ID: 1187831138

View in Genome Browser
Species Human (GRCh38)
Location X:23381963-23381985
Sequence CACAATCTTGAATGTTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187831134_1187831138 29 Left 1187831134 X:23381911-23381933 CCACAGAGGCTTGTATCAAGGTT 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1187831138 X:23381963-23381985 CACAATCTTGAATGTTTTGGGGG 0: 1
1: 0
2: 1
3: 17
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187831138 Original CRISPR CACAATCTTGAATGTTTTGG GGG Intronic
901416875 1:9122359-9122381 CAGCATTTTGAATTTTTTGGTGG - Intronic
902254717 1:15180541-15180563 CACTATGCTGATTGTTTTGGGGG + Intronic
903412175 1:23154227-23154249 CAAAATCTTGATTGTGGTGGTGG + Intronic
906584349 1:46963359-46963381 TACAATCTGGCATGTTTTTGCGG + Intergenic
906798949 1:48719454-48719476 CAGAATGGTGAATGGTTTGGAGG - Intronic
907344646 1:53764912-53764934 CAAAATCTTTATTGTTTTGAGGG - Intergenic
908951266 1:69566423-69566445 CACAGTCTTGACTGTGTTCGAGG + Intergenic
909374773 1:74927211-74927233 CACAATCGGAAATGATTTGGGGG + Intergenic
910090469 1:83456950-83456972 TACATTCTGCAATGTTTTGGGGG + Intergenic
910545098 1:88406956-88406978 CACTACCTTAAATCTTTTGGAGG + Intergenic
910742271 1:90532864-90532886 CACTATGCTGAATATTTTGGTGG - Intergenic
911281120 1:95930375-95930397 CTGAATCTTGAATGATTTGTAGG + Intergenic
912902292 1:113664664-113664686 CAGAATCCTCAATGTTTTGCTGG - Intronic
916869012 1:168892235-168892257 CATATTCTTGTATATTTTGGGGG + Intergenic
917040061 1:170795725-170795747 CAGAATCTTGAATGATTGGCTGG + Intergenic
918152144 1:181806722-181806744 GAAAAACTTTAATGTTTTGGGGG + Intronic
918794210 1:188872346-188872368 CACAATCTTGATTGTGGTGATGG - Intergenic
919461960 1:197888286-197888308 TAAAATCTTGAATTGTTTGGAGG - Intergenic
922000043 1:221468000-221468022 CACAATCCCAAATTTTTTGGAGG + Intergenic
924441070 1:244085961-244085983 CACATTCTTGGATATTTTGTTGG - Intergenic
1065546131 10:26822755-26822777 CATTATCTTGAATGTGTTGATGG + Intronic
1066066808 10:31767434-31767456 CATAATCTTGTTTGTTTTGTTGG + Intergenic
1069270099 10:66515999-66516021 CACAATCTTGCATCTTCTGTAGG - Intronic
1071062542 10:81590012-81590034 CACAATCTTATATTTCTTGGAGG - Intergenic
1071756728 10:88550014-88550036 TACAATCTCTAAAGTTTTGGGGG + Intronic
1072244333 10:93528479-93528501 CAAAATATTTTATGTTTTGGGGG + Exonic
1074380861 10:112979210-112979232 CACAACCATGAATGTCTTGGCGG - Intronic
1077987132 11:7364439-7364461 CACATTATTGGATTTTTTGGTGG - Intronic
1078165294 11:8877768-8877790 TACAATCGTGATTTTTTTGGGGG - Intronic
1079664639 11:23089418-23089440 CACAATCTTAAATGATCTGGGGG + Intergenic
1079921198 11:26436495-26436517 CACCATCTTTACTGTTTTGCAGG - Intronic
1082213727 11:49539981-49540003 CCCAATCATGAATATTTTGAGGG + Intergenic
1083222959 11:61265302-61265324 CACAATGTTGATTGTTCTGATGG - Intronic
1086635876 11:89084462-89084484 CCCAATCATGAATATTTTGAGGG - Intergenic
1087435068 11:98105920-98105942 TGCCATCTTGCATGTTTTGGTGG - Intergenic
1087610107 11:100423698-100423720 CATAATCTCAAATTTTTTGGAGG - Intergenic
1087975511 11:104541082-104541104 GACATTCTCGAATTTTTTGGTGG + Intergenic
1088171835 11:107006996-107007018 CACAACCTGAAATGTTTTGGTGG + Intronic
1088644971 11:111910832-111910854 CCCAATCTGGAATGTTCTGCTGG + Intronic
1089033623 11:115361027-115361049 GACATTATAGAATGTTTTGGGGG - Intronic
1089803732 11:121063460-121063482 CCCAGTCTTGGATGTTTGGGTGG + Intronic
1090445050 11:126757227-126757249 CACAATGTTTAAAGTTCTGGTGG + Intronic
1091348203 11:134870125-134870147 GACAATCTTGACAGTTTTGAGGG + Intergenic
1093670208 12:21865242-21865264 CAAAATGTTGTATGTTTTTGTGG + Intronic
1095816619 12:46429585-46429607 CACATTCTGGAATTTTTTTGAGG - Intergenic
1096168231 12:49443924-49443946 AACAATTTTGAAAATTTTGGAGG - Intronic
1096189407 12:49605536-49605558 CACAATGTTGCCTGCTTTGGAGG + Exonic
1097460626 12:59857609-59857631 CATAATCTTGTATTTCTTGGAGG - Intergenic
1100526650 12:95425849-95425871 CTCAATGTTGAATTTTTTGAGGG + Intergenic
1101157824 12:101944239-101944261 CACAATCTTGTATGTTTCAAGGG - Intronic
1104521451 12:129479398-129479420 CAGAATCTGGAATTTCTTGGTGG + Intronic
1110162779 13:72399429-72399451 CACAATCATGAACTTTTTGTGGG - Intergenic
1111346991 13:86971364-86971386 CACTATCTGGTATGTTTTGTGGG + Intergenic
1111994183 13:95146923-95146945 CCCACCCTTGAATGTTTTAGAGG - Intronic
1113696902 13:112353571-112353593 GAAAATAATGAATGTTTTGGGGG - Intergenic
1114408990 14:22483130-22483152 CCTAAGCTGGAATGTTTTGGAGG - Intergenic
1114744805 14:25135792-25135814 TACAATCTTGAATGTTTTTAAGG - Intergenic
1115953337 14:38746948-38746970 CACAAATGTGAATGTTTTAGAGG + Intergenic
1117011879 14:51479223-51479245 CACAATGATGAATGGTTTGGGGG - Intergenic
1120488572 14:85147218-85147240 CACATTCTAGAATGTTATCGTGG + Intergenic
1122371637 14:101232249-101232271 CACATTGTTGAAAGGTTTGGTGG - Intergenic
1123158245 14:106251600-106251622 GAAAATCTTGAATGCTTTGCTGG - Intergenic
1123962408 15:25418437-25418459 CATATTGTTGAATGTTTCGGTGG - Intronic
1127270969 15:57401791-57401813 CAAAAACTTGATTTTTTTGGAGG + Intronic
1129717562 15:77860945-77860967 CAGAAACTCCAATGTTTTGGGGG + Intergenic
1129977725 15:79836396-79836418 CACTTTCTAGAATATTTTGGTGG + Intronic
1132918348 16:2367610-2367632 AACAATATTGAATTGTTTGGAGG + Intergenic
1134682041 16:16133020-16133042 CACAAATTCTAATGTTTTGGAGG - Intronic
1137730404 16:50685471-50685493 CTCAATGTAGAATGCTTTGGTGG - Intergenic
1139287151 16:65825919-65825941 CTTCATCTTGAATGTGTTGGGGG - Intergenic
1139944876 16:70633571-70633593 CACAATCTTAAATGTTCAGGTGG + Intronic
1146366691 17:32234417-32234439 CCCAATCTTCATTGTTTAGGAGG - Intronic
1146978380 17:37136161-37136183 CTCTATCTTGATTGTTGTGGTGG - Intronic
1149855240 17:60077235-60077257 CAGAATCTGGAATGATTTGAAGG + Intronic
1151538336 17:74750930-74750952 CAGATTCCTGCATGTTTTGGAGG + Intronic
1151809279 17:76427758-76427780 CACACTCTGGATTGTGTTGGAGG - Intronic
1153389555 18:4538878-4538900 CACATTCTTGAATTTTTAAGGGG - Intergenic
1153496064 18:5701049-5701071 CACAATTATGTATATTTTGGGGG + Intergenic
1154377889 18:13823978-13824000 CACACTCTTGAATGGTTGGATGG - Intergenic
1155595577 18:27482139-27482161 CACAATTTTTAATTTTTGGGGGG - Intergenic
1155926833 18:31665040-31665062 CACAGTCTTGAATTTTTAGAAGG + Intronic
1156950814 18:42895492-42895514 TCCAAATTTGAATGTTTTGGGGG + Intronic
1158690548 18:59656340-59656362 CACAAACATGAATGTTTTATAGG - Intronic
1158860843 18:61590936-61590958 ATCAGTCTTGAATGCTTTGGAGG - Intergenic
1158982136 18:62773537-62773559 AAAAATCTGGCATGTTTTGGAGG - Intronic
1159024916 18:63174885-63174907 CACAAAATTTAGTGTTTTGGGGG - Intronic
1162391043 19:10390384-10390406 CAGAATCAAGAATGTTTGGGGGG + Intergenic
1162845885 19:13392281-13392303 CACAGTCATGAGTGTTTTGAAGG + Intronic
1166664360 19:44669881-44669903 CACAATCCTGTAGGGTTTGGGGG - Intronic
1167029004 19:46944450-46944472 CTCAGACTTCAATGTTTTGGGGG - Intronic
1167087534 19:47320487-47320509 CACCACCTTGAGTGTCTTGGTGG - Exonic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
926607139 2:14909009-14909031 CACAATTTAGAATCATTTGGGGG - Intergenic
928788884 2:34926894-34926916 CACAATCTGCTATGCTTTGGGGG + Intergenic
934679365 2:96271597-96271619 CACAGTGTTAAATTTTTTGGAGG + Exonic
937540029 2:122938039-122938061 AACAATCTCCACTGTTTTGGAGG + Intergenic
937902434 2:127031374-127031396 AATTATCTTGAATGTGTTGGAGG - Intergenic
938888071 2:135673926-135673948 CACTATCTTGTATTTTTTTGTGG + Intronic
938907815 2:135855189-135855211 AAAAATCTTGAATGTTTTAAAGG + Intronic
939952612 2:148493294-148493316 CAGAATCTTGGATTCTTTGGTGG - Intronic
941290254 2:163665336-163665358 CACAATCTTAGATGTTCTGAGGG + Intronic
945600247 2:211853571-211853593 CACACTCTTGAGTGATATGGAGG + Intronic
945942951 2:215968010-215968032 TCCAATATTTAATGTTTTGGGGG + Intronic
946184937 2:217975323-217975345 CATAATAATAAATGTTTTGGGGG - Intronic
947303047 2:228709906-228709928 GACAATATTGATTGTTTTTGAGG - Intergenic
947303050 2:228709994-228710016 GACAATATTGATTGTTTTTGAGG - Intergenic
1169295409 20:4393145-4393167 CTGAATCTTGAATGTAGTGGTGG + Intergenic
1174189300 20:48728783-48728805 CACAATCTAGAGTGTTTGTGGGG - Intronic
1177807801 21:25891171-25891193 AACAATCATGTATGTTTTGGTGG + Intronic
1177896823 21:26862946-26862968 CACAGACTTGAAGGTTTTAGAGG + Intergenic
1178450937 21:32699244-32699266 CACAATGCAGAATGTCTTGGGGG - Intronic
1183003175 22:34878541-34878563 CCCAATCATGAATGTGGTGGGGG - Intergenic
1183199928 22:36379197-36379219 TACAATTTTTAATGTGTTGGGGG - Intronic
1183765342 22:39868039-39868061 CTCACTCTTTAATGTTATGGGGG + Intronic
949634303 3:5966214-5966236 CACAATCTTGATTATTTTATTGG - Intergenic
949898202 3:8786229-8786251 CACAATGTTGATTGTGTTGATGG - Intronic
951422612 3:22505304-22505326 CACTATTTTGAATGTATTGTTGG - Intergenic
951479603 3:23145671-23145693 CATTATCTTGATTGTTGTGGTGG - Intergenic
952193531 3:31048308-31048330 CACATTATTGATTGTTTCGGTGG + Intergenic
953735071 3:45486880-45486902 CACAATATTGAGAGTTTTGAAGG + Intronic
955658179 3:61267001-61267023 CAAATTCTTGAGTGTTTTGTAGG + Intergenic
955949777 3:64231269-64231291 TGCAATCTTTAATGTTTTTGTGG - Intronic
956826948 3:73005937-73005959 CACAATCTTGATTGTTGTGATGG - Intronic
957264760 3:77948766-77948788 CACAATGTTGAAAGTTTCGTGGG + Intergenic
957293344 3:78306080-78306102 CCACATCTTGAATGTTTTGCTGG - Intergenic
957548067 3:81665739-81665761 AACAATGTTGAGTGTTTTGCGGG - Intronic
957652698 3:83029607-83029629 CAGAATCTTGAAAGTTTTTTAGG - Intergenic
959810298 3:110611179-110611201 CACTATCTTGATTGTGGTGGTGG + Intergenic
960366687 3:116781550-116781572 GACTATCTGGAATGTTTTAGGGG - Intronic
961230498 3:125303281-125303303 CTGAATCTTGATTGCTTTGGTGG + Intronic
961861869 3:129923126-129923148 CACAATCAAGAATGATTTGCTGG - Intergenic
963055255 3:141181428-141181450 CTCGCTCTTGAATGTTGTGGTGG - Intergenic
963502709 3:146147959-146147981 CAGAATCTTTCTTGTTTTGGAGG - Intronic
963506657 3:146194409-146194431 CTCTATCTTGAACGTTGTGGTGG + Exonic
965746505 3:171932063-171932085 CACAATCCTGAATTTTGTGCTGG - Intronic
971124638 4:23739934-23739956 CACATTCTTGAATGTTCTAGAGG - Intergenic
972066939 4:34958860-34958882 TACAATCTTGAATGCTATGTAGG - Intergenic
972716324 4:41650005-41650027 CACAACCTTGACTGTTTTTCTGG - Intronic
973670465 4:53211872-53211894 TACATTCTTGAATGTTATTGTGG - Intronic
975434798 4:74339533-74339555 GTCATTCTTGAATATTTTGGAGG - Intergenic
975591740 4:76007606-76007628 CACAAACTTGATTGTGCTGGGGG + Intergenic
980701656 4:136440438-136440460 CAAAATCTTAAATAATTTGGAGG + Intergenic
982126182 4:152185835-152185857 CAGAAGATTGAATGTTTTGAAGG - Intergenic
982581868 4:157188809-157188831 CAAAATTTTGAATTTTTTTGGGG - Intergenic
982760136 4:159272335-159272357 CACAATCTTGTATGTTTATAAGG - Intronic
982867401 4:160532764-160532786 CACAAGCTGGAGTTTTTTGGGGG - Intergenic
983092076 4:163515637-163515659 CACAAACTTGATAGTTTTGTTGG - Intronic
983438287 4:167745836-167745858 CACATTCTGGGATTTTTTGGTGG + Intergenic
986496034 5:8342872-8342894 CCCAATCTTGAATGACTTTGAGG + Intergenic
987825457 5:23025115-23025137 CAGGGTCTTGAAAGTTTTGGTGG - Intergenic
990353629 5:54943181-54943203 CACTTTCTGGAATGTTTTTGAGG - Intergenic
990855396 5:60261227-60261249 AACAACCTTGAATGTTTGGATGG + Intronic
994879080 5:105462686-105462708 AACACTATTTAATGTTTTGGAGG - Intergenic
995286098 5:110389953-110389975 CAGAATTGTCAATGTTTTGGGGG - Intronic
995288785 5:110425168-110425190 CACAACCCTGAAAGTTCTGGTGG + Intronic
995690564 5:114821802-114821824 CACAATGTGGAAACTTTTGGAGG + Intergenic
995998618 5:118330744-118330766 CACAATTCTAAATGTTTTAGAGG + Intergenic
999463481 5:151777749-151777771 CACAATCTTGATTGTGGTGATGG - Intronic
1000281583 5:159787030-159787052 CACAATATTGACTGTTTTAGAGG - Intergenic
1000471165 5:161643900-161643922 CTCAATCTTGGATTTTTTGAGGG + Intronic
1000710100 5:164563285-164563307 CACATTCTTGAATTTTCTGTAGG - Intergenic
1001125347 5:169014069-169014091 CACAATACAGAATGTTTTGTGGG + Intronic
1001335666 5:170794827-170794849 CAAATTGTTGAATTTTTTGGTGG - Intronic
1002128137 5:177062073-177062095 CACTATCTTACATGTTTTGCAGG - Exonic
1004622731 6:17345240-17345262 CACAACCTTGAATGTGTTTTGGG - Intergenic
1008409078 6:51152313-51152335 CACAATGCTGAATTTTTAGGCGG - Intergenic
1008497417 6:52146992-52147014 GACAATCCTGACTGCTTTGGAGG - Intergenic
1009334981 6:62475930-62475952 TACAATCTGGAATTTTTTTGGGG - Intergenic
1009704125 6:67222780-67222802 CCCAATCTTGATTGATTTTGGGG + Intergenic
1010461550 6:76119634-76119656 TACAAACTTTAAAGTTTTGGAGG - Intergenic
1010964002 6:82181594-82181616 CACTATTTTGAATGTTGTGTTGG + Intronic
1011533014 6:88345289-88345311 GACAATATTGAATGCTTTTGAGG - Intergenic
1012335087 6:98045396-98045418 CACAATCTTCAATGTATATGAGG - Intergenic
1012743073 6:103045575-103045597 CACCATCTCCAATATTTTGGTGG - Intergenic
1013020973 6:106217786-106217808 CAAAATTTTGAATTTTTTTGTGG - Intronic
1013076698 6:106778086-106778108 CCCAAACTTGTCTGTTTTGGAGG + Intergenic
1014092170 6:117416452-117416474 CAAAATCCTGGATCTTTTGGAGG - Intronic
1015993741 6:138976449-138976471 CACTATCATGAATCTTTTTGTGG - Intronic
1020733204 7:11910659-11910681 CAAAATAAAGAATGTTTTGGGGG + Intergenic
1023174484 7:37422578-37422600 CATAATTTTAAATGTTTTGATGG + Intronic
1023741316 7:43283607-43283629 AACAATCTTGAATATTATTGAGG - Intronic
1024288716 7:47784145-47784167 CACAAGCAGGAATGTTTTTGTGG - Intronic
1024571249 7:50724507-50724529 CACAATGTTGACTTTTTTGAAGG - Intronic
1025926216 7:65962402-65962424 AACAGTCTTGAACCTTTTGGTGG - Intronic
1026369701 7:69686550-69686572 CAAAAAGTTGAATGTTTTTGAGG + Intronic
1027729751 7:81856300-81856322 CACAAACTTAAATGTGTTTGTGG - Intergenic
1028357636 7:89928515-89928537 GACACTATTGAATTTTTTGGGGG - Intergenic
1028574289 7:92329528-92329550 CATAATCTTTATTGTTTAGGTGG - Intronic
1028819426 7:95189399-95189421 CATAATCCTAAATTTTTTGGAGG + Intronic
1030417246 7:109261116-109261138 CACAAGCTAGAACGTTTTTGGGG + Intergenic
1030815263 7:114028338-114028360 CATAATCTAGCATGTTTGGGAGG + Intronic
1031777996 7:125924943-125924965 CAGAAACTTGAATTTTATGGAGG - Intergenic
1032895026 7:136240818-136240840 CAGAATCTTGACTGTTTTGGAGG + Intergenic
1032913262 7:136458599-136458621 CACAATCCTGTATGTATTGAAGG + Intergenic
1034052958 7:148002621-148002643 CAAAACCTTGATTTTTTTGGAGG + Intronic
1034257949 7:149734668-149734690 CACACTCCTGAATGTTCTCGAGG - Intergenic
1034778191 7:153851016-153851038 CACATTCTTTAATGGTTTGAAGG + Intergenic
1037460290 8:19101769-19101791 GAAAATCTAGAATGTGTTGGAGG - Intergenic
1037530748 8:19770423-19770445 CACAATCTTGATTGTGGTGATGG + Intergenic
1038106040 8:24435447-24435469 CACAATCTTGACTGTAATAGAGG + Intergenic
1039600505 8:38832967-38832989 CTCAATTGTGAATGTTTTGAGGG + Intronic
1039650624 8:39337358-39337380 CTCAATTTTGAGTGTTTTTGAGG + Intergenic
1040815724 8:51506728-51506750 CACTATGTTGAATTATTTGGTGG + Intronic
1041801957 8:61809889-61809911 CACAATCTGAATTGTTTTGTGGG - Intergenic
1041863433 8:62540206-62540228 CACATTTTTGAGTGATTTGGAGG - Intronic
1041954419 8:63541850-63541872 CACATTCTTCAAAATTTTGGGGG - Intergenic
1042670800 8:71261477-71261499 CACAAGTTTGAGGGTTTTGGGGG - Intronic
1043894114 8:85723892-85723914 CACAATGTTGAATGCTTTAAAGG - Intergenic
1044223317 8:89695667-89695689 CACAATTTTGAAGGTTTGGAAGG - Intergenic
1045183123 8:99808001-99808023 CATAATATTAAATGTCTTGGTGG - Intronic
1048722333 8:137340193-137340215 TACACACTTGAATGTTTTAGAGG + Intergenic
1048863977 8:138745815-138745837 CTGAATCCTGAATGTTTTGGCGG - Intronic
1048939607 8:139387127-139387149 GACATTCTTGAAGGTTTTAGTGG + Intergenic
1048939920 8:139391238-139391260 TCCAATGTTGAATGTTTTGTTGG - Intergenic
1049294092 8:141820869-141820891 CACATGCTTGAATGTGTAGGGGG - Intergenic
1049874059 8:145003751-145003773 CTAAATCTTTAATTTTTTGGGGG + Intergenic
1050216183 9:3327088-3327110 CACAATCTTTAAAGATTTGTTGG - Intronic
1051212582 9:14760201-14760223 CTCAATCGTGAATGTTTTGAAGG + Intronic
1051813012 9:21072137-21072159 CACTATCTTGACTGTGTTGATGG - Intergenic
1051971709 9:22895947-22895969 CACAATTCTGATAGTTTTGGGGG - Intergenic
1052403066 9:28025166-28025188 CACAACCTTGAGTGTTTAAGGGG - Intronic
1052948850 9:34191500-34191522 CACCATCTTGAAGCTTTTAGAGG + Intronic
1056202367 9:84288979-84289001 CACAATCTTCATTGATCTGGTGG + Intronic
1059221155 9:112620287-112620309 CCAAATCTTGATTGTTTTGTTGG + Intronic
1059610527 9:115887621-115887643 CACAAAGGTGAATGTTTTGGAGG - Intergenic
1060158459 9:121337185-121337207 CACAAATTTGGATGCTTTGGGGG - Intergenic
1187017834 X:15348089-15348111 AGCATTCTTGAAGGTTTTGGAGG + Intronic
1187831138 X:23381963-23381985 CACAATCTTGAATGTTTTGGGGG + Intronic
1188271203 X:28143255-28143277 CATAATCTTAAATGTTTTCTGGG - Intergenic
1188917303 X:35927684-35927706 CACTATCTTGACTGTGGTGGTGG - Intronic
1189990355 X:46588162-46588184 CACAGGCATGTATGTTTTGGAGG + Intronic
1192776598 X:74251991-74252013 AACCAACATGAATGTTTTGGTGG + Intergenic
1192853507 X:74982362-74982384 CATAATCTCAAATTTTTTGGAGG - Intergenic
1193262897 X:79430233-79430255 CATACTCTTAAATGTTTTGGAGG - Intergenic
1194031759 X:88825739-88825761 CACAAACTTGAATATTTTAGGGG - Intergenic
1194285013 X:91999382-91999404 CACATATTTGAAGGTTTTGGTGG - Intronic
1195511927 X:105725721-105725743 CACAATTTTTAATGTCTTGAAGG + Intronic
1195780294 X:108455019-108455041 CATTATCTTGAATGTTGTGATGG - Intronic
1197784231 X:130184895-130184917 CACAATCAGGAATGTCTTGGAGG - Intergenic
1199099541 X:143782482-143782504 CAAAAACTGGAATGATTTGGAGG + Intergenic
1200602579 Y:5223924-5223946 CACATATTTGAAGGTTTTGGTGG - Intronic
1200854929 Y:7927408-7927430 CACAATCTTAAACATTTTGCTGG + Intergenic
1200892719 Y:8340798-8340820 CACAATCTTACATGTTTTTTGGG - Intergenic