527 AAGTACTTGTTGAAGACATTTGG + Intergenic
1179356127 21:40661990-40662012 AAGTACTTATTGAACACATAGGG + Intronic
1179691627 21:43084136-43084158 AAATACTTTTTGTAGAGATAGGG + Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1182163892 22:28152306-28152328 AAGCACCACTAGAAGAGTTATGG - Intronic
1182724620 22:32433649-32433671 AATTACTTCTGGAAGACTTGTGG - Intronic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1184073803 22:42163418-42163440 AAGTAACTCTTGAAAAGTTAGGG - Intronic
1185201214 22:49506670-49506692 GAGTACTTTTTAAAGAGTTTAGG - Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
953763903 3:45717987-45718009 AAGTAATTCTTGAAGCAATATGG + Intronic
954045692 3:47927937-47927959 AATTCCTTCTGGAAGAATTAAGG + Intronic
955816955 3:62853786-62853808 AAGTACTTTTTGTAGAGACAGGG - Intronic
956471481 3:69571543-69571565 AAGTAATTTTGGAAAAGTTAAGG + Intergenic
956634437 3:71349847-71349869 TAGTACCTCCTGAAGGGTTAGGG - Intronic
957391265 3:79573770-79573792 AAGTATTTACTGAAGAGTTAAGG - Intronic
959150779 3:102605067-102605089 AAGTACTACTTGAGGTGTTGGGG + Intergenic
959204868 3:103293528-103293550 AACTACTGCTTGAAAGGTTAGGG - Intergenic
959211885 3:103395145-103395167 AAATACTTCTTTAAGAACTATGG + Intergenic
959816877 3:110683994-110684016 CAATACTCCTTTAAGAGTTACGG - Intergenic
960818384 3:121698651-121698673 AAGTATTTCTTGAAGATACAGGG - Exonic
963526313 3:146418881-146418903 AAGGACTCTTTGAAGAGTTTAGG - Intronic
964801159 3:160559626-160559648 AACTACCTCTTGCAGAATTACGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
968414816 4:421920-421942 ATGTACTTATTGAAGAGACAGGG + Intergenic
970247801 4:14081478-14081500 AAGAACTTCTTGACAAGCTATGG + Intergenic
972595065 4:40522532-40522554 AACTACCTCTTGTAGAGTTTGGG + Intronic
972673661 4:41238447-41238469 AATTAATTCTTGTAGAGATAGGG - Intergenic
974251080 4:59383781-59383803 AAGCACAAATTGAAGAGTTATGG - Intergenic
974870844 4:67638860-67638882 CATTACTTATTGAAAAGTTACGG - Intronic
975303021 4:72813598-72813620 AAGTACTTCTTGAGCTGCTAGGG - Intergenic
976338377 4:83917407-83917429 AAGGACTTATTGAAATGTTATGG - Intergenic
978877778 4:113663146-113663168 AAGTACTTGTTAAAAAGATAGGG - Intronic
980059000 4:128108464-128108486 AAATACATTTTGAAGAGTAAAGG - Intronic
980092190 4:128454588-128454610 CAGTTCTTCTGGAAGAGTTCAGG + Intergenic
980383332 4:132056157-132056179 TTGTACTTCTTGTAGAGTCAGGG + Intergenic
981920679 4:150080910-150080932 AAGGGCTTCTTGAGGAGGTAAGG + Intronic
982479135 4:155887689-155887711 AACCACATCTTGAAGACTTAAGG + Intronic
983342162 4:166476687-166476709 AAGCACTTCTTGAATGGTTAAGG + Intergenic
983859178 4:172683506-172683528 AAGTCCTTTTTCAAGGGTTAGGG - Intronic
984078825 4:175216574-175216596 AAGTGTTTCTTAAAAAGTTACGG + Intergenic
986820922 5:11466013-11466035 AACTACTTATTGAAGAGGTGGGG + Intronic
986873327 5:12077303-12077325 AAGTATGTTTTGAAAAGTTAAGG + Intergenic
988475774 5:31584031-31584053 AATTAATTCATGAAGGGTTAAGG - Intergenic
989265578 5:39469959-39469981 ATTTACTTCTGGTAGAGTTAGGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990014447 5:51042108-51042130 AAACACTTCTTGAAAAGTCAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
991288582 5:65008636-65008658 CAGTAGTTCTTGATGAGTTATGG + Intronic
992346806 5:75887515-75887537 AAATCCTTCTGGATGAGTTAAGG + Intergenic
993734167 5:91456477-91456499 AAGTAATTCTGGAGGAGTTAAGG - Intergenic
994085038 5:95749281-95749303 GAGTACTTGGTGAAGAGCTAGGG - Intronic
994321062 5:98395101-98395123 AATTACTATTTGCAGAGTTATGG - Intergenic
994736209 5:103559744-103559766 AAGGACTTCTTGTAGAATTTTGG - Intronic
1002891924 6:1340755-1340777 AAATACATCTTGAAGTATTAAGG - Intergenic
1002980284 6:2129049-2129071 GAGTACTTCATGAAAAGTGAGGG - Intronic
1003699890 6:8451237-8451259 AATTACTTCTTTAAGCTTTAAGG + Intergenic
1004578348 6:16922337-16922359 AAGTATTTCTAGAAAAGTTCTGG + Intergenic
1005096552 6:22122385-22122407 ATGCACTTCTTGAAGTGCTAAGG - Intergenic
1005352363 6:24949055-24949077 AGATACTATTTGAAGAGTTAAGG - Intronic
1005467814 6:26132193-26132215 AAGTTTTTCTTGAAGAGGTATGG - Intronic
1007847120 6:44768498-44768520 AACTCTTTCTTGAAGAGTGAGGG - Intergenic
1009055288 6:58327705-58327727 AAGTACTTTTTGAAGGCTCAGGG - Intergenic
1009235873 6:61122873-61122895 AAGTACTTTTTGAAGGCTCAGGG + Intergenic
1009395955 6:63201242-63201264 AAGTACTTCTTGTTGTGTGAAGG - Intergenic
1009810677 6:68661087-68661109 AGGCACTTCTTGAAAAATTAAGG - Intronic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1013024634 6:106258960-106258982 ATGTACTCATTGAAGAATTATGG - Intronic
1014102580 6:117528047-117528069 CAGTACTTCTTGAACATTTTGGG - Intronic
1014351876 6:120355765-120355787 AAGTAGTTATTGAAAACTTAAGG - Intergenic
1015257443 6:131195384-131195406 AACTATGTCTTGAAGAGTTGTGG + Intronic
1016421326 6:143886527-143886549 AAGTACTCCTTAAAGAGGTTTGG - Intronic
1017285138 6:152665956-152665978 AAGTAATTATTGATGAGTGAGGG + Intergenic
1019080808 6:169428327-169428349 AAGTACTTTCAGAAAAGTTAGGG + Intergenic
1021339290 7:19443318-19443340 AAGTATTTCTAGAACAGATAAGG - Intergenic
1023924357 7:44654878-44654900 AATTACTTCTTGAAGAGTGCAGG - Intronic
1024385325 7:48744635-48744657 AAGTAGTTGTTGAAGGCTTATGG + Intergenic
1029535819 7:101156933-101156955 AAGAACTTCTTTAAGAGTTTGGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031706462 7:124985959-124985981 AAATAATTCTTCAAGAGTGAGGG + Intergenic
1032554013 7:132812722-132812744 TAGGAAATCTTGAAGAGTTAGGG - Intronic
1034710949 7:153191057-153191079 ATGTACTTCTTGAAGACCCAAGG + Intergenic
1035950456 8:4014507-4014529 TAGTAGTCCTTGAAGAGTAAGGG - Intronic
1035971599 8:4255665-4255687 ATGTATTACGTGAAGAGTTAAGG + Intronic
1037385535 8:18336415-18336437 AGCTTCTTCCTGAAGAGTTAGGG + Intergenic
1039015821 8:33147518-33147540 AGGTATTTCTTAAAGGGTTATGG - Intergenic
1039675017 8:39653570-39653592 AAGTAATTATTTAAAAGTTAAGG + Intronic
1041700420 8:60782775-60782797 AGGTACTGTTTTAAGAGTTAGGG + Intronic
1044810310 8:96054249-96054271 AATAATTTTTTGAAGAGTTAGGG - Intergenic
1046218777 8:111184939-111184961 AATTACTTCTAGAACAGGTATGG + Intergenic
1049924743 9:397733-397755 AAATACACCTTGAAGTGTTATGG + Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050674816 9:8040001-8040023 AAGTACTTCCAGAAGATTGATGG + Intergenic
1050682637 9:8131527-8131549 AAATATTTCTTAAAGAATTAAGG + Intergenic
1051948838 9:22605733-22605755 AATTTCTTTTTGAAGACTTATGG - Intergenic
1051964052 9:22804035-22804057 AAGGATTTCTTGGAGAGTTTTGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1058342142 9:103911427-103911449 CAATTCTTCTTAAAGAGTTATGG + Intergenic
1060983487 9:127807031-127807053 AAGTACTTGGTGAAGAGCTCAGG - Exonic
1061477996 9:130881795-130881817 CCCTACTTCTTGAAGATTTATGG + Intronic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1185857153 X:3546589-3546611 AAGAACTTCATGGAGAGTTGAGG - Intergenic
1186335869 X:8587294-8587316 AAGTACTTAGTGAAGATTTATGG + Intronic
1187829331 X:23364988-23365010 AAGTACTTCTTGAAGAGTTACGG + Intronic
1188233646 X:27698968-27698990 AAATATTTGTTGAGGAGTTATGG + Intronic
1188326048 X:28802312-28802334 AATTTCTTTTTGTAGAGTTATGG + Intronic
1189475362 X:41349266-41349288 AAGTACTTTGTAAAAAGTTATGG - Exonic
1189646716 X:43140899-43140921 AAATATTTCTTGAGGAGTTTAGG - Intergenic
1190120134 X:47652202-47652224 AAGTAGATCTTGAAGTGATAAGG - Intronic
1190575525 X:51832753-51832775 TAGTAATTCCTGAAGAGTGAAGG - Intronic
1190643068 X:52498982-52499004 AAGTAGTTCATGAAGACTGACGG - Intronic
1190644605 X:52513885-52513907 AAGTAGTTCATGAAGACTGACGG + Intronic
1200807061 Y:7443823-7443845 AAGAACTTCATGGAGAGTTGAGG + Intergenic
1201262374 Y:12172567-12172589 AAGTACTTAATGAACAGTGAAGG - Intergenic