ID: 1187836312

View in Genome Browser
Species Human (GRCh38)
Location X:23435590-23435612
Sequence CCACCACTGGGACTGTACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187836312_1187836318 19 Left 1187836312 X:23435590-23435612 CCTCAGTACAGTCCCAGTGGTGG No data
Right 1187836318 X:23435632-23435654 ATCACCACTGTCCCAACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187836312 Original CRISPR CCACCACTGGGACTGTACTG AGG (reversed) Intergenic
No off target data available for this crispr