ID: 1187830192

View in Genome Browser
Species Human (GRCh38)
Location X:23373449-23373471
Sequence CTATATCCACAGCTTAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187830189_1187830192 28 Left 1187830189 X:23373398-23373420 CCAGGCACACATGTGCAGAGGAA 0: 1
1: 0
2: 6
3: 27
4: 268
Right 1187830192 X:23373449-23373471 CTATATCCACAGCTTAAATTTGG 0: 1
1: 0
2: 1
3: 16
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187830192 Original CRISPR CTATATCCACAGCTTAAATT TGG Intronic
904411910 1:30329750-30329772 CCATATCCACAGCCTAAAATGGG - Intergenic
904679323 1:32217888-32217910 CTATATCCACAGTTTAATAACGG - Intronic
906703026 1:47873404-47873426 ATATATCCACCCCATAAATTTGG - Intronic
908515662 1:64890276-64890298 CTTTATCCTCAGCACAAATTAGG + Intronic
908891993 1:68859057-68859079 CTATGTCCACTGCCTGAATTAGG + Intergenic
909212872 1:72846299-72846321 CTGCATCCAAAGCTTATATTAGG + Intergenic
909645965 1:77917881-77917903 TTATATGCAGAGTTTAAATTAGG - Intronic
910059256 1:83068786-83068808 CTAAAACCACAGTTTTAATTTGG - Intergenic
910447774 1:87316264-87316286 CAATATACACAGTTTAAATTGGG + Intergenic
911579200 1:99615921-99615943 CAAAATCCACAGTTTACATTCGG - Intergenic
912881221 1:113417367-113417389 GTATAGCCACGTCTTAAATTGGG + Intronic
915605731 1:156949007-156949029 CTATATTCACAGCTCATTTTAGG + Intronic
915957863 1:160238169-160238191 CTATATTCCCAGCTTTAAATAGG + Intronic
916447126 1:164882865-164882887 CTATATACTTAGTTTAAATTTGG + Intronic
918830075 1:189384542-189384564 CTATATCCATATCCTAAGTTGGG + Intergenic
919265211 1:195254348-195254370 CTTTCTCCACTACTTAAATTTGG + Intergenic
920527622 1:206679411-206679433 CTAAATCCACAGTTTACAATGGG - Intronic
921695390 1:218203414-218203436 CTAGATCCAGAGCTTGGATTTGG - Intergenic
922647119 1:227299520-227299542 ATATATTTACAGCTTAAAATAGG - Intronic
923014433 1:230114976-230114998 CCAAGTCCACAGCTTACATTAGG + Intronic
923951308 1:238958134-238958156 CTATCTCCACAGATTAGTTTTGG - Intergenic
1062900648 10:1142848-1142870 CCAAATCCACAGTTTACATTAGG + Intergenic
1063612199 10:7572168-7572190 CTATATCCACAGCTCATCTCCGG + Intronic
1063849711 10:10173307-10173329 CAATATCCATAGCTTACATTAGG + Intergenic
1064161058 10:12947021-12947043 CTATCTCCACAGTTTATTTTCGG + Intronic
1065252160 10:23826608-23826630 CTCCATCCACAGCTTGAATCAGG - Intronic
1065514917 10:26515534-26515556 CCATATGCACAGCTAAAACTAGG + Intronic
1067746389 10:48939433-48939455 CTATCTCCACCACTTAAATGGGG - Intronic
1069979136 10:72240134-72240156 TCATATCCACACCTTTAATTTGG - Intergenic
1071004067 10:80862171-80862193 CTAGATCCATAGGTTAATTTTGG + Intergenic
1072113663 10:92347845-92347867 CTATATCCATAGCTCAAATTTGG + Intronic
1073273084 10:102283376-102283398 CTATTTCCACAGCTTCCTTTTGG - Intronic
1075549765 10:123383530-123383552 CAAAATCCACACCTTAATTTTGG + Intergenic
1076621928 10:131794834-131794856 CAACATCCACAGTTTACATTAGG + Intergenic
1078116455 11:8456818-8456840 CTAAGTCCATAGCTTATATTAGG - Intronic
1078351449 11:10598082-10598104 CTATATCCTCAGATGGAATTTGG - Intronic
1080980940 11:37404678-37404700 CTATATCCAAATCTTTTATTAGG - Intergenic
1083093695 11:60227219-60227241 TTAAATCTACAGATTAAATTGGG - Intronic
1086084659 11:82942668-82942690 CTACTTCCACAGCTGACATTGGG + Intronic
1092671698 12:10868699-10868721 CAATATCCACAGTTTCAGTTGGG - Intronic
1093543607 12:20318506-20318528 GTTTATCCAGAGCTTAAATTTGG + Intergenic
1093761515 12:22916370-22916392 CCATAACCACGGCTGAAATTTGG - Intergenic
1095107789 12:38256605-38256627 CAATCTCCACAGATTGAATTGGG - Intergenic
1095871598 12:47034494-47034516 CTATATCTACAGCATATACTAGG - Intergenic
1097524783 12:60718354-60718376 ATATATCCAAAGTTTACATTAGG - Intergenic
1098808521 12:75053170-75053192 CTAAATCTACAGATAAAATTGGG - Intronic
1099593860 12:84631624-84631646 CTATACTCACAGCTGAGATTGGG + Intergenic
1100001555 12:89843056-89843078 CTATGTCTCCAGCTAAAATTCGG + Intergenic
1101852156 12:108412128-108412150 CTAAATCCACTGCATAAAATAGG - Intergenic
1102785509 12:115601056-115601078 GTAAATGCACAGCTTATATTTGG + Intergenic
1104070938 12:125344848-125344870 CTATTTCCACAGCTCCACTTTGG - Intronic
1105583268 13:21720897-21720919 CTATGTCCTAAGCTTAGATTGGG + Intergenic
1109761130 13:66830617-66830639 CTATATGGACAGCTACAATTAGG - Intronic
1110106567 13:71684402-71684424 CTACATTCATAGCTTATATTTGG + Intronic
1110154845 13:72303970-72303992 ATATATACACATTTTAAATTCGG + Intergenic
1110214911 13:73014546-73014568 CTAGGTCCACAGTTTACATTTGG - Intronic
1111375351 13:87372025-87372047 CCAGCTCAACAGCTTAAATTTGG + Intergenic
1112359681 13:98706196-98706218 CTATATTCAAAACTTTAATTTGG + Exonic
1112868499 13:103938713-103938735 CTATATCCACAGCCCACCTTTGG + Intergenic
1114173159 14:20295047-20295069 CTATATCCATAGTTGAAATTTGG - Intronic
1116442009 14:44964065-44964087 CTGTATCCACAGCTTTAAAAAGG - Exonic
1116878973 14:50144736-50144758 CTATTTCAAAAACTTAAATTTGG - Intronic
1121495405 14:94388621-94388643 CTGGATCCACTGCTTAAATACGG - Exonic
1121798929 14:96757298-96757320 CCATAACCACAGCCTAAGTTAGG - Intergenic
1127298518 15:57630663-57630685 GTCTATCCACAGTTTAAATTTGG - Intronic
1130178301 15:81597864-81597886 CAACATCCACAGGTTATATTAGG + Intergenic
1131424964 15:92338424-92338446 CTAAGCCCAAAGCTTAAATTAGG + Intergenic
1137956661 16:52838217-52838239 CAAAATCCATAGCTTACATTAGG + Intergenic
1138427481 16:56945758-56945780 CTATAGCCAGAGCTGAAATCTGG - Intergenic
1138822031 16:60272318-60272340 CTATATTCACAGCTTTTACTGGG + Intergenic
1146352085 17:32103482-32103504 CTATTTCCCCAGTTCAAATTAGG + Intergenic
1149358475 17:55868900-55868922 CTAGATCCACATCTAACATTGGG + Intergenic
1149869599 17:60169848-60169870 CTATTTCCCCAGTTCAAATTAGG + Intronic
1151752433 17:76047382-76047404 CTATATAAAAATCTTAAATTAGG + Intronic
1153950285 18:10052687-10052709 CTATTTCCACATTTAAAATTTGG - Intergenic
1155774930 18:29749390-29749412 CTATATATATACCTTAAATTAGG - Intergenic
1156063080 18:33104591-33104613 CTATTTCCACACCTTAATGTGGG - Intronic
1156562301 18:38139078-38139100 CTATAACTGCAGCTTTAATTGGG - Intergenic
1156705898 18:39882092-39882114 CAATATCAAATGCTTAAATTAGG + Intergenic
1157128346 18:44978910-44978932 CAATATCCTCATCTTAAAATTGG - Intronic
1158355162 18:56610212-56610234 CTATATACTCAGTTTAAATGTGG - Intronic
1166245218 19:41520324-41520346 ATGTATACACATCTTAAATTTGG + Intergenic
926604090 2:14878815-14878837 CCAAATCCATAGCTTACATTAGG + Intergenic
926776779 2:16430962-16430984 CTGTATCCACTGCTGAAGTTAGG + Intergenic
928724648 2:34157982-34158004 CTATAGCCACAGCCTATATTTGG - Intergenic
930423645 2:51185523-51185545 TTATATCAACAGCTTAAGATAGG + Intergenic
931339041 2:61380667-61380689 CTATTTCTACACCTTAAATCTGG + Intronic
932834413 2:75022368-75022390 TGATATCCACAGATTAATTTGGG - Intergenic
932967411 2:76492801-76492823 CCATATGCCCAGCTAAAATTGGG + Intergenic
936255962 2:110912191-110912213 TTATATCTACAGATTAATTTAGG - Intronic
940022350 2:149168568-149168590 CAATATTCACAGCTTAAATATGG - Intronic
941029746 2:160497317-160497339 CAATGTCCACATATTAAATTTGG + Intergenic
941224841 2:162835664-162835686 CTATATATACACCTTAAAATGGG + Intronic
941733391 2:168945101-168945123 ACAGATCCACAGCTTACATTAGG - Intronic
941936467 2:170985273-170985295 CTATATTCAGAGATAAAATTTGG - Intergenic
942991275 2:182206414-182206436 CAATGTCCACAGTTTACATTAGG + Intronic
943877751 2:193094287-193094309 CTGAATCCAAAGCTTAAATGTGG + Intergenic
946530217 2:220562625-220562647 CAATATCGACAACTTAACTTTGG - Intergenic
1171303770 20:24086905-24086927 CAAAGTCCACAGCTTACATTAGG + Intergenic
1176243463 20:64085595-64085617 CTTATTCCACAGTTTAAATTAGG + Intronic
1183554109 22:38511791-38511813 CAATATGCCCAGCTAAAATTTGG - Intergenic
950061390 3:10074337-10074359 TTGTATCCCCATCTTAAATTAGG + Intronic
950302929 3:11897749-11897771 TTGTATCCCCATCTTAAATTAGG + Intergenic
953189608 3:40671476-40671498 CTAAGTCCACAGTTTACATTAGG - Intergenic
956083524 3:65585333-65585355 CTTTATCCACATTTAAAATTGGG - Intronic
956148223 3:66213639-66213661 CCAAATCCACAGTTTACATTAGG + Intronic
957618119 3:82558854-82558876 CTATATCCACATATTAATATTGG + Intergenic
957901768 3:86503418-86503440 CAAAATCCACAGTTTACATTGGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
962180500 3:133201167-133201189 GTATATCCACAGCTTAAGCCTGG + Intronic
963639907 3:147846720-147846742 GCATATCCACAGCTTATAATGGG - Intergenic
965269269 3:166591745-166591767 CTAAATCCATAGTTTACATTAGG + Intergenic
968780498 4:2576808-2576830 CTATTACCACAGCATAAAATTGG - Intronic
971752775 4:30672505-30672527 CAAGATCCACAGCTGACATTAGG - Intergenic
973296456 4:48527755-48527777 ATGAATTCACAGCTTAAATTTGG + Intronic
975509107 4:75172691-75172713 CTATACCCACAGCCTGAATGTGG - Intergenic
978862130 4:113462643-113462665 CTATATTCTCAGTTTAAAATAGG - Intronic
979745106 4:124203341-124203363 CTATATTCTCAGTTTAAATTGGG + Intergenic
980717211 4:136641797-136641819 CTATATCCACAGATAATACTTGG + Intergenic
981520717 4:145659618-145659640 CTCTATCCACATCTTAAGATTGG - Exonic
981760996 4:148194177-148194199 CTATATTTACAGATTAACTTAGG + Intronic
982034666 4:151333979-151334001 CTATATAAACAGGTGAAATTTGG - Intergenic
984297225 4:177867783-177867805 CTATATGCCTACCTTAAATTTGG + Intronic
985893550 5:2735469-2735491 CTATATCCATGGTTTATATTAGG - Intergenic
986108320 5:4683359-4683381 CTATGCCCACATTTTAAATTGGG - Intergenic
988434620 5:31159352-31159374 CCAAGTCCACAGTTTAAATTAGG + Intergenic
988511402 5:31867628-31867650 CTAAATCTACAGCTTCAAGTTGG + Intronic
989703676 5:44301596-44301618 CTTTATCCACTGTGTAAATTAGG + Intergenic
990265677 5:54072350-54072372 GTTTATCCACAGCTGCAATTAGG - Intronic
992600701 5:78396231-78396253 CCAAATCCACAGTTTACATTAGG - Intronic
993445627 5:88009015-88009037 TTATATCTACAGCTCAATTTAGG - Intergenic
995433904 5:112114042-112114064 CTCTATCCTCAGCTGAGATTTGG - Intergenic
995638396 5:114222619-114222641 CCATACCCACAGCTTAATTGAGG - Intergenic
995846258 5:116497362-116497384 CTATATCAACAGTATAAATATGG + Exonic
996452961 5:123647668-123647690 CTATGTCAAAAGCTTATATTTGG - Intergenic
998402546 5:141855541-141855563 CTCTATCCTCAGATGAAATTGGG + Intronic
998491001 5:142546248-142546270 CCATATGCCCAGCTTAAAATTGG - Intergenic
1002542299 5:179914234-179914256 CGATACCCACAGCTTAAAATAGG - Intronic
1007053231 6:38854705-38854727 CTAAATCCTCAGCCTAATTTAGG - Intronic
1009817519 6:68755059-68755081 CTATAAACACAACTTAATTTAGG + Intronic
1010985965 6:82424555-82424577 CTCTATCCAAATCTTAAATCAGG - Intergenic
1012898910 6:104984048-104984070 CTATAGCCACATTTTCAATTTGG - Intronic
1014513605 6:122355158-122355180 CTATATAAACAGCAAAAATTAGG + Intergenic
1014691572 6:124569749-124569771 CTTTATCAACAGCATAAATATGG + Intronic
1018097679 6:160406056-160406078 CAATGTCCACAGTTTACATTTGG - Intronic
1021749635 7:23782920-23782942 ATGTATCCAAAGCTTAAAATTGG + Intronic
1028383525 7:90226125-90226147 CTATATCCACTGCTAAACTTTGG - Intronic
1028994256 7:97082867-97082889 GTATTTCCACACCTTCAATTGGG - Intergenic
1029909987 7:104135216-104135238 CTCTATCCAAGGCATAAATTTGG - Intronic
1030721139 7:112871920-112871942 CAATGTCCAAAGATTAAATTGGG + Intronic
1030906524 7:115190270-115190292 CTATTTCCACAGATAAAATTTGG - Intergenic
1033978616 7:147134263-147134285 AAATAAACACAGCTTAAATTAGG - Intronic
1039688949 8:39841376-39841398 CCAAATCCATAGCTTACATTAGG + Intergenic
1040439873 8:47429967-47429989 CTATTTCCACTTTTTAAATTTGG + Intronic
1041566263 8:59282010-59282032 ATATATGCACGGCTTAAGTTAGG - Intergenic
1046438940 8:114233661-114233683 CAATATCCACAACTTAAATCTGG + Intergenic
1051470437 9:17433959-17433981 CTATATCAACAGAGTAAATTGGG - Intronic
1051638912 9:19205946-19205968 CAATATCCCCAGCATGAATTTGG + Intergenic
1060924950 9:127449843-127449865 CTATCACCATAGCATAAATTGGG + Intronic
1061192220 9:129088480-129088502 ATATAGCCACAGCCCAAATTGGG + Intronic
1185979073 X:4756123-4756145 CAATGTCCACAGTTTACATTAGG + Intergenic
1187830192 X:23373449-23373471 CTATATCCACAGCTTAAATTTGG + Intronic
1188090441 X:25957929-25957951 CAATGTCCACATATTAAATTTGG + Intergenic
1188406165 X:29812800-29812822 ATTTATCATCAGCTTAAATTAGG - Intronic
1188755583 X:33957281-33957303 CTGTATCTGCAGGTTAAATTAGG - Intergenic
1189300019 X:39945659-39945681 CTATATACGCAGGTAAAATTTGG - Intergenic
1194524398 X:94960334-94960356 CTATATTCTCAGCATAAATTAGG - Intergenic
1195789109 X:108561786-108561808 CTATAATCAGAGCTTAGATTTGG + Intronic
1197495260 X:127172049-127172071 CCAGATCCACAGCTTCACTTTGG - Intergenic
1199133490 X:144223214-144223236 ATATTTCCACAGCTTATTTTTGG + Intergenic
1200826210 Y:7645352-7645374 ATATTTCCACAGCTTTATTTTGG + Intergenic
1200882688 Y:8234873-8234895 ATATATCCACAGCTTTATTTTGG + Intergenic
1202106615 Y:21375889-21375911 ATATTTCCACAGCTTTATTTTGG + Intergenic
1202201011 Y:22348074-22348096 ATATTTCCACAGCTTTATTTTGG - Intronic