ID: 1187836315

View in Genome Browser
Species Human (GRCh38)
Location X:23435602-23435624
Sequence CTCCTGTGGTCACCACCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1712
Summary {0: 3, 1: 29, 2: 130, 3: 290, 4: 1260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187836315_1187836318 7 Left 1187836315 X:23435602-23435624 CCCAGTGGTGGTGACCACAGGAG 0: 3
1: 29
2: 130
3: 290
4: 1260
Right 1187836318 X:23435632-23435654 ATCACCACTGTCCCAACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187836315 Original CRISPR CTCCTGTGGTCACCACCACT GGG (reversed) Intergenic
900015603 1:146896-146918 CACCTGTGGTCCCTACTACTTGG + Intergenic
900045866 1:505490-505512 CACCTGTGGTCCCTACTACTTGG + Intergenic
900068068 1:747206-747228 CACCTGTGGTCCCTACTACTTGG + Intergenic
901382915 1:8886917-8886939 CACCTGTGGTCCCAGCCACTTGG - Intergenic
901439332 1:9268111-9268133 CTCCTGTGGTCCCAGCTACTCGG + Exonic
901468156 1:9436717-9436739 CTCCTGTGGTCCCAACTACATGG + Intergenic
901580129 1:10235376-10235398 CACCTGTGGTCCCAACTACTAGG - Intronic
901623456 1:10608091-10608113 CACCTGTAGTCCCCACTACTTGG - Intronic
901844569 1:11973704-11973726 CGCCTGTGGTCCCAACTACTTGG - Intronic
902079721 1:13812775-13812797 TTCCTGGGGTCACACCCACTAGG + Intronic
902269807 1:15295480-15295502 CACCTGTAGTCACAACTACTTGG + Intronic
902347567 1:15829599-15829621 CACCTGTGGTCCCAACTACTTGG - Intergenic
902772992 1:18656864-18656886 CGCCTGTGGTCACAGCTACTCGG + Intronic
902903455 1:19536352-19536374 CACCTGTGGTCACAACTACTGGG + Intergenic
903201986 1:21748783-21748805 CACCTGTGGTCCCAACTACTCGG + Intronic
903424346 1:23242538-23242560 CGCCTGTGGTCCCAACTACTTGG + Intergenic
903567585 1:24279698-24279720 CCCCTGTTTTCACCACCACCAGG - Intergenic
903905350 1:26681911-26681933 CTCCTGTAGTCACAGCTACTTGG + Intergenic
904549972 1:31307698-31307720 CACCTGTGGTCCCAACTACTTGG - Intronic
904610742 1:31725002-31725024 CTCCGCTGGTCACCACCTCTGGG - Intergenic
904682382 1:32238458-32238480 CTCCTGTAGTCCCAACTACTTGG + Intergenic
904704933 1:32382733-32382755 CGCCTGTGGTCCCCGCTACTAGG + Intronic
904801175 1:33093858-33093880 CGCCTGTGGTCACAGCTACTTGG - Intronic
906109939 1:43315931-43315953 CACCTGTGGTCCCAACTACTCGG + Intronic
906119458 1:43379048-43379070 CGCCTGTAGTCACAGCCACTTGG + Intergenic
906352791 1:45078582-45078604 CCCTTGTGGCCACCACCACCAGG + Intronic
906400995 1:45504597-45504619 CACCTGTGGTCCCAGCCACTCGG + Intronic
906495024 1:46299452-46299474 CACCTGTGGTCACAGCTACTTGG + Intronic
906734804 1:48115375-48115397 CTCCTGTGGTCCCCAAGTCTAGG + Intergenic
906826945 1:48992389-48992411 TCCCTGTGGCCACCACCACTGGG + Intronic
906848751 1:49224489-49224511 CCCCTGTAGTCCCCACTACTTGG + Intronic
906915558 1:50005227-50005249 CTCCTGTGGCCACCAGCACTGGG - Intronic
907116815 1:51976289-51976311 CTCCTGTAGTCCCCATTACTTGG - Intronic
907145263 1:52225268-52225290 CTCCTGGGGCCACCACAACGAGG + Intronic
907342917 1:53749736-53749758 CACCTGTGGTCTCAGCCACTCGG + Intergenic
907377570 1:54056449-54056471 CACCTGTAATCCCCACCACTCGG - Intronic
907466220 1:54639315-54639337 CACCTGTGGTCCCAACTACTTGG + Intergenic
907756374 1:57314655-57314677 CACCTGTGGTCCCAACTACTTGG + Intronic
908024818 1:59939494-59939516 CCCCTGTGGCCGCCACCACTAGG + Intergenic
908093144 1:60707377-60707399 CTCTTGTGGCCACCACAGCTGGG - Intergenic
908264016 1:62360991-62361013 CGCCTGTGGTCCCAGCCACTGGG + Intergenic
908397483 1:63739851-63739873 CCTCTGTGGCCACTACCACTGGG + Intergenic
909103926 1:71384837-71384859 CCTCTGTGGCCACTACCACTGGG - Intergenic
909209609 1:72807378-72807400 CCCCTGTGGCCACCAGCAATGGG + Intergenic
909231193 1:73092958-73092980 CTCCCATGGTCACCACCTCTTGG + Intergenic
909271413 1:73627727-73627749 CCCCCATGGTCACCACCAGTGGG - Intergenic
909316359 1:74224080-74224102 TCCCTGTGGCCACCACCACTGGG - Intronic
909438734 1:75673654-75673676 CTCTTGTGGTCGCCAGCACTGGG - Intergenic
909448861 1:75776723-75776745 CTCCTGTGGTCACAGCTACTTGG + Intronic
909615806 1:77606574-77606596 CCCCTGTGGCCACCACCACTGGG - Intronic
909782027 1:79559209-79559231 CTTCTGTGGCCACCGCGACTAGG - Intergenic
909935595 1:81546855-81546877 CTCCTGAGATGACCACCTCTGGG - Intronic
910384573 1:86666648-86666670 GCCCTGTGGCCACCATCACTGGG - Intergenic
910388027 1:86705276-86705298 CTCCTGTGGCCTCCACCCCGGGG + Intronic
910515275 1:88053834-88053856 CCCCTCTAGCCACCACCACTGGG + Intergenic
910643637 1:89490291-89490313 CCCCTGTGGCCACCACCACTGGG - Intergenic
910667759 1:89742699-89742721 CTCCTGTGGTCCACACTAATGGG - Intronic
910725025 1:90328832-90328854 CCCCTGCAGCCACCACCACTGGG - Intergenic
910876293 1:91881911-91881933 CACCTGTGGTCCCCGCTACTCGG + Intronic
911200635 1:95040044-95040066 CACCTGTGGTCCCAACTACTGGG + Intronic
911373774 1:97025220-97025242 CTTCTAGGGCCACCACCACTAGG - Intergenic
911399597 1:97358346-97358368 CCTCTGTGGTCTCCACCTCTGGG + Intronic
911487266 1:98516998-98517020 CCCCTGTGGCTACCACCACAGGG - Intergenic
911961032 1:104302186-104302208 CCACTGTGGCCATCACCACTGGG - Intergenic
911981232 1:104569134-104569156 CCCCAGTTGCCACCACCACTGGG - Intergenic
912015439 1:105028087-105028109 CCCCTGTAGCTACCACCACTGGG - Intergenic
912041772 1:105399044-105399066 TCCCTATGGCCACCACCACTAGG + Intergenic
912152864 1:106880816-106880838 CTCCTGCAGTCACCAGCACTGGG - Intergenic
912316528 1:108671623-108671645 CCCCTGTGGTCACCACCACTGGG - Intergenic
912337267 1:108874929-108874951 CTCCTGTGGTCCCAGCTACTGGG + Intronic
912366966 1:109141789-109141811 CTCCTGTGGTCCCAGCTACTTGG - Intronic
912633156 1:111266938-111266960 CCCCTGTGGCCACCACCGCTGGG + Intergenic
912644006 1:111373340-111373362 TCTCTGTGGCCACCACCACTGGG - Intergenic
912732738 1:112124112-112124134 CTCCTGTAGTCACAGCTACTTGG - Intergenic
912896246 1:113593415-113593437 CGCCTGTAGTCACAGCCACTTGG + Intronic
912899168 1:113629857-113629879 TCCCTGTGGCCACCACCACTGGG + Intronic
913146973 1:116002251-116002273 CTCTTTTGGTCACTACCACTGGG + Intronic
913416758 1:118617987-118618009 CCCCTGTGGCCACCACCACTAGG + Intergenic
914257900 1:145975485-145975507 GCCCTGTGCTCAGCACCACTGGG + Intronic
914264433 1:146026280-146026302 CACCTGTGGTCCCAACTACTTGG - Intergenic
914923862 1:151866611-151866633 CTCCTGTGGTCTCAGCTACTCGG - Intergenic
915005471 1:152630872-152630894 CCACTGCGGTCACCACCACTGGG - Intergenic
915080261 1:153347197-153347219 CTCCTGTAGTCCCAACTACTCGG - Intronic
915186151 1:154106595-154106617 CCTCTGTGGCCACCACCACTAGG - Intronic
915219739 1:154365220-154365242 CACCTGTAGTCACAACTACTTGG - Intergenic
915235321 1:154476218-154476240 CACCTGTGGTCCCAGCCACTTGG + Intronic
915683224 1:157603075-157603097 CGCCTGTAGTCCCCACTACTCGG - Intergenic
915752941 1:158228796-158228818 CTCCTGTGGCCACCACCACTGGG - Intergenic
915925623 1:160016994-160017016 CACCTGTGGTCTTAACCACTTGG + Intergenic
915956879 1:160228014-160228036 CTCCTGTAGTCCCAACTACTTGG - Intronic
916360671 1:163963509-163963531 CTCCTGTGGCCACCTCCACTGGG - Intergenic
916728187 1:167542719-167542741 CAGCTGTGGTCACTATCACTGGG - Intronic
916881560 1:169024161-169024183 CACCTGTGGTCCCAACTACTTGG + Intergenic
917191482 1:172423218-172423240 CTCCTGTGGCCACCACTACTGGG - Intronic
917226309 1:172787886-172787908 CCTCTGTGGCCACCACCACCAGG + Intergenic
917246237 1:173004443-173004465 CCCCTGTGGCCACCATCACTGGG + Intergenic
917306372 1:173628869-173628891 CCCCTGTGGCCACCACCACTAGG - Intronic
917387168 1:174490483-174490505 CCCCTGTGGTTACCACCACTGGG + Intronic
917953037 1:180061320-180061342 CACCTGTGGTCCCAGCCACTTGG - Intronic
917957547 1:180115961-180115983 CACCTGTGGTCCCAACTACTTGG + Intergenic
917986502 1:180325931-180325953 ACCCTGTGGCCACCACCACTGGG + Intronic
918251562 1:182707830-182707852 CGCCTGTAGTCCCCGCCACTCGG - Intergenic
918262522 1:182808831-182808853 CCCCTGTGGTCCCAGCCACTTGG + Intronic
918349650 1:183641258-183641280 CTCCTGTGGTCTCAGCTACTTGG - Intronic
918358110 1:183724905-183724927 CCCCTGTGGCCACTACCACTGGG - Intronic
918677349 1:187303950-187303972 CACCTGTAGTCCCCACTACTTGG - Intergenic
918747807 1:188228442-188228464 CCCCTATGGCCACCACTACTAGG + Intergenic
918752784 1:188293116-188293138 TCCCTGTGGCCACTACCACTAGG - Intergenic
918915660 1:190633888-190633910 CCCCTGTGACCACCACCACTAGG + Intergenic
918989839 1:191684570-191684592 CCCCTGTGGCCACCATCACTGGG + Intergenic
919067869 1:192715273-192715295 ACCCTGTGGCTACCACCACTGGG - Intergenic
919456002 1:197819650-197819672 CCTCTGTGGCTACCACCACTGGG - Intergenic
919494115 1:198242585-198242607 CGCCTGTGGTCACAGCTACTCGG - Intronic
919913686 1:202127438-202127460 CGCCTGTGGTCCCAACTACTCGG - Intronic
920124172 1:203680481-203680503 CGCCTGTGGTCCCAGCCACTCGG + Intronic
920151065 1:203908326-203908348 CTCCTGTGGTCCCAGCCACTCGG - Intergenic
920201914 1:204264817-204264839 CTGCTATGGCCACCACCACCTGG + Intronic
920454341 1:206086879-206086901 CACCTGTGGTCCCAACTACTCGG + Intronic
920566836 1:206980841-206980863 CTCCTGTGGTCCCCACCTCCTGG + Intergenic
920580974 1:207107421-207107443 CTCCTGTGGTCCCAGCTACTGGG + Intronic
920596670 1:207279150-207279172 CCCCTGTAGCCACCAGCACTGGG + Intergenic
921011963 1:211150629-211150651 CCCCTGTGACCACCACCACTGGG - Intergenic
921017852 1:211208496-211208518 CTCCTGTGGTCCCAGCTACTTGG - Intergenic
921125214 1:212171640-212171662 CGCCTGTGGTCCCAACTACTTGG + Intergenic
921192486 1:212723169-212723191 CGCCTGTGGTCCCAGCCACTTGG - Intergenic
921249919 1:213287813-213287835 CTGCTGTGGCTAGCACCACTGGG + Intergenic
921257655 1:213356993-213357015 CTGCTGTGGGCACCAGCACAGGG + Intergenic
921296050 1:213705027-213705049 CCCCTGTGGTCACCACCACTGGG + Intergenic
921397675 1:214686105-214686127 CTCCTGTGGTGACCAGAATTTGG - Intergenic
921823229 1:219641173-219641195 CCCCTGTGACCACCACCACTGGG - Intergenic
922103431 1:222492584-222492606 CACCTGTGGTCCCTACTACTTGG + Intergenic
922320381 1:224481660-224481682 TCCCTGTGGCCACCACCACTGGG + Intronic
922336524 1:224622981-224623003 CTCCTATGGGCCCCTCCACTGGG + Intronic
922357997 1:224795088-224795110 CCTCTGTGGCCACCATCACTGGG + Intergenic
922498832 1:226082364-226082386 CACCTGTGGTCCCAGCCACTCGG - Intergenic
922605363 1:226886839-226886861 CGCCTGTGGTCCCAACTACTTGG + Intronic
922642362 1:227246457-227246479 CCCCTGTGGCCACCATCACTGGG - Intronic
922692601 1:227706704-227706726 CTCCTCAGGTCACCAGCCCTGGG + Intergenic
923886510 1:238163968-238163990 CTCCTATGGTCACCACCAGTGGG + Intergenic
923960170 1:239072172-239072194 CCCCTGTGGCCATCACCACTGGG - Intergenic
924175141 1:241384015-241384037 CTCCTGTGGTCCCAGCGACTTGG + Intergenic
924345594 1:243070091-243070113 CACCTGTGGTCCCTACTACTTGG + Intergenic
924490706 1:244535171-244535193 CCCCTGTGGACACTGCCACTGGG + Intronic
924629313 1:245721888-245721910 CCCCTGTGGCCACTATCACTGGG - Intergenic
1062794734 10:336021-336043 CGCCTGTGGTCCCAACTACTTGG - Intronic
1064077510 10:12281162-12281184 CACCTGTGGTCCCAACTACTTGG + Intergenic
1064081378 10:12310727-12310749 CTCCTGTGGTCCCAGCTACTCGG - Intergenic
1065072857 10:22045410-22045432 CCCCAGTGTTCACCACCTCTGGG + Intergenic
1065116743 10:22490529-22490551 CACCTGTGGTCCCAGCCACTTGG - Intergenic
1065381415 10:25095425-25095447 CCTCTGTGGCCACCACCACTAGG + Intergenic
1065424042 10:25580849-25580871 CACCTGTAGTCACAACTACTTGG - Intronic
1065508100 10:26449879-26449901 CTCCTGTGGTCTCAGCTACTTGG + Intronic
1065717492 10:28586558-28586580 TTCCTGTGGTCCCAACTACTTGG + Intronic
1066247399 10:33596601-33596623 CCTCTGTGGTCTCCACCACCAGG + Intergenic
1066293963 10:34038223-34038245 CGCCTGTAGTCACAGCCACTCGG - Intergenic
1066522061 10:36232238-36232260 CTCCTGTGGTCCCAGCTACTGGG + Intergenic
1066527289 10:36295736-36295758 CTTCTGTGTACACCATCACTGGG + Intergenic
1066708349 10:38204576-38204598 CCCCTGTGGCCACCACCACTGGG - Intergenic
1067032496 10:42887816-42887838 CCCCTGTGGCTGCCACCACTAGG + Intergenic
1067075354 10:43176688-43176710 CGCCTGTGGTCACAGCTACTTGG - Intronic
1067094385 10:43289192-43289214 CACCTGTGGTCCCAGCCACTTGG + Intergenic
1067117192 10:43444692-43444714 CGCCTGTGGTCCCAGCCACTTGG - Intronic
1067238597 10:44471990-44472012 CTCCTGTGGTCCCAGCTACTCGG - Intergenic
1067856357 10:49796911-49796933 CACCTGTGGTCCCAACTACTCGG - Intergenic
1068308660 10:55250267-55250289 CTCTTGTAGTCACAGCCACTTGG - Intronic
1068942561 10:62693886-62693908 CTCTAGTGGTCACTGCCACTGGG + Intergenic
1069175177 10:65281289-65281311 CTCCTGTGGTCCCAGCTACTTGG - Intergenic
1069189554 10:65469040-65469062 CTCCTGTAGTCCCAGCCACTCGG + Intergenic
1069343593 10:67440569-67440591 CCCCTGTGGCCACCAATACTGGG - Intronic
1069419897 10:68237883-68237905 CGCCTGTAGTCCCCACTACTTGG + Intergenic
1069458962 10:68576534-68576556 CTCCTGTAGTCCCAACTACTTGG + Intronic
1069712418 10:70498403-70498425 CTCCTGTGGTCCCAGCTACTTGG - Intronic
1069727361 10:70589334-70589356 CTCCTGTGGTCCCCACCCAGAGG - Intergenic
1070059275 10:72966983-72967005 CCCCTGTGGTCACCACTATTGGG + Intergenic
1070224896 10:74493306-74493328 CACCTGTGGTCTCAACTACTAGG - Intronic
1070755519 10:78989811-78989833 CACCTGTGGTCCCAACTACTTGG - Intergenic
1070776141 10:79111049-79111071 CTCCTGGGCTGACCACCACCGGG + Intronic
1070892758 10:79954338-79954360 CACCTGTGGTCACCAACAGCGGG - Intronic
1070915149 10:80148688-80148710 CCCCTGTGGCCACCACCACTAGG - Intergenic
1071046736 10:81387960-81387982 CTCCTGTGGCCGCCACCACTAGG - Intergenic
1071067231 10:81650312-81650334 CTCCTGTGGTCCCAGCTACTTGG - Intergenic
1071418384 10:85462990-85463012 CACCTGTGGTCCCAACTACTTGG + Intergenic
1071896631 10:90075419-90075441 CTCTTGTGATCAACTCCACTGGG + Intergenic
1071963104 10:90825056-90825078 GCCCTGTATTCACCACCACTGGG - Intronic
1072058896 10:91788763-91788785 CCACTGTGATCACCACCGCTGGG - Intergenic
1072083614 10:92057156-92057178 CTCCTGGGGTCCCCAACTCTAGG + Intronic
1072140436 10:92584563-92584585 CACCTGTGGTCCCAACTACTCGG - Intergenic
1072250087 10:93574766-93574788 CTCCTGTGGTCCCAGCTACTCGG + Intronic
1072267412 10:93743961-93743983 CTCCTGTGGCCAGCACTACCAGG + Intergenic
1072286623 10:93921722-93921744 CTCCTGTGGTCCTAACTACTCGG - Intronic
1072492213 10:95919549-95919571 CTCCCATGGCCACCACCACTGGG + Intronic
1072568212 10:96635777-96635799 CGCCTGTGGTCCCAGCCACTTGG + Intronic
1072652120 10:97303860-97303882 CACCTGTGGTCCCAGCCACTCGG + Intergenic
1072717935 10:97763802-97763824 CTCCTGTGGTCCCAGCTACTTGG + Intergenic
1072777724 10:98216696-98216718 CTCCTGTGGTCCCAGCTACTCGG - Intronic
1072843127 10:98796761-98796783 CCCCTGTGGTCACTACCACTGGG - Intronic
1072853642 10:98924279-98924301 CCCCTGTGGCCACCACCACTGGG + Intronic
1072900216 10:99400510-99400532 CGCCTGTGGTCCCAGCCACTTGG + Intronic
1073264648 10:102218642-102218664 CTCCTGTGGTCCCAGCTACTCGG - Intergenic
1073301673 10:102474770-102474792 CGCCTGTGGTCCCAACTACTTGG - Intronic
1073534052 10:104258726-104258748 CGCCTGTGGTCCCAACTACTCGG + Intronic
1073680816 10:105701454-105701476 CACCTGTAGTCCCCACTACTCGG - Intergenic
1073708094 10:106010110-106010132 CCCCTGTGACCACCACCATTGGG + Intergenic
1073827004 10:107336110-107336132 CTCCTGTGGCCACAACTACTGGG + Intergenic
1073890193 10:108091755-108091777 CCCCTGTGGCCACGAGCACTGGG - Intergenic
1074056781 10:109929375-109929397 CTCCTGTAGTCCCAACTACTCGG - Intergenic
1074302050 10:112241879-112241901 CCCCTGTGGCCACCACCACTGGG + Intergenic
1074408584 10:113202384-113202406 CACCTGTGGCCACCACCGCTGGG - Intergenic
1074696798 10:116057149-116057171 CTCCTGGGGTCACTCCCACATGG - Intronic
1074741390 10:116487570-116487592 CTCCTGGGGTCTTCTCCACTTGG + Intergenic
1074893367 10:117753766-117753788 CTCCCCTGCTCCCCACCACTGGG - Intergenic
1074909121 10:117891477-117891499 CACCTGTGGTCCCAGCCACTTGG - Intergenic
1075026348 10:118986952-118986974 CACCTGTGGTCCCAGCCACTTGG + Intergenic
1075233675 10:120707708-120707730 CACCTGTGGTCCCCGCTACTTGG - Intergenic
1075763848 10:124877468-124877490 CACCTGTGGTCCCAACTACTCGG + Intergenic
1075776107 10:124989860-124989882 TGCCTGTGGTCGCCACTACTTGG - Intronic
1075960588 10:126564296-126564318 CTTCTGTGCTCACCACAACCTGG - Intronic
1076150329 10:128157137-128157159 CTCTTGTGGACACCACCCCTGGG + Intergenic
1076176002 10:128368297-128368319 CACCTGTAGTCACCGCCACTTGG - Intergenic
1076282754 10:129263255-129263277 CACCTGTGGCCTCCACTACTTGG + Intergenic
1076543175 10:131227225-131227247 CTCCCATGGTGACCAGCACTGGG - Intronic
1076899452 10:133330225-133330247 CGCCTGTGGTCCCAGCCACTCGG + Intronic
1076972194 11:141963-141985 CACCTGTGGTCCCTACTACTTGG + Intergenic
1077427543 11:2490512-2490534 TACCTGTGGCCACCACCACTGGG - Intronic
1077869178 11:6247267-6247289 CACCTGTGGTCCCAGCCACTTGG - Intergenic
1078126485 11:8569829-8569851 CTCCTGTGGTCTCAGCTACTCGG + Intronic
1078901222 11:15644414-15644436 CACCTGTGGTCCCAACTACTTGG - Intergenic
1079051782 11:17167094-17167116 CTCCTGTGGTCCCAGCTACTTGG - Intronic
1079188841 11:18260966-18260988 CTCCTGTTGTCCTCACTACTTGG - Intergenic
1079471447 11:20781914-20781936 CACCTGTGGTCCCAACTACTTGG + Intronic
1079473781 11:20807455-20807477 ACCCTGTGGTCACCACCACTGGG + Intronic
1079686970 11:23371053-23371075 CCCCAGTGGTCACCACCACTGGG - Intergenic
1079723194 11:23845822-23845844 CTCCTGTGGCCACCACAGCTGGG + Intergenic
1080008399 11:27433336-27433358 CGCCTGTGGTCCCAACTACTGGG - Intronic
1080096940 11:28419226-28419248 CTCCTATGGTCACCACCACTGGG - Intergenic
1080128685 11:28767327-28767349 CCCCTGTGGCCACTACCACTAGG - Intergenic
1080349493 11:31367171-31367193 CACCTGTGGTCCCAACTACTTGG + Intronic
1080351231 11:31387337-31387359 CCTCTGTGGCCATCACCACTGGG - Intronic
1080489723 11:32750251-32750273 CCCCTGTGACGACCACCACTGGG + Intronic
1080847405 11:36038020-36038042 CTCCTGTGGTCCCAGCTACTAGG - Intronic
1081049266 11:38316603-38316625 CCCCTGTGGTCACCACCACTGGG - Intergenic
1081073617 11:38641765-38641787 CCCTTGTGGCCACTACCACTGGG + Intergenic
1081245799 11:40764673-40764695 CCCCTGTGGCCACCACCACTGGG - Intronic
1081510773 11:43770608-43770630 CACCTGTGGTCCCAGCCACTGGG + Intronic
1081555477 11:44157139-44157161 GTCCTGTGGTCACCGCTGCTTGG + Intronic
1081832561 11:46126123-46126145 CACCTGTGGTCCCAACTACTCGG + Intergenic
1081921997 11:46787030-46787052 CGCCTGTGGTCCCGACTACTTGG + Intronic
1082039108 11:47670357-47670379 CTCCTGTGGTCCCAGACACTTGG + Intronic
1082704624 11:56478473-56478495 CTCCTGTGGTCTCAGCTACTTGG + Intergenic
1082829322 11:57603711-57603733 CGCCTGTGGTCCCAACTACTTGG + Intronic
1083206751 11:61154976-61154998 CACCTGTGGTCCCAACTACTTGG + Intronic
1083346919 11:62000293-62000315 CACCTGTGGTCCCCGCTACTTGG + Intergenic
1083803702 11:65061055-65061077 CTGCTTTGGTCACATCCACTGGG + Intergenic
1083822144 11:65178699-65178721 CTCCTGTAGTCCCCACTACTAGG - Intronic
1083935003 11:65865505-65865527 CTCCTGTGGCCTCCACTACCTGG - Intronic
1084023521 11:66433092-66433114 CACCTGTGGTCCTAACCACTTGG + Intergenic
1084359436 11:68660058-68660080 CACCTGTGGTCCCAGCCACTCGG - Intergenic
1084552735 11:69856921-69856943 CTCCTGTAATCCCAACCACTTGG - Intergenic
1084763740 11:71294072-71294094 CCCCTGTGGCCACCAACACTGGG + Intergenic
1084964297 11:72736366-72736388 ATCCTGTGGTCCCCGCTACTGGG - Intronic
1085147435 11:74213568-74213590 CCCCTGTGGCCACCAGCACTAGG - Intronic
1085178558 11:74511859-74511881 CTCCTGTGGCCATTACCACTGGG - Intronic
1085572013 11:77568216-77568238 CCCCTGTGGTCACCACCACTGGG + Intronic
1086068871 11:82776594-82776616 CCCCTGTGGTCACCACTAATGGG - Intergenic
1086115256 11:83242689-83242711 TGCCTGTAGTCACCACTACTCGG - Intronic
1086314431 11:85575408-85575430 CGCCTGTGGTCCCAGCCACTTGG + Intronic
1086524538 11:87710503-87710525 TTCCTGTGGCCACCACTTCTAGG + Intergenic
1086847768 11:91773479-91773501 ACCCTGTGGCCACCACCCCTGGG + Intergenic
1087178529 11:95119573-95119595 CCCCTGTGGCCACCACCGCTAGG + Intronic
1087201440 11:95347848-95347870 TCCCTGTGGCCACCACCGCTAGG - Intergenic
1087299420 11:96414352-96414374 CCCTTGTGGCCACCACCATTGGG - Intronic
1087313270 11:96576554-96576576 CCCCTGTGGCCACCATCACTGGG + Intergenic
1087402289 11:97683551-97683573 CCCCTGTGGCCACCAACCCTAGG + Intergenic
1087574317 11:99971415-99971437 CGCCTGTAGTCACAACTACTGGG + Intronic
1087720870 11:101664515-101664537 ACCCTGTGGCCACCAGCACTGGG + Intronic
1087887669 11:103498455-103498477 CCCCTGTGGCCACCAACACTGGG - Intergenic
1087950709 11:104218149-104218171 TCCCTGTGGCCACCACCACTGGG + Intergenic
1088154745 11:106789912-106789934 ACCCTGTGGCCACCAACACTAGG + Intronic
1088826839 11:113503009-113503031 CTCCTGTGGTCCCAGCTACTTGG + Intergenic
1088856429 11:113759047-113759069 CACCTGTGGTCACAGCTACTGGG + Intronic
1088870860 11:113889469-113889491 CACCTGTGGTCCCAGCCACTTGG - Intergenic
1088944389 11:114495122-114495144 CCTCTGTGGCCACCACCAGTGGG + Intergenic
1089227857 11:116941130-116941152 CACCTGTGGTCCCAACTACTTGG - Intronic
1089414974 11:118280776-118280798 CTCCTGTGGTCCCAGCTACTTGG - Intergenic
1089578745 11:119468366-119468388 CCCCTTTAGCCACCACCACTGGG + Intergenic
1089824595 11:121264095-121264117 CCCCTATGGCCACCACCTCTAGG + Intergenic
1090111308 11:123911773-123911795 ACCCCGTGGCCACCACCACTGGG - Intergenic
1090121210 11:124030044-124030066 CTCTTCTGGCCACCAGCACTTGG + Exonic
1090676789 11:129006636-129006658 CCCCTGTGGCCACCACCACTGGG + Intronic
1091155975 11:133373497-133373519 CTCCTGTAGTCTCAACTACTGGG + Intronic
1091463168 12:661202-661224 CACCTGTAGTCCCCACTACTCGG - Intronic
1091720051 12:2806565-2806587 CGCCTGTGGTCCCAGCCACTTGG - Intergenic
1092476976 12:8828012-8828034 CCCCTGTGGCCACCAGCATTGGG + Intronic
1093477357 12:19570894-19570916 CTCCTGTAGTCCCAACTACTCGG - Intronic
1093620162 12:21278476-21278498 CCCCTGTGGCCACCACCACTGGG - Intronic
1093864043 12:24203419-24203441 CAAATGTGCTCACCACCACTGGG + Intergenic
1093903191 12:24660509-24660531 CCCCTTTGGCCACCACCACTGGG + Intergenic
1093931910 12:24962073-24962095 CCCCTGTGGCCACCACCACTGGG - Intergenic
1094014286 12:25846074-25846096 CACCTGTGGTCCCAACTACTTGG - Intergenic
1094078562 12:26506381-26506403 CGCCTGTGGTCCCAACTACTAGG + Intronic
1094419881 12:30258862-30258884 CCCCTGTGGTCACCACAACTGGG - Intergenic
1094559284 12:31535327-31535349 CCCCTGTGGCTACCACCACTGGG - Intronic
1094787264 12:33863300-33863322 CTCCTGTGGGCAGCACCACTGGG + Intergenic
1095114482 12:38335257-38335279 CTCCTGTAGTCCCAACTACTTGG + Intergenic
1095169806 12:39020462-39020484 CCCCTGTGGCCACCATCACTAGG - Intergenic
1095614621 12:44173199-44173221 CACCTGTGGTCCCCACTACGTGG - Intronic
1095866758 12:46980474-46980496 CACCTGTGGTCCCAACTACTTGG - Intergenic
1095888382 12:47212143-47212165 CTCCTGTGGTCCCAGCTACTGGG + Intronic
1096174999 12:49508936-49508958 CACCTGTAGTCCCCACTACTTGG + Intronic
1096255311 12:50058639-50058661 CTCCAGAGGTCACCACTCCTCGG - Intronic
1096272852 12:50180172-50180194 CGCCTGTAGTCCCAACCACTCGG + Intronic
1096936172 12:55279557-55279579 CTCCTGTGGTCTCAGCTACTTGG + Intergenic
1097006130 12:55919272-55919294 CTCCTGTAGTCCCAACTACTTGG - Intronic
1097124606 12:56763941-56763963 CACCTGTGGTCCCAGCCACTTGG + Intronic
1097466363 12:59929320-59929342 CTCCTATGACTACCACCACTGGG - Intergenic
1097668081 12:62504368-62504390 CACCTGTGGTCCCAACTACTCGG - Intronic
1097714710 12:62954346-62954368 CCCCTGTGGCCACCTCCACTGGG + Intergenic
1097870975 12:64601989-64602011 CGCCTGTGGTCCCAACTACTCGG + Intergenic
1097899160 12:64856589-64856611 CCCCTGTGGCCACTACCACTGGG + Intronic
1097938787 12:65281101-65281123 CTCCTGTGGTCTCAGCTACTTGG + Intronic
1098060430 12:66555137-66555159 CCCCTGTGGCCACTATCACTGGG - Intronic
1098333678 12:69380511-69380533 CCCCTTTAGCCACCACCACTGGG + Intronic
1098395416 12:70011566-70011588 CCCCTGTGGCCACCACCACTGGG - Intergenic
1098652644 12:72992505-72992527 CTTCTGTGGTGCCCACCACTGGG + Intergenic
1098966813 12:76799009-76799031 CTCCTGTGGTCCCAGCTACTCGG + Intronic
1099562137 12:84192225-84192247 CCCCTGTGGCCACCAACACTGGG + Intergenic
1099616217 12:84938814-84938836 GCCCTGTGGCCACCATCACTGGG - Intergenic
1100060917 12:90575079-90575101 CCCCTGTGGCTACTACCACTGGG + Intergenic
1100396505 12:94190366-94190388 CACCTGTGGTCCCCACTACTTGG - Intronic
1100905012 12:99287138-99287160 CCCCTATGGTCACCATCACTGGG - Intronic
1101135117 12:101735533-101735555 CACCTGTAGTCACAACTACTTGG + Intronic
1101143007 12:101815191-101815213 CCCCTGTAGTCACAACTACTTGG - Intronic
1101226777 12:102695123-102695145 CTCCTTTGGCCACCAGCACTAGG - Intergenic
1101251862 12:102945182-102945204 CCCCTGTGGTCACCACCACTAGG + Intronic
1101917527 12:108907405-108907427 CTCCTGTGGTCCCAGCTACTTGG - Intergenic
1102078814 12:110081259-110081281 CGCCTGTGGTCTCAACCACTCGG + Intergenic
1102273238 12:111558669-111558691 CGCCTGTGGTCCCCGCTACTTGG + Intronic
1102285523 12:111653065-111653087 CTCCTGTGGTCCCAGCTACTAGG + Intronic
1102594082 12:113979068-113979090 CACCTGTGGTCCCCGCTACTTGG - Intergenic
1102724911 12:115053609-115053631 CTCCTGGGGTAAATACCACTTGG + Intergenic
1102840036 12:116109194-116109216 CTCCTGTGGTCACAGCTGCTTGG - Intronic
1102976440 12:117210096-117210118 CTCCTGTGGTCCCAGCTACTTGG - Exonic
1103359337 12:120344581-120344603 CTCTTGTGGTCCCCGCTACTTGG + Intronic
1103461497 12:121108326-121108348 CCCCTGTGGCCATCACCACTGGG - Intergenic
1103604370 12:122076333-122076355 CACCTGTGGTCACAGCTACTCGG + Intergenic
1103707091 12:122881614-122881636 CACCTGTGGTCCCAACTACTGGG + Intronic
1103812709 12:123628486-123628508 CTCCTGTGGTCCCAGCTACTTGG - Intronic
1103992244 12:124807073-124807095 CGCCTGTGGTCCCAACTACTCGG + Intronic
1104065528 12:125302237-125302259 CTCCTGTGGTCCCAGCTACTAGG + Intronic
1104132425 12:125907033-125907055 CTCCTGTGGTCCCAGCTACTTGG + Intergenic
1104797096 12:131527526-131527548 CGCCTGTGGTCCCAACTACTTGG + Intergenic
1104799649 12:131545419-131545441 TTCCTGTGGTCCCAGCCACTTGG + Intergenic
1105475851 13:20727632-20727654 CTCCTGTAGTCCCAGCCACTTGG - Intergenic
1105558923 13:21472685-21472707 CCCCTGTGGCTACCATCACTGGG + Intergenic
1106102670 13:26708112-26708134 CCCAGGTGGGCACCACCACTGGG + Intergenic
1106565849 13:30883935-30883957 CACCTGTAGTCCCCACTACTTGG + Intergenic
1107044452 13:35980327-35980349 CACCTGTGGTCCCAGCCACTCGG + Intronic
1107178215 13:37423833-37423855 CCCCTGTGGCTGCCACCACTGGG - Intergenic
1107688873 13:42932063-42932085 CTCCTGTAGTCCCAACTACTTGG - Intronic
1108295341 13:49011357-49011379 CGCCTGTGATCTCCGCCACTTGG - Intronic
1108730226 13:53227737-53227759 CCCCTGTAGTCCCCACCACTTGG + Intergenic
1108962064 13:56246889-56246911 CCCCTGTGGCCACCAGCACTTGG + Intergenic
1109045888 13:57409971-57409993 CCCCTGTGGCCACCATCACTGGG - Intergenic
1109100606 13:58180281-58180303 TTCCTGTGCTCACCACCACTGGG + Intergenic
1109506825 13:63312460-63312482 CACCTGTGGCCACCACCACTGGG - Intergenic
1110244439 13:73305981-73306003 CACCTGTAGTCCCCACTACTTGG - Intergenic
1110376830 13:74803313-74803335 CCCCTGTGGCTACCACAACTGGG - Intergenic
1110448666 13:75617307-75617329 CACCTGTGGCTACCACCACTGGG + Intergenic
1110665685 13:78115526-78115548 CCCCTGTGGCCACCACCACTGGG + Intergenic
1110901593 13:80831750-80831772 CCCCTGTGACCACCACCACTGGG - Intergenic
1110916700 13:81030289-81030311 CCCCAGTGGTCACCACCACTGGG + Intergenic
1111135673 13:84039359-84039381 CTCCTGTGGTCCCGGCTACTCGG + Intergenic
1111205288 13:84999929-84999951 CGCCTGTAGTCACAACTACTCGG - Intergenic
1111303348 13:86373565-86373587 TCCCTGTGGCCACCTCCACTGGG + Intergenic
1111449218 13:88391664-88391686 CCCTTGTGGCCACCACCAATGGG - Intergenic
1111513279 13:89294259-89294281 CTGCTGTGGCCACCACCCCTGGG + Intergenic
1111542811 13:89690194-89690216 CCCTTGTGTTCATCACCACTAGG - Intergenic
1112269079 13:97951841-97951863 CTCCTGCAGTCCCAACCACTTGG + Intergenic
1112453070 13:99530296-99530318 CTCCTGTAGTCCCAACTACTTGG + Intronic
1112523267 13:100117988-100118010 CTCCTGTGGTCCCAGCTACTTGG + Intronic
1112523329 13:100118672-100118694 CACCTGTAGTCACAACTACTTGG - Intronic
1113027697 13:105959134-105959156 CTCCTGTAATCTCCACTACTTGG - Intergenic
1113212834 13:108002745-108002767 CCCCTGTGGCCACCACCAGTGGG + Intergenic
1113217718 13:108061577-108061599 TCTCTGTGGTCACCACCACTGGG - Intergenic
1113558759 13:111259320-111259342 CCCCTGTAGTCACCACCATTGGG - Intronic
1114238459 14:20843486-20843508 CGCCTGTGGTCCCAGCCACTTGG + Intergenic
1114251003 14:20960146-20960168 CCCCTGTGGTCACCACCACTGGG - Intergenic
1114294359 14:21315922-21315944 CACCTGTGGTCACGGCTACTTGG - Intronic
1114296482 14:21334046-21334068 CTCCTGTGGTCCCAGCCACTCGG - Intronic
1114315596 14:21507053-21507075 CACCTGTAGTCACAACTACTCGG + Intronic
1114432307 14:22671792-22671814 CTCCTGTGGCCACCACCATCAGG - Intergenic
1114506360 14:23217501-23217523 CCCATGTGGCAACCACCACTGGG - Intronic
1114783641 14:25569652-25569674 CCCTTGTGGTCACCACTAGTGGG + Intergenic
1114867461 14:26614314-26614336 TGCCTGTGGTCCCCACTACTCGG - Intergenic
1115002501 14:28439694-28439716 CTCCTGTGGTCCCCGCTACTTGG - Intergenic
1115023830 14:28716113-28716135 CTCCTGTAGTCCCAACTACTTGG + Intergenic
1115476778 14:33822260-33822282 CCCCTGTGGCCACCACCACTGGG - Intergenic
1115598245 14:34929880-34929902 CACCTGTGGTCCCCACTACTTGG + Intergenic
1116154805 14:41189596-41189618 CCCCTGTGGCCACCACCACTGGG - Intergenic
1116192696 14:41680352-41680374 CCCCTCTGGCCACCACCATTAGG - Intronic
1116326011 14:43534483-43534505 CGCCTGTAGTCCCCACTACTCGG + Intergenic
1116413318 14:44650346-44650368 CCCCTCTGGCCACCACCACTGGG - Intergenic
1116422240 14:44745675-44745697 CCCCTGTGGCCACCACCACTAGG - Intergenic
1116497686 14:45582649-45582671 CCCCTATGGCCACAACCACTGGG + Intergenic
1116834995 14:49761950-49761972 CTCCTGTGGCCACCACCACAGGG + Intergenic
1116889228 14:50250636-50250658 CTCCTGTGGCCACCACCACTGGG - Intronic
1117057982 14:51932502-51932524 CACCTGTGGTCCCCGCTACTTGG + Intronic
1117172199 14:53112289-53112311 CTCCTGTAGTCCCAACTACTTGG + Intronic
1117208352 14:53469426-53469448 CCCCTGTAGCCACCACCACTGGG + Intergenic
1117240763 14:53829978-53830000 CACCTGTGGATACCAGCACTTGG - Intergenic
1117384119 14:55194244-55194266 TCACTGTGGCCACCACCACTGGG + Intergenic
1117527905 14:56629913-56629935 CACCTGTGGTCCCAACTACTTGG + Intronic
1117560272 14:56930386-56930408 CTCCTGTAGTCCCAGCCACTTGG - Intergenic
1117606313 14:57431971-57431993 GCCCTGTGGCCACCACCACTGGG - Intergenic
1117706586 14:58475970-58475992 CACCTGTGGTCCCTGCCACTCGG + Intronic
1117842912 14:59880102-59880124 ACTCTGTGGTCATCACCACTGGG + Intergenic
1117972001 14:61261030-61261052 CTCCTGTCAGCTCCACCACTGGG + Intronic
1118034113 14:61848483-61848505 CCCCTGTGGCCACCACCATTGGG + Intergenic
1118534334 14:66742885-66742907 CGCCTGTGGTCCCAACTACTCGG - Intronic
1118619951 14:67605806-67605828 CACCTGTGGTCCCAACTACTGGG - Intergenic
1118886622 14:69872532-69872554 CTCCTGTGGTCCAAACTACTTGG + Intronic
1118972937 14:70652801-70652823 GTCCTGTGGTCTCCACAACCTGG - Intronic
1119096755 14:71840156-71840178 CCCCTGTGGTCACCACTACTAGG + Intergenic
1119216743 14:72875279-72875301 CACCTGTGGTCCCAGCCACTTGG + Intronic
1119321958 14:73737498-73737520 CTCCTGTGGTCCCAGCTACTTGG + Intronic
1119427726 14:74546721-74546743 CTCCCGTGCCCACCGCCACTGGG + Intronic
1119643944 14:76335094-76335116 CCCCTTAGTTCACCACCACTGGG + Intronic
1119812489 14:77534030-77534052 CGCCTGTGGTCCCAACTACTTGG + Intronic
1119814217 14:77550776-77550798 CTCCTGTGGTCCCAGCTACTTGG + Intronic
1120131260 14:80810195-80810217 CGCCTGTAGTCCCAACCACTCGG + Intronic
1120275882 14:82371445-82371467 CCCCTGTGGCCACCATCACTGGG - Intergenic
1120439571 14:84519852-84519874 CCCCTGTGGCTGCCACCACTGGG + Intergenic
1120697557 14:87660395-87660417 CTTCTGTGGCCACCACCACTGGG - Intergenic
1120700511 14:87693928-87693950 CGCCTGTGGTCACAGCTACTTGG + Intergenic
1120787455 14:88550472-88550494 CTCCTGGCGTCACCAGCGCTGGG - Exonic
1120868427 14:89316045-89316067 CTCCTGTGGTCCCCGCCAAAAGG + Intronic
1120905011 14:89612666-89612688 CACCTGTGGTCCCAGCCACTCGG + Intronic
1121153067 14:91654840-91654862 CCCTTGTAGCCACCACCACTAGG - Intronic
1121347012 14:93143681-93143703 CACCTGTGGTCCCAGCCACTTGG + Intergenic
1121376056 14:93411523-93411545 CCACTGTGGTCACCACTACCAGG - Intronic
1121666104 14:95673579-95673601 CACCTGTAGTCACAGCCACTTGG + Intergenic
1122511488 14:102272002-102272024 CACCTGTGGTCCCAGCCACTTGG - Intronic
1122590514 14:102846688-102846710 CTCCTGTGGTCCCAGCTACTTGG + Intronic
1122687107 14:103514332-103514354 CTCCTGTGGTCCCAGCTACTGGG + Intergenic
1123683466 15:22780882-22780904 CGCCTGTAGTCACAACTACTTGG - Intronic
1123775958 15:23580257-23580279 CACCTGTGGTCCCAACTACTTGG + Intronic
1124081270 15:26500710-26500732 CTCCAGTGGCCACCACCACTGGG + Intergenic
1124937177 15:34184339-34184361 CACCTGTGGTCTCAGCCACTCGG + Intronic
1125276889 15:38003303-38003325 CTCCTGTGGCTACCACAACTGGG + Intergenic
1125786194 15:42320572-42320594 CACCTGTAGTCCCCACTACTTGG - Intronic
1126052968 15:44704112-44704134 CACCTGTGGTCCCAACTACTTGG - Intronic
1126375826 15:47995922-47995944 CTCCTGGAGCCACCACCCCTAGG + Intergenic
1126410804 15:48371235-48371257 CACCTGTGGTCCCAACTACTTGG - Intergenic
1126438550 15:48662187-48662209 CACCTGTGGTCTCCACTGCTCGG + Intergenic
1126440656 15:48684210-48684232 CTCCTTTGGCCACCGCCACTGGG - Intergenic
1126458423 15:48889716-48889738 CTCCTGTGGTCCCAGCTACTCGG + Intronic
1126459905 15:48903889-48903911 CACCTGTAGTCCCCACTACTTGG - Intronic
1126534247 15:49742993-49743015 CCACTGTGGCCACCACCGCTGGG - Intergenic
1126706976 15:51414884-51414906 CCCTTATGGCCACCACCACTGGG - Intergenic
1126716789 15:51526035-51526057 CCCCTGTGGCCATCACCTCTAGG - Intronic
1127132711 15:55883619-55883641 TCCCTGTGGCCACCACCACTGGG - Intronic
1127140492 15:55970502-55970524 ATCCTGTGGCCACCATCACTGGG - Intronic
1127173589 15:56329016-56329038 CTTCTGAGGCCACCACCACTGGG - Intronic
1127177911 15:56381764-56381786 CCCCTGTGCCCAGCACCACTGGG + Intronic
1127186936 15:56490104-56490126 CTCCTGTGGTCCCAGCTACTCGG + Intergenic
1127447690 15:59081897-59081919 CTCCTGTGGTCCCAGCTACTGGG + Intronic
1127477018 15:59344426-59344448 CCCCTATGGCCACCACCACTGGG + Intronic
1127515671 15:59690780-59690802 CACCTGTGGTCCCAGCCACTTGG + Intergenic
1127783329 15:62335108-62335130 CCCTTGTGGCCACCAACACTGGG + Intergenic
1127843270 15:62848070-62848092 CCCCTGTGGTCAGAACCACCTGG - Intergenic
1127971398 15:63965366-63965388 CTCCTGTGGCCATCACCACTGGG + Intronic
1128900939 15:71422597-71422619 CCCCTGTGGCCACCACCACTGGG + Intronic
1129209718 15:74060668-74060690 TCCCTATGGCCACCACCACTGGG - Intergenic
1129477346 15:75795129-75795151 TCCCTATGGCCACCACCACTGGG + Intergenic
1129512519 15:76135343-76135365 CTGCTGAGGTGACCACCACATGG + Intronic
1129512770 15:76137155-76137177 CTCCTGTCCTCACCACCCCAAGG + Intronic
1129523777 15:76201501-76201523 CACCTGTGGTCCCAACTACTAGG - Intronic
1129537693 15:76327569-76327591 TGCCTGTGGTCCCAACCACTTGG - Intergenic
1129561870 15:76578440-76578462 CCCCTGTAGCCCCCACCACTGGG - Intronic
1129593791 15:76942815-76942837 TGCCTGTGGTCCCCACTACTTGG + Intronic
1129642506 15:77394365-77394387 CTTCTGTGGCCACCATTACTGGG - Intronic
1129775835 15:78235791-78235813 CACCTGTGGTCCCAGCCACTTGG + Intronic
1129797798 15:78391302-78391324 CTCCCGCAGTCACCACCATTAGG - Intergenic
1130166729 15:81468906-81468928 CTCCTGTAGTCCCAACTACTTGG + Intergenic
1130511910 15:84596211-84596233 TCCCTATGGCCACCACCACTGGG - Intergenic
1130997327 15:88911261-88911283 CTCCTGTGTTCTCCACCACCGGG - Intronic
1131172858 15:90190899-90190921 CTCCTGTGGTCCCAGCTACTTGG - Intronic
1131180174 15:90233988-90234010 CTCCTGGGGCCACCACCCCCGGG + Exonic
1131182286 15:90249083-90249105 CTCCTGTAGTCACAGCTACTGGG + Intergenic
1131495900 15:92910516-92910538 CGCCTGTGATCCCAACCACTCGG - Intronic
1131945017 15:97609794-97609816 CCCCTGTGGCCACAACCACTGGG - Intergenic
1131945114 15:97610952-97610974 CCCCAGTGGCCACCACCACCAGG - Intergenic
1132792167 16:1697385-1697407 CGCCTGTAGTCCCCACTACTCGG + Intronic
1132990271 16:2788824-2788846 CACCTGTGGTCCCAACTACTTGG - Intergenic
1133253211 16:4498498-4498520 CACCTGTAGTCCCAACCACTCGG - Intronic
1133442542 16:5832811-5832833 CTCCTGTGGTCCCAAGCAGTTGG - Intergenic
1133834052 16:9350941-9350963 CTCCTGTGACCACCACCACTGGG + Intergenic
1134256795 16:12618981-12619003 CTCCTGTAGTCCCAACTACTCGG + Intergenic
1134620317 16:15683899-15683921 TGCCTGTGGTCACAACTACTCGG + Intronic
1134914258 16:18056574-18056596 CTCCTGTAGTCCCAGCCACTTGG - Intergenic
1135356676 16:21774636-21774658 CACCTGTGGTCCCAACTACTTGG - Intergenic
1135455176 16:22590777-22590799 CACCTGTGGTCCCAACTACTTGG - Intergenic
1136571904 16:31103169-31103191 CACCTGTGGTCACAGCTACTCGG + Intergenic
1136609774 16:31359289-31359311 CGCCTGTGGTCCCAACTACTTGG - Intronic
1136679317 16:31946437-31946459 CTCCTGTGGCCACCACCACTGGG - Intergenic
1137225792 16:46506912-46506934 CCTCTGTGTCCACCACCACTGGG - Intergenic
1137639324 16:50014329-50014351 CGCCTGTGGTCCCAGCCACTTGG + Intergenic
1137885777 16:52101864-52101886 CTCCTGTAGTCACAGCTACTCGG + Intergenic
1137946281 16:52735847-52735869 CTCCACTGGTAACCACCACCAGG + Intergenic
1137999079 16:53255181-53255203 TGCCTGTGGTCCACACCACTTGG + Intronic
1138057621 16:53852148-53852170 CACCCGTGGTCACAACTACTTGG + Intronic
1138498322 16:57422535-57422557 CATCTCTGGTCACCACCAGTGGG - Intergenic
1139123071 16:64043558-64043580 CCTCTGTGGCCACCACCACTGGG - Intergenic
1139235654 16:65335886-65335908 CTCCTGTAGTCACAGCTACTGGG + Intergenic
1139565251 16:67771134-67771156 CTCCTGTGGTCCCAGCTACTAGG + Intronic
1139610312 16:68052022-68052044 CACCTGTAGTCCCCACTACTTGG - Intronic
1139835669 16:69836738-69836760 CACCTGTGGTCCCCACTACCTGG - Intronic
1140473990 16:75229493-75229515 CTCCTGGGGTCACCACCCTCAGG + Exonic
1140567008 16:76055547-76055569 CCCCTGTGGCCACCAAAACTGGG + Intergenic
1141200529 16:81894301-81894323 CGCCTGTGGTCCCAACAACTTGG + Intronic
1141719383 16:85747324-85747346 CACCTGTGGTCCCAACTACTTGG + Intronic
1141731181 16:85824375-85824397 CACATGTGGTCACCTCCAGTTGG - Intergenic
1141929643 16:87193517-87193539 CGCCTGTGGTCCCAGCCACTTGG - Intronic
1142206748 16:88786441-88786463 CTCCTGTAGTCCCAACTACTCGG + Intergenic
1142282065 16:89153891-89153913 CTCCTGCAGTCACCACCCCTGGG + Intronic
1142404228 16:89878152-89878174 CACCTGTGGTCACAGCTACTCGG + Intronic
1142448055 16:90155559-90155581 CACCTGTGGTCCCTACTACTTGG - Intergenic
1142459433 17:79765-79787 CACCTGTGGTCCCTACTACTTGG + Intergenic
1142732075 17:1866438-1866460 CTCCTGTGGTCCCAGCTACTAGG - Intronic
1142845843 17:2675713-2675735 CTCCTGTAGTCCCAGCCACTAGG + Intronic
1142897883 17:2993917-2993939 CTCCTGTGGTCCCCGCTACTTGG + Intronic
1142919680 17:3173126-3173148 CTCCTGTGGCCACCACCACTAGG - Intergenic
1143133524 17:4696204-4696226 CACCTGTGGTCACAGCTACTTGG + Intronic
1143177058 17:4961637-4961659 CGCCTGTAGTCCCCACTACTCGG + Intronic
1143417483 17:6760220-6760242 CGCCTGTGGTCCCAGCCACTTGG + Intronic
1144138187 17:12319488-12319510 CGCCTGTGGTCCCAACTACTTGG + Intergenic
1144562990 17:16337168-16337190 CTCCTGTAGTCCCATCCACTAGG - Intronic
1144886262 17:18464621-18464643 CACCTGTGGTCCCAGCCACTTGG + Intergenic
1145114839 17:20199524-20199546 CACCTGTGGTCCCAGCCACTTGG - Intronic
1145117356 17:20224252-20224274 CTTCTGTGGCTACCACTACTGGG + Intronic
1145200905 17:20944033-20944055 CCCCTCTGGCTACCACCACTGGG + Intergenic
1146015257 17:29228018-29228040 CTCCTGTGGTCTCAGCTACTTGG + Intergenic
1146049159 17:29535183-29535205 CTCCTGTGGTCCCAGCTACTTGG + Intronic
1146098807 17:29959058-29959080 CCGCTGTGGCCACCATCACTGGG + Intronic
1146240528 17:31218695-31218717 CGCCTGTGGTCCCAGCCACTTGG - Intronic
1146242442 17:31243251-31243273 GCCCTGTGGACACCAGCACTGGG + Intronic
1146314299 17:31795143-31795165 CCCCTGTGGTCTCAGCCACTTGG - Intergenic
1146339930 17:32009766-32009788 CACCTGTGGTCCCAACTACTTGG - Intronic
1146343143 17:32039349-32039371 CTCCTGTAGTCCCCGCTACTGGG + Intronic
1146615262 17:34351221-34351243 CCCCCATGGTCACCACTACTGGG - Intergenic
1146792651 17:35761227-35761249 CTCCTGTGGTCCCAGCTACTCGG - Intronic
1147834543 17:43320638-43320660 CTCCTGTAATCCCCACTACTTGG - Intergenic
1147884105 17:43673166-43673188 CGCCTGTAGTCCCAACCACTTGG - Intergenic
1148069286 17:44898341-44898363 CTCCTGTAGTCCCAACTACTCGG - Intronic
1148584582 17:48768394-48768416 CGCCTGTGGTCCCAGCCACTCGG - Intronic
1148652355 17:49259399-49259421 CACCTGTAGTTACCACTACTTGG - Intergenic
1149075568 17:52593937-52593959 CCTCTATGGTCACCACCACCAGG + Intergenic
1149237156 17:54605778-54605800 CACCTGTAGTCCCCACTACTTGG + Intergenic
1149239886 17:54636293-54636315 CCCCTGTGGTCACTACTATTGGG - Intergenic
1149652777 17:58286983-58287005 CTCCTGTAGTCCCAACGACTTGG + Intergenic
1149661894 17:58338379-58338401 CTCCTGTGTTCACCCACCCTGGG - Intergenic
1149668458 17:58383419-58383441 CTCCTGTAGTCCCAGCCACTTGG - Intronic
1149932940 17:60773771-60773793 CGCCTGTGGTCCCAACTACTTGG - Intronic
1150140958 17:62728148-62728170 CACCTGTGGTCACAGCTACTTGG - Intronic
1150257834 17:63763041-63763063 CTTCTGTGGTCCCAACTACTTGG - Intronic
1150296928 17:64015612-64015634 CGCCTGTAGTCACAACTACTTGG + Intronic
1150804445 17:68308178-68308200 CTCCTGTGGTCTCAGCTACTCGG + Intronic
1150871138 17:68911673-68911695 CCCCTGTGGCCACCACCACTAGG - Intronic
1150882092 17:69041576-69041598 CGCCTGTAGTCACAACTACTAGG + Intronic
1151613306 17:75191240-75191262 CTCCTGTGGTCCCAGCTACTCGG - Intergenic
1151971688 17:77460653-77460675 CTCCTGTGGTCATTTCCTCTTGG + Intronic
1152367844 17:79867028-79867050 ATCCTGAAGTCACCACCACCTGG + Intergenic
1152649783 17:81487629-81487651 CGCCTGTGGTCCCAGCCACTTGG - Intergenic
1152712136 17:81877105-81877127 CACCTGTGGTCCCAACTACTCGG - Intergenic
1152770396 17:82164253-82164275 CCCCTGTGGTCTCAACTACTCGG + Intronic
1152812695 17:82389624-82389646 CTCCTGTGGTCCCAGCTACTCGG - Intronic
1152983976 18:305548-305570 CTCCTGTGGTGACAAACCCTTGG + Intergenic
1153029361 18:699332-699354 CGCCTGTGGTCCCCGCCTCTCGG + Intronic
1153088723 18:1319029-1319051 ACCCTGTGGCCACCACCACTGGG - Intergenic
1153236095 18:2989792-2989814 CTCCTGTGGTCCCAGCCACTCGG + Intronic
1153429589 18:5000804-5000826 CCCCTGTGGCCAGCACCACGGGG - Intergenic
1153453942 18:5260047-5260069 CTCCTGTGGCCACCATTAGTAGG - Intergenic
1153680338 18:7494516-7494538 CGCCTGTAGTCCCCACTACTAGG - Intergenic
1153985013 18:10343882-10343904 GTGATGTGGTCACCCCCACTCGG - Intergenic
1154473271 18:14725354-14725376 CACCTGTGGTCCCCACTACTTGG - Intergenic
1155443529 18:25885779-25885801 CCCTTGTGGCCACCACCACTGGG - Intergenic
1155470702 18:26189405-26189427 CTCCTGTGGTCCCAGCTACTTGG + Intronic
1155485693 18:26339449-26339471 TGCCTGTGGTCCCAACCACTTGG - Intronic
1155541346 18:26871602-26871624 CACCTGTGGTCCCAGCCACTGGG + Intergenic
1155597406 18:27503242-27503264 CCCCTGTGGCCACCACCACTAGG - Intergenic
1155883369 18:31177862-31177884 CACCTGTAGTCCCAACCACTTGG + Intergenic
1155884911 18:31196086-31196108 CTCCTGTGGTCCCAGCTACTCGG + Intergenic
1156037752 18:32784695-32784717 CACCTGGGGTCACAACTACTTGG - Intergenic
1156055697 18:32999574-32999596 CTCCTGTGGCCACCACCACTGGG - Intronic
1156155947 18:34301694-34301716 CCCCTGTAGCCAGCACCACTTGG - Intergenic
1156192935 18:34740668-34740690 CGCCTGTGGTCCCCATTACTCGG + Intronic
1156307217 18:35888315-35888337 CACCTGTGGTCCCAACTACTTGG + Intergenic
1157035722 18:43970639-43970661 CTCCTGTAGTCCCCGCTACTCGG + Intergenic
1157180086 18:45489383-45489405 CTCCTGTGGTCTCAGCTACTTGG + Intronic
1157262246 18:46186319-46186341 CACCTGTAGTCCCAACCACTCGG - Intronic
1157937080 18:51884619-51884641 CTCCTGTGGCCACCACCACTAGG - Intergenic
1158024891 18:52885065-52885087 CTCCTGTGGCTACCACCACTAGG + Intronic
1158040770 18:53090566-53090588 CACCTGTGGTCCCAGCCACTCGG + Intronic
1158116967 18:54006073-54006095 CCCTTGTGGCCACCACCACTGGG - Intergenic
1158248378 18:55457609-55457631 CTTCTGTGGTCCCAACTACTTGG - Intronic
1158285255 18:55873737-55873759 CTCCTCTGGTCTCCACCACATGG + Intergenic
1158431392 18:57390322-57390344 CCCCTGTGTCTACCACCACTAGG - Intergenic
1158481167 18:57823310-57823332 CCCCTGTGGCCACCACCACTGGG + Intergenic
1158596395 18:58820088-58820110 CTCCTGTAGTCTCAACTACTTGG + Intergenic
1158772560 18:60537953-60537975 CTCCTGTAGTCCCAACTACTTGG + Intergenic
1158867536 18:61652384-61652406 CACCTGTGGTCCCAACTACTTGG - Intergenic
1158920006 18:62181534-62181556 CACCTGTGGTCCCCGCTACTTGG - Intronic
1158948904 18:62474116-62474138 CTCCTGTGGCCGCCACTACTAGG + Intergenic
1159284816 18:66336113-66336135 TTCCCGTGATCAGCACCACTGGG + Intergenic
1159296331 18:66494191-66494213 CTCCGCTGGTCCCCCCCACTGGG + Intergenic
1159394446 18:67838202-67838224 CCCCAGTGGCCACCACCACTAGG + Intergenic
1159446421 18:68545962-68545984 CCTCTGTGGCCACCACCACTGGG - Intergenic
1159648173 18:70943860-70943882 CCACTGTGGCCACCACCAGTGGG - Intergenic
1159731279 18:72032155-72032177 CCCATTTGGCCACCACCACTAGG + Intergenic
1159753199 18:72328374-72328396 CGCCTGTGGTCCCAGCCACTAGG - Intergenic
1159896385 18:74001057-74001079 CCCCTGTGGCCACCAGCACTAGG + Intergenic
1160138369 18:76295618-76295640 CCCCTATGGCAACCACCACTGGG + Intergenic
1160237127 18:77094521-77094543 CTCCTGTGCTCACCTCAACGTGG - Intronic
1160649149 19:212272-212294 CACCTGTGGTCCCTACTACTTGG + Intergenic
1160695758 19:483582-483604 CACCTGTGGTCGTCACGACTGGG + Intergenic
1160807308 19:997929-997951 CACCTGTGGTCCCCGCTACTTGG + Intronic
1160828449 19:1091513-1091535 CTCCTGTGGGCTCCAGCCCTCGG - Intronic
1161120554 19:2523425-2523447 CTCCTGTGGTCCCAGCTACTTGG + Intronic
1161128200 19:2572145-2572167 CCCCTGTGGTCCCAGCCACTCGG - Intronic
1161409014 19:4106281-4106303 CGCCTGTGGTCTCAACTACTCGG + Intronic
1161555953 19:4942805-4942827 CGCCTGTGGTCCCAGCCACTTGG + Intronic
1161774474 19:6251826-6251848 CACCTGTGGTCCCAGCCACTCGG + Intronic
1161951008 19:7468073-7468095 CACCTGTGGTCCCCGCTACTTGG + Intronic
1162113086 19:8411746-8411768 CTCCTGTGGTCCCAGCTACTTGG - Intronic
1162118695 19:8447898-8447920 CTCCTGTAGTCTCAGCCACTGGG + Intronic
1162419605 19:10558503-10558525 CCCCTGTGGTGCCCACCACCTGG + Intronic
1162753620 19:12843873-12843895 CACCTGTGGTCCCCACTATTTGG + Intronic
1162815721 19:13193121-13193143 CTCCTGTGGTCCCAGCTACTTGG - Intergenic
1162830288 19:13280299-13280321 CACCTGTGGTCCCAGCCACTTGG - Intronic
1163320820 19:16573540-16573562 CGCCTGTGGTACCCACTACTAGG + Intronic
1163389163 19:17019679-17019701 CGCCTGTTCTCACAACCACTTGG - Intronic
1163819144 19:19486316-19486338 TTCCTGGGGTCCCCAACACTGGG - Intronic
1163954398 19:20622059-20622081 CACCTGTAGTCCCCACTACTCGG + Exonic
1163995540 19:21042660-21042682 CGCCTGTGGTCCCCGCTACTTGG + Intronic
1164149673 19:22540578-22540600 CACCTGTGGTCCCAACTACTTGG + Intergenic
1164546991 19:29174094-29174116 CCCCTATGGCCACCACCACTTGG - Intergenic
1164632545 19:29771108-29771130 CACCTGTAGTCACAGCCACTTGG - Intergenic
1164842783 19:31406001-31406023 CTCCTGTGGTCGCAGCTACTAGG + Intergenic
1165224600 19:34345694-34345716 CACCTGTAGTCCCAACCACTTGG + Intronic
1165645533 19:37432262-37432284 CCCCTGTGGCTACCACCACTGGG - Intronic
1165775499 19:38402248-38402270 CGCCTGTAGTCACCACTATTTGG - Intergenic
1166065804 19:40358210-40358232 CGCCTGTGGTCCCAGCCACTTGG - Intronic
1166082789 19:40454965-40454987 CACCTGTGGTCCCCAATACTTGG - Intronic
1166235404 19:41452131-41452153 CTCCTGTGGTCCCAGCTACTTGG + Intergenic
1166378301 19:42341089-42341111 GGCCTGTGGTCCCAACCACTTGG - Intronic
1166408215 19:42539024-42539046 ACTCTGTGGCCACCACCACTGGG + Intronic
1166757313 19:45201381-45201403 CCCTTGTGGCCACCACCACTGGG + Intronic
1166916360 19:46198233-46198255 CACCTGTGGTCCCAACTACTTGG - Intergenic
1167083252 19:47291502-47291524 CCTCTGTGGCCACCACCTCTGGG - Intronic
1167148782 19:47697130-47697152 CGCCTGTGGTCACAGCTACTTGG - Intronic
1167164752 19:47790894-47790916 CGCCTGTGGTCCCAGCCACTCGG + Intergenic
1167283119 19:48582715-48582737 CGCCTGTGGTCCCAACTACTCGG + Intronic
1167481299 19:49733336-49733358 CACCTGTGGTCCCAACTACTCGG + Intergenic
1167759007 19:51431978-51432000 CACCTGTGGTCCCAACTACTCGG - Intergenic
1167946246 19:52991444-52991466 CGCCTGTGGTCCCAACTACTTGG + Intergenic
1168181036 19:54663318-54663340 CGCCTGTGGTCCCAGCCACTCGG + Intronic
1168271500 19:55252353-55252375 CACCTGTAGTCCCCACTACTCGG - Intronic
1168449070 19:56448896-56448918 CTCCCATGGCCACCAACACTGGG - Intronic
1168695531 19:58401941-58401963 CGCCTGTAGTCCCAACCACTCGG + Intronic
924995040 2:352054-352076 CACCTGTGGTCCCAGCCACTTGG - Intergenic
924997819 2:379995-380017 CGCCTGTGGTCCCAACTACTTGG + Intergenic
925168872 2:1738672-1738694 CACCTGTGGTCACAGCTACTCGG - Intronic
925506230 2:4568494-4568516 ACCCTGTGGCCACCTCCACTGGG + Intergenic
925588645 2:5488024-5488046 CCTCTGTGGCCACCAGCACTGGG - Intergenic
925787335 2:7445601-7445623 CACCTGTAGTCCCCACTACTTGG - Intergenic
926478454 2:13357494-13357516 CTCCTGTAGTCACCACCACTAGG - Intergenic
926702633 2:15813883-15813905 CTCCTGTGGACATCACCTTTGGG + Intergenic
926745006 2:16149545-16149567 CTCCTGTGGTCCCAGCTACTCGG - Intergenic
926894594 2:17670985-17671007 CTCCTGTGGTCCCAACTACTTGG - Intronic
926894649 2:17671481-17671503 CTCCTGTGGTCCCAACTACTTGG + Intronic
927569271 2:24144309-24144331 CACCTGTGGTCCCAGCCACTCGG + Intronic
927594626 2:24385820-24385842 CTCCTGTGGCTACTACCACTAGG + Intergenic
927600575 2:24436794-24436816 CACCTGTGGTCCCAACTACTTGG - Intergenic
927765132 2:25800035-25800057 CTCCTGTAGTCACAGCTACTTGG + Intronic
927808519 2:26169155-26169177 CTCCTGTGGTCCCAACTACTCGG - Intergenic
927944614 2:27128072-27128094 CGCCTGTGGTCCCAGCCACTTGG - Intronic
928153506 2:28854792-28854814 CTCCTGTGGTTCCAGCCACTTGG + Intronic
928340093 2:30435382-30435404 CTCCTGTGGTCCCAGCTACTTGG + Intergenic
928458986 2:31451577-31451599 CCCCTATGGCCACCACCACTAGG - Intergenic
928495561 2:31828554-31828576 CCCCTGTGACCACCACCACTGGG + Intergenic
928765064 2:34635842-34635864 CTCCTGTAGGCTCCACCTCTGGG + Intergenic
929281618 2:40086832-40086854 CCCCTGTGTCCACCACCAATGGG + Intergenic
929524930 2:42693181-42693203 CTCTTGTGGCTACCACCACTGGG + Intronic
929529180 2:42736344-42736366 CCCCTGTGGCGACTACCACTGGG + Intronic
930125982 2:47796833-47796855 CACCTGTAGTCCCAACCACTTGG + Intronic
930727514 2:54695968-54695990 CTCCTGTGGCCACCACCACTGGG - Intergenic
930778370 2:55197433-55197455 CCACTGTGGTCACCAGCTCTGGG - Intronic
931076957 2:58725809-58725831 CACCTGTAGTCTCCACTACTCGG + Intergenic
931085866 2:58830346-58830368 CCCCTGTGGCCACCACCACTGGG + Intergenic
931726590 2:65117322-65117344 CACCTGTAGTCCCAACCACTTGG - Intronic
931736654 2:65200133-65200155 CCCCTGTGGCCACCACCACTGGG - Intergenic
931750643 2:65326964-65326986 CTCCTGTGGTCCCAGCTACTTGG - Intronic
932233381 2:70101315-70101337 TGCCTGTGGTCACAGCCACTCGG + Intergenic
932626523 2:73300823-73300845 ATCCGGTTGACACCACCACTAGG + Intergenic
932648691 2:73532151-73532173 CCCCTGTGGCCACCACCAGTGGG + Intronic
932889598 2:75580378-75580400 CTCCTATAGCCACCACCACTGGG - Intergenic
933053714 2:77634171-77634193 TCCCTGTGGCCACCATCACTGGG + Intergenic
933097981 2:78211472-78211494 CCCCTGTGGCCACCACCACTGGG - Intergenic
933601082 2:84330855-84330877 CCCCTGTGGCCACCACCAGTGGG - Intergenic
933893809 2:86792618-86792640 CTCCTGTGGTCCCAGCTACTTGG - Intronic
933911494 2:86944526-86944548 CACCTGTGGTCCCAACTACTCGG - Intronic
934475507 2:94590816-94590838 CTCCTGTAGTCCCAACTACTTGG + Intronic
934575593 2:95398830-95398852 CACCTGTGGTCCCCGCTACTTGG - Intergenic
934750820 2:96793114-96793136 CTCCTGAGGTCAGGAGCACTGGG + Intronic
934778635 2:96954923-96954945 CACCTGTGGTCCCAACTACTTGG + Intronic
934785623 2:97003491-97003513 CACCTGTGGTCACAGCTACTTGG - Intronic
935078504 2:99769906-99769928 CCCCTGTGGCTACCACGACTGGG + Intronic
935437758 2:103055507-103055529 CCCATATGGCCACCACCACTGGG + Intergenic
935519321 2:104084554-104084576 CGCCTGTAGTCCCCACTACTTGG - Intergenic
935551713 2:104464843-104464865 CTCCTGTGGTCCCAGCTACTCGG - Intergenic
935812939 2:106817643-106817665 TCCCTGTAGCCACCACCACTGGG - Intronic
935989546 2:108706488-108706510 CCCCTGTGGCCACCACCACTGGG - Intergenic
935991365 2:108721564-108721586 CACCTGTGGTCCCAACTACTCGG - Intronic
936352107 2:111720629-111720651 CTCCTGTGGTCACCGTCTCATGG + Intergenic
936427061 2:112431130-112431152 CACCTGTGGTCCCAACTACTCGG + Intronic
936448553 2:112616138-112616160 CACCTGTGGTCACAGCTACTTGG - Intergenic
936511191 2:113149035-113149057 CCTCTGTGGCCACCACAACTTGG + Intergenic
936831644 2:116654533-116654555 CCTCTGTGGCCACCACCACTAGG - Intergenic
937172498 2:119889292-119889314 CACCTGTAGTCCCCACTACTCGG + Intronic
937512603 2:122612497-122612519 CCCCTGTGGCTACCACCAGTGGG - Intergenic
937610372 2:123854294-123854316 CTCCTGTTGTCTCAACTACTTGG + Intergenic
937651766 2:124327104-124327126 CTCCTGTAGTCCCCGCTACTTGG - Intronic
937793881 2:125994329-125994351 CTCCTATAGTCACCACCACTGGG + Intergenic
938177839 2:129152721-129152743 CCCTTGTGGCCACCAGCACTGGG + Intergenic
938268420 2:129947044-129947066 CACCTGTGGTCCCAACTACTTGG - Intergenic
938692943 2:133808952-133808974 CGCCTGTGGTCCCAACTACTTGG + Intergenic
938755426 2:134374865-134374887 CTCCTGTGGTCCCAGCTACTCGG + Intronic
938937517 2:136140196-136140218 CACCTGTAGTCCCAACCACTTGG - Intergenic
939066513 2:137489297-137489319 CACCTGTAGTCACCACTACTTGG + Intronic
939144625 2:138397098-138397120 ACCCTGTGGCCACCACCAGTGGG - Intergenic
939146201 2:138417945-138417967 CTCCTGTAGTCCCAACTACTCGG - Intergenic
939483325 2:142777585-142777607 TGCCTGTGGCCACCACTACTAGG + Intergenic
939637534 2:144600736-144600758 CACCTGTGGTCCCAGCCACTTGG - Intergenic
939707791 2:145477338-145477360 CCTCTGTGAACACCACCACTGGG + Intergenic
940007188 2:149018711-149018733 CGCCTGTAGTCCCAACCACTTGG + Intronic
940315061 2:152319933-152319955 CCCCTGTGGCCACCACCACAAGG + Intergenic
940402250 2:153261589-153261611 AACCTGTGGCCACCACTACTTGG + Intergenic
940429673 2:153575276-153575298 CTCCTGTGGTCTCCACCACTAGG + Intergenic
940496584 2:154437016-154437038 CGCCTGTTGTCCCCACTACTTGG - Intronic
940503679 2:154526815-154526837 CTCCTGTGGCCACCAGCACTAGG + Intergenic
940546969 2:155100901-155100923 CACCTTTGATCACCACCACTGGG - Intergenic
940559725 2:155280581-155280603 CTGCTGTGGCCACCACAACTGGG + Intergenic
940795506 2:158072566-158072588 GCCCTGTGGCCACCACCACTGGG - Intronic
940803137 2:158154809-158154831 CCCCTATGACCACCACCACTGGG - Intergenic
941497707 2:166227514-166227536 CTGCTGTACTCACAACCACTAGG + Intronic
941742327 2:169047776-169047798 CCTCTGAGGCCACCACCACTGGG - Intergenic
941800380 2:169652872-169652894 CTCCTGTAGTCCCAACTACTTGG + Intronic
942001477 2:171652542-171652564 CCCCTGGGGCCACCACCACTGGG + Intergenic
942049828 2:172129119-172129141 TGCCTGTGGTACCCACCACTTGG - Intergenic
942294814 2:174507250-174507272 CCCCTGTGGTCACCACTAATGGG - Intergenic
942295038 2:174508555-174508577 CTCCTGTGGTCACCACCACTGGG - Intergenic
942341183 2:174949480-174949502 CTCCTGTGGTCCCAGCTACTTGG - Intronic
942352436 2:175066178-175066200 CTCCTGTGGCCACAAACACTAGG - Intergenic
942814214 2:180033372-180033394 CCTTTATGGTCACCACCACTGGG + Intergenic
942882008 2:180872035-180872057 TCCCTGTGGCCACCACTACTGGG - Intergenic
942966464 2:181899716-181899738 CACCTGTAGTCACAACCACTTGG + Intronic
943208095 2:184927407-184927429 CCCCTGTGGCCACCACCACTGGG + Intronic
943237145 2:185337438-185337460 CTTCTGTGGCCACCACTACTAGG + Intergenic
943427783 2:187758582-187758604 CCACTGTGGCCACTACCACTGGG + Intergenic
943899600 2:193415382-193415404 TGCCTGTGGTCACAACTACTTGG + Intergenic
943933685 2:193886594-193886616 CCCCTGTGGCCACCACCACTGGG - Intergenic
944005229 2:194896768-194896790 CCCCTGGGGCCACCACCACTGGG + Intergenic
944061402 2:195572865-195572887 CTCCTGTGGTCCCAACTTCTTGG + Intergenic
944133154 2:196369425-196369447 CTCCTGTTGTCACCACCACTGGG + Intronic
944350764 2:198724308-198724330 CACCTGTGGTCCCAACTACTCGG + Intergenic
944578899 2:201115556-201115578 CACCTGTGGTCCCCGCTACTTGG + Intergenic
944616274 2:201464499-201464521 CCCCTGTTGCCACCACCACTAGG + Intronic
944767515 2:202879544-202879566 CTCCTGTGGTCCCAAGTACTTGG - Exonic
944967285 2:204949441-204949463 CTCCTGTGGTCCCAGCTACTTGG - Intronic
945127547 2:206529522-206529544 CACCTGTGGTCCCAACTACTAGG - Intronic
946697380 2:222372962-222372984 CCCCTGTGGCCACGACCACTGGG - Intergenic
947009036 2:225546091-225546113 CCCCTGTGGCCACCACCGCTGGG + Intronic
947024210 2:225718423-225718445 CACCTGTGGTCCCAACTACTTGG - Intergenic
947218843 2:227773535-227773557 CTCCTGTGGTCCCAGCTACTCGG - Intergenic
947496927 2:230644498-230644520 CTCCTGTGGTCCCAGCTACTCGG - Intergenic
947505229 2:230703642-230703664 CCACTGTGGCCACCACCACTGGG + Intergenic
947721870 2:232374818-232374840 CACCTGTAGTCCCCACTACTCGG + Intergenic
947909609 2:233792436-233792458 CGCCTGTAGTCTCAACCACTCGG - Intronic
948407980 2:237737023-237737045 ACCCTGAGGTCACGACCACTTGG - Intronic
948470929 2:238178305-238178327 CGCCTGTGGTCCCAGCCACTCGG - Intronic
948475387 2:238215766-238215788 CCCCTGTGGCCACCACCACTGGG + Intergenic
948487849 2:238292030-238292052 TTCCTGTGGTCCCAGCCACTTGG + Intergenic
948774779 2:240278450-240278472 CTCCTGAGGTCACTACCCCTGGG - Intergenic
948937537 2:241177289-241177311 CGCCTGTAGTCACCACTACTCGG + Intronic
949003471 2:241631589-241631611 CGCCTGTGGTCCCAACTACTTGG - Intronic
1168783026 20:510840-510862 CGCCTGTGGTCCCAACTACTTGG - Intronic
1168916350 20:1491365-1491387 CTTCTGTGGTCCCCAAGACTTGG + Exonic
1168917126 20:1499513-1499535 AGCCTGTGGCCACCACCGCTAGG + Intergenic
1169381556 20:5111970-5111992 CTCCTGTAGTCCCAGCCACTTGG - Intronic
1169487054 20:6042433-6042455 CTCCTGTCCTCACTCCCACTGGG + Intronic
1169628730 20:7600996-7601018 CCTCTTTGGCCACCACCACTGGG - Intergenic
1169684798 20:8259488-8259510 CTCCTGTGGTCCCAGCTACTGGG + Intronic
1170287595 20:14727407-14727429 CACCTGTGGTCACAGCTACTTGG + Intronic
1170539307 20:17372058-17372080 CTTCTGTGGTTACCACCCATTGG - Intronic
1170559715 20:17546574-17546596 CACCTGTAGTCCCCACTACTTGG + Intronic
1170668485 20:18407195-18407217 CTCCTGTGGCCACCACTATTGGG - Intronic
1170712180 20:18801374-18801396 CTCCTGTAGTCCCCACTACTGGG - Intergenic
1171358465 20:24568434-24568456 CTCCCGAGGTCACCAGCCCTAGG - Intronic
1171418884 20:25004053-25004075 CTCCTGTGGTCCCAGCTACTTGG + Intergenic
1171943032 20:31349320-31349342 CTCCTGTGATTACCACTACTGGG - Intergenic
1171944348 20:31363235-31363257 CTCCTGTAGTCCCAACTACTCGG + Intergenic
1171999542 20:31762473-31762495 CGCCTGTAGTCACAACTACTTGG - Intronic
1172014799 20:31866939-31866961 CTCATTTGGTCTCCACCACTGGG - Intronic
1172120354 20:32594919-32594941 CACCTGTGGTCACAGCTACTTGG - Intronic
1172137010 20:32693476-32693498 CGCCTGTGGTCCCAACTACTCGG + Intergenic
1172249463 20:33468682-33468704 CTCCTGTAATCCCCACTACTTGG + Intergenic
1172294559 20:33799499-33799521 CACCTGTGGTCACAGCTACTCGG + Intergenic
1172356824 20:34285977-34285999 CGCCTGTGGTCCCAGCCACTCGG + Intronic
1172420209 20:34809840-34809862 CTCCTGTAGTCACAGCCACTCGG + Intronic
1172509226 20:35488587-35488609 CTCCTGTGGTCCCAGCTACTTGG - Intronic
1172524619 20:35591600-35591622 CTCCTGTAGTCCCAACTACTTGG - Intergenic
1172570072 20:35963213-35963235 CACCTGTGGTCCCAACTACTTGG + Intronic
1172664626 20:36590688-36590710 CCCCTGTGGTCCCAACTACTTGG - Intronic
1172681052 20:36715689-36715711 CACCTGTGGTCCCAACTACTTGG + Intronic
1172738116 20:37144169-37144191 CTCCTGTAGTCCCAACTACTTGG + Intronic
1172830504 20:37829955-37829977 CTCCTGTGATCCCAACTACTTGG - Intronic
1173091916 20:39980398-39980420 TGCCTGTGGTCCCCACTACTTGG + Intergenic
1173126991 20:40346199-40346221 TCCCTGTGGCCACCACCACTGGG - Intergenic
1173204109 20:40979345-40979367 CACCTGTGGTCACCATCACTGGG + Intergenic
1173260976 20:41435476-41435498 CACCTGTGGTCCCTACTACTTGG + Intronic
1173523636 20:43716424-43716446 CTCCTGTGCTCACCCTCTCTTGG + Exonic
1173531819 20:43775507-43775529 CGCCTGTGGTCACAGCTACTTGG + Intergenic
1173534718 20:43800707-43800729 CACCTGTGGTCCCAGCCACTTGG - Intergenic
1173912462 20:46680513-46680535 CTCCTGTGGTCAGCTCCTCCAGG + Intronic
1174156502 20:48518879-48518901 CACCTGTGGTCTCAGCCACTGGG - Intergenic
1174304234 20:49603865-49603887 CACCTGTGGTCCCAGCCACTTGG + Intergenic
1174527853 20:51188102-51188124 CACCTGTAGTCCCCACTACTTGG - Intergenic
1174610273 20:51792561-51792583 CTCCTGTGGTCCCAGCTACTCGG + Intronic
1174817189 20:53697165-53697187 CGCCTGTGGTCCCAACTACTTGG + Intergenic
1174825293 20:53763070-53763092 CTCCTGTAGTCCCAACTACTCGG - Intergenic
1174831741 20:53820016-53820038 TCCCTGTGGCCACCACCGCTAGG + Intergenic
1174866770 20:54144373-54144395 CACCTGTGGTCGCAACTACTAGG - Intergenic
1174938660 20:54899117-54899139 CTCCTGTGGCCACCGCCACTGGG - Intergenic
1174982041 20:55407625-55407647 CCCTTGTGGCCACCACCACTGGG + Intergenic
1175122287 20:56725040-56725062 CGCCTGTGGTCCCGGCCACTTGG - Intergenic
1175145184 20:56890550-56890572 CACCTGTGGTCCCAGCCACTTGG + Intergenic
1175363791 20:58436457-58436479 CTCCTGTGGTCCCAGCTACTTGG - Intronic
1175865469 20:62173886-62173908 CTCCTGTGGTCCCAGCTACTTGG + Intronic
1175908749 20:62394663-62394685 CTCCTGTGGACAGAGCCACTTGG - Intronic
1176718928 21:10377979-10378001 TTCCTGTGGTCCCAGCCACTTGG + Intergenic
1176718962 21:10378182-10378204 CTCCTGTGGTCCCAGCTACTTGG + Intergenic
1176801214 21:13432512-13432534 CACCTGTGGTCCCCACTACTTGG + Intergenic
1176995053 21:15544957-15544979 CTCCTTTTTTCAGCACCACTGGG - Intergenic
1177105294 21:16946884-16946906 CACCTGTGGCCACCACCACTAGG - Intergenic
1177193510 21:17878288-17878310 CTCCTGTAGTCCCAACTACTCGG + Intergenic
1177275876 21:18912797-18912819 CACCTGTAGCTACCACCACTGGG + Intergenic
1177387891 21:20430738-20430760 CTCCTGTGCTCAGCACCAACAGG - Intergenic
1177494533 21:21872444-21872466 CTCCTGTTGCCACCACCACTTGG + Intergenic
1177503924 21:21997496-21997518 CCCCTGTGGCCAACACCACTTGG + Intergenic
1177740519 21:25148086-25148108 CCCCAGTGGCCACCACCACTGGG + Intergenic
1177771420 21:25519948-25519970 CTCCTGTGGCCACCACCACTGGG - Intergenic
1177969818 21:27776231-27776253 CGCCTGTCGTCCCCACTACTCGG + Intergenic
1178633452 21:34282119-34282141 CTCCTGTGGTCCCAGCTACTTGG + Intergenic
1179249264 21:39659112-39659134 CGCCTGTGGTCACAGCTACTTGG + Intronic
1179421204 21:41238256-41238278 CTCTGGGGCTCACCACCACTGGG - Intronic
1179832972 21:44009915-44009937 CACCTGTGGTCCCAACTACTTGG + Intergenic
1180178544 21:46105258-46105280 CACCTGTGGTCCCAACTACTGGG + Intronic
1180300194 22:11031164-11031186 CTCCTGTGGTCCCAGCTACTTGG + Intergenic
1180989668 22:19927526-19927548 CGCCTGTGGTCCCAGCCACTCGG + Intronic
1181092226 22:20481727-20481749 CACCTGTAGTCCCCACTACTTGG - Intronic
1181295687 22:21836742-21836764 CGCCTGTGGTCCCAGCCACTTGG + Intronic
1181536076 22:23546128-23546150 CTCCTGTAGTCCCAACTACTTGG - Intergenic
1181547713 22:23612339-23612361 CACCTGTAGTCCCCACTACTCGG + Intronic
1181927383 22:26370876-26370898 CTCCTGTAGTCCCAACTACTTGG + Intronic
1181951633 22:26557919-26557941 CTCCTGTAGTCCCAACTACTTGG + Intronic
1182383230 22:29911415-29911437 CGCCTGTGGTCCCAACTACTTGG + Intronic
1182467555 22:30526602-30526624 CTCCTGTGGTCCCAGCTACTTGG + Intronic
1182619760 22:31612594-31612616 CACCTGTGGTCCCAACTACTCGG + Intronic
1182844934 22:33422633-33422655 CACCTGTGATCCCAACCACTCGG - Intronic
1183119226 22:35717276-35717298 CACCTGTAGTCCCCGCCACTTGG + Intergenic
1183497683 22:38158293-38158315 CACCTGTGGTCACAGCTACTTGG - Intronic
1183914528 22:41106557-41106579 ATCCTGTGGACTCAACCACTGGG + Intronic
1184544414 22:45156814-45156836 CTCCTGTGGTCCCAGCTACTTGG - Intergenic
1184729939 22:46366509-46366531 GTCATGTGGTGGCCACCACTTGG - Intronic
1184753768 22:46504386-46504408 CACCTGTAGTCCCAACCACTTGG + Intronic
1184795041 22:46727403-46727425 CACCTGTGGTCCCAACTACTTGG - Intronic
1185419747 22:50728781-50728803 CTCCAGCAGTCACCACCACCTGG + Intergenic
949158490 3:853936-853958 CTCCTGTGGCCACCAGCACTGGG - Intergenic
949553182 3:5129670-5129692 CGCCTGTGGTCCCTACTACTTGG - Intronic
949622992 3:5837277-5837299 CTCATGTGACCACCACCACTGGG + Intergenic
949967683 3:9372452-9372474 CTCCTGTGGTCCCAGCTACTGGG + Intronic
950076852 3:10193495-10193517 CTCCTGTGGTCTCAGCTACTTGG + Intronic
950079085 3:10208418-10208440 CACCTGTGGTCCCCTCTACTTGG - Intronic
950392686 3:12709030-12709052 CTCCTGTGGGAAGCAGCACTGGG + Intergenic
950538619 3:13596261-13596283 CACCTGTGGTCCCCACTACTTGG - Intronic
950669498 3:14517625-14517647 CGCCTGTGGTCCCAGCCACTCGG - Intronic
950695528 3:14698680-14698702 CCCCTGTGGCCACCACCACTGGG + Intronic
950800968 3:15551655-15551677 CCCCTATGTCCACCACCACTGGG + Intergenic
951172048 3:19554184-19554206 CCCCTGTGGCCACCACCACTGGG + Intergenic
951259816 3:20494886-20494908 CCCCTGTGGCCATCACCACTGGG + Intergenic
951398800 3:22204073-22204095 ACCCTGTGGCCACCACCATTGGG - Intronic
951423227 3:22511503-22511525 CTCCTGTGGACACCACCACTAGG - Intergenic
951518869 3:23592384-23592406 CGCCTGTAGTCCCCGCCACTCGG + Intergenic
951747820 3:25999023-25999045 CCTCTGTGGTCTCCACCTCTGGG - Intergenic
951972880 3:28467580-28467602 CCCTTGTGGCCACCACCACTGGG - Intronic
952008790 3:28875409-28875431 CCTCTGTGGCCACCATCACTGGG + Intergenic
952529603 3:34249637-34249659 CACCTGTGGTGTCCAGCACTTGG + Intergenic
952725847 3:36583190-36583212 CTCCTTTGGTCACCACCACTGGG - Intergenic
952912599 3:38203744-38203766 CCCCTGTGGCTACCAGCACTGGG + Intronic
953180114 3:40587047-40587069 CATCTCTGGTCACCTCCACTTGG + Intergenic
953584972 3:44191389-44191411 CACCTGTAGTCCCCACTACTTGG + Intergenic
953742910 3:45552416-45552438 CTCCTTTGGACACCATCCCTGGG + Intergenic
953777128 3:45829476-45829498 TGCCTGTGGTCCCAACCACTTGG + Intronic
953865911 3:46583310-46583332 CTCCTGTGGTCCCAGCTACTTGG - Intronic
953956267 3:47234357-47234379 CTCCTGTAGTCCCAGCCACTCGG - Intronic
953961687 3:47271016-47271038 CTCCTGTGGTCCCAGCTACTTGG + Intronic
953985714 3:47441025-47441047 CACCTGTAGTCCCCGCCACTCGG - Intronic
953999686 3:47546318-47546340 CACCTGTGGTCTCAACTACTCGG - Intergenic
954429597 3:50463422-50463444 CACCTGTGGTCCCAGCCACTGGG - Intronic
954487922 3:50872447-50872469 CCTCTGTGGTCACCACCACTAGG + Intronic
954736066 3:52707293-52707315 CTCCTGTAGTCACAGCTACTCGG - Intronic
954880359 3:53831497-53831519 CCCCTGTGGCCACCAACACTGGG - Intronic
955204487 3:56883423-56883445 CTCCTGTGGTCCCAGCTACTTGG - Intronic
955585131 3:60470119-60470141 CTCCTGTGGCCACCGCCACTGGG + Intronic
955693664 3:61614533-61614555 CACCTGTGGTCCCAACTACTTGG - Intronic
956115998 3:65919435-65919457 CTCCTGTGGTCCCAGCTACTTGG + Intronic
956222836 3:66922689-66922711 CTTCTGTGGCCATCACCACTGGG - Intergenic
956223067 3:66924198-66924220 CCTCTGTGGTCACCACCACTGGG - Intergenic
956410241 3:68971551-68971573 CACCTGTAGTCCCAACCACTTGG - Intergenic
956549605 3:70442746-70442768 ACCCTGTGGCCACTACCACTGGG - Intergenic
956644012 3:71438900-71438922 GCCCTGTGGTCTCCACCAGTGGG - Intronic
956678607 3:71757391-71757413 CACCTGTGGTCACAGCTACTGGG + Intergenic
957378199 3:79388386-79388408 CTCCTGTAATCAGCACCCCTGGG + Intronic
957745725 3:84339835-84339857 CTCCTGTGGCCACCATCACCAGG + Intergenic
957890087 3:86345644-86345666 CCCCTGTGGCCACCACAACTGGG + Intergenic
957925547 3:86805753-86805775 CTCCTGTGGCCACCAACAATGGG - Intergenic
957976083 3:87447238-87447260 CTCTGGTGGCCACCACTACTCGG + Intergenic
958156254 3:89759958-89759980 CTCCTGTAGTCACAGCTACTCGG + Intergenic
958260403 3:91374044-91374066 CACCTGTGGTCCCAACTACTTGG + Intergenic
958682939 3:97353862-97353884 CCCCTGTGGCCACCACCACTGGG - Intronic
958757683 3:98270719-98270741 CTCCTGTGGCCACCACCTTTAGG + Intergenic
958765218 3:98360066-98360088 CCCCTGTGGCCACCACCACTAGG + Intergenic
958837597 3:99163520-99163542 CTCCTATGGCCACCACTGCTTGG - Intergenic
958840081 3:99192486-99192508 CCACTATGGTCACTACCACTAGG - Intergenic
958862156 3:99457502-99457524 TCCCTGTGGCCACCACTACTAGG + Intergenic
958976877 3:100678866-100678888 CCCTTGTGGCCACCACCACTGGG + Intronic
959065084 3:101647950-101647972 CACCTGTGGTCCCCACTACCTGG + Intergenic
959183653 3:103014259-103014281 CGCCTGTGGTCCCAACTACTCGG + Intergenic
959191239 3:103113718-103113740 CCCATGTGGCCATCACCACTGGG - Intergenic
959285052 3:104397917-104397939 CTCCTGTGGCCAACACAGCTGGG - Intergenic
959448174 3:106466637-106466659 CCCCTGTGGCCACCACCGCTGGG + Intergenic
959701256 3:109301107-109301129 CACCTGTGGTCCCAACTACTGGG - Intronic
959717136 3:109444895-109444917 CGCCTGGGGCCACCACCACTGGG - Intergenic
959818881 3:110708517-110708539 CTCCTGTGGCTACCACCAATGGG + Intergenic
959841749 3:110984293-110984315 CCTCTGTGGCCAACACCACTAGG - Intergenic
959913603 3:111792947-111792969 CCCCTGTGGCCACCAACACTGGG + Intronic
959966256 3:112358747-112358769 CTCCTGTCCTTACCACAACTTGG + Intronic
960324402 3:116277493-116277515 CGCCTGTGGTCCCAGCCACTCGG - Intronic
960404261 3:117239435-117239457 CCCCTATGGCCACTACCACTGGG - Intergenic
960565015 3:119123595-119123617 GCCCTGTGGCCATCACCACTGGG - Intronic
960649433 3:119929953-119929975 CGCCTGTGGTCACAGCGACTCGG + Intronic
960870140 3:122239653-122239675 TCCCTGTGGCCACTACCACTGGG - Intronic
961246104 3:125455052-125455074 CACCTGTGGTCCCAGCCACTTGG - Intronic
961299392 3:125912649-125912671 CTCCTGTAGTCTCAGCCACTTGG - Intergenic
961378000 3:126479790-126479812 CTCCTGTGGTCCCAGCTACTTGG + Intergenic
961704874 3:128776409-128776431 CACCTGTGGTCCCAACTACTTGG - Intronic
961889097 3:130115410-130115432 CTCCTGTAGTCTCAGCCACTTGG + Intergenic
961952404 3:130763210-130763232 CCCCTGTGGCCTTCACCACTAGG - Intergenic
961986333 3:131138620-131138642 CTCCTTTGGTCACCACTACTGGG - Intronic
962015263 3:131432330-131432352 CCCCTGTGGCCCCCACCAATGGG - Intergenic
962047229 3:131773471-131773493 CACCTGTGGTCCCAACTACTTGG - Intronic
962483433 3:135817205-135817227 CCCTTGTGGCCACCATCACTGGG - Intergenic
962546445 3:136440861-136440883 CGCCTGTAGTCCCAACCACTTGG + Intronic
962667922 3:137674271-137674293 CATCTGTGGCTACCACCACTGGG - Intergenic
962698902 3:137978345-137978367 TTTCTGCGGCCACCACCACTAGG + Intergenic
962759015 3:138492093-138492115 CCACTATGGCCACCACCACTGGG + Intergenic
962787233 3:138779515-138779537 CACCTGTGGTCCCAACTACTCGG - Intronic
962799448 3:138877828-138877850 CTCCTGTAGTCCCAACTACTGGG - Intergenic
962843017 3:139252487-139252509 GTTCTGTGGCCACCCCCACTGGG + Intronic
962998460 3:140653676-140653698 CCCCTGTGGCCACCACCACTGGG - Intergenic
963140495 3:141942597-141942619 CTCCTGTGGTCCCAGCTACTCGG - Intergenic
963154232 3:142078371-142078393 TCCCTGTGGCCACCACCACTGGG - Intronic
963179536 3:142339171-142339193 CCCCTGTGGCCACCACCACTGGG - Intronic
963183365 3:142384924-142384946 CTCCTGTTCTCACATCCACTAGG + Intronic
963330635 3:143910739-143910761 ACCCTGTGGCCACCACCACTGGG - Intergenic
963595190 3:147317227-147317249 CCTCTGTGGACTCCACCACTGGG - Intergenic
963701423 3:148630845-148630867 TTCCTGTGGCCACCACAGCTGGG - Intergenic
963763246 3:149307252-149307274 CCCCTGTGGCCACCAATACTGGG + Intergenic
964021875 3:152022395-152022417 TTCCTGTGGCCACCAGCTCTGGG - Intergenic
964339087 3:155689048-155689070 CCCCTGTAATCACAACCACTGGG - Intronic
964398327 3:156272112-156272134 CCCCCGTGGCTACCACCACTGGG + Intronic
964804172 3:160588282-160588304 CCCCTGTGGCCACCACCACTGGG - Intergenic
965000005 3:162941162-162941184 TTCCTGTAGCCACCATCACTGGG - Intergenic
965014483 3:163139735-163139757 CTCTTGTGGCCGTCACCACTAGG + Intergenic
965035026 3:163426619-163426641 CCCCTATAGCCACCACCACTGGG - Intergenic
965045717 3:163573979-163574001 CCCCTGTGACAACCACCACTGGG - Intergenic
965160574 3:165128766-165128788 CCCCTATGGCCACCACCCCTAGG + Intergenic
965177755 3:165357743-165357765 CACCTGTGGTCCCAGCCACTTGG - Intergenic
965181144 3:165404958-165404980 CTCCTATGGGCACCACCAGTGGG - Intergenic
965236782 3:166135598-166135620 CTACTGTGGTCAATACTACTGGG + Intergenic
965317428 3:167209324-167209346 CCCCTGTGGCCACCAGCACTGGG - Intergenic
965582397 3:170282977-170282999 CACCTGTGGTCCCAACTACTTGG + Intronic
965980409 3:174682491-174682513 ACCCTGTGGCCACCACAACTGGG - Intronic
966079341 3:175980148-175980170 CTCCTGTAGTCACAGCTACTTGG - Intergenic
966142043 3:176767664-176767686 TTCCTGTGGCCACTACCACTGGG - Intergenic
966151785 3:176874219-176874241 CCCCTGTGGCCACCACCCCTGGG - Intergenic
966245818 3:177806852-177806874 CTCCTGTTCTCACCAACACTTGG + Intergenic
966329084 3:178790693-178790715 CCTCTGTGGCCACCACCACTGGG - Intronic
966401047 3:179547055-179547077 CACCTGTGGCCACCAGCACTGGG - Intergenic
966463591 3:180204037-180204059 CCCCTGTGGCCACCACCACTGGG - Intergenic
966523548 3:180898099-180898121 CACCTGTAGTCCCCGCCACTTGG + Intronic
966701198 3:182853331-182853353 CACCTGTGGTCCCAGCCACTCGG - Intronic
967032776 3:185623699-185623721 CTCCTGTGGTCCCAGCTACTTGG + Intronic
967119477 3:186370231-186370253 CACCTGTGGTCCCAGCCACTCGG - Intergenic
967179857 3:186894499-186894521 CTCCTGTGGTCCCAGCTACTTGG - Intergenic
967655642 3:192044560-192044582 CCCCTGTTGCCACCACCACTAGG - Intergenic
967677587 3:192317817-192317839 CCCCTGTGGCCACCACCACTGGG - Intronic
967696857 3:192542912-192542934 CTCCTGTTGTCACCACTATTAGG + Intronic
968096371 3:195933517-195933539 CTCCTGTGGCCACCAGCACTGGG - Intergenic
968191207 3:196668793-196668815 CTCCTGTAGTCCCAACTACTAGG + Intronic
968202710 3:196769199-196769221 CGCCTGTGGTGCCAACCACTCGG + Intronic
968215789 3:196888988-196889010 CGCCTGTAGTCCCCACTACTTGG + Intronic
968343309 3:197978509-197978531 CACCTGTGGTCCCAGCCACTTGG + Intronic
968368697 3:198207855-198207877 CACCTGTGGTCCCTACTACTTGG - Intergenic
970892914 4:21067700-21067722 TCCCTATGGCCACCACCACTGGG - Intronic
971954383 4:33396685-33396707 CTCCTATGGTCGCCAACACTGGG - Intergenic
972170106 4:36335347-36335369 CTCCTGTGGTCTCAGCTACTTGG - Intronic
972270964 4:37510618-37510640 CCCCTGTGACCACTACCACTAGG + Intronic
972555352 4:40175680-40175702 CGCCTGTGGTCCCAGCCACTCGG + Intergenic
972579366 4:40380882-40380904 CCCCTATGTCCACCACCACTGGG - Intergenic
972601836 4:40579871-40579893 CACCTGTGGTCACCTCTACATGG - Intronic
972761545 4:42110158-42110180 CACCTGTGGTCCCAACTACTCGG + Intergenic
972826615 4:42767065-42767087 CCCCTGTGGTCCCAACTACTCGG + Intergenic
972909646 4:43798169-43798191 TCCCTGTGGCCACCACCACTGGG - Intergenic
972915590 4:43874264-43874286 CTCCTGTGGCCACCACCACTAGG + Intergenic
972934340 4:44114015-44114037 TCCCTGTGGCCACCACCACTGGG + Intergenic
973766737 4:54169813-54169835 CGCCTGTAGTCCCCACTACTTGG - Intronic
973830137 4:54750888-54750910 CACCTGTGGTCCCAACTACTTGG + Intergenic
973852872 4:54978078-54978100 CTCCTGTGGCCGTCACTACTGGG - Intergenic
973863707 4:55090978-55091000 CACCTGTGGTCCCAACTACTTGG - Intronic
973919700 4:55672917-55672939 CAGTTGTGGCCACCACCACTGGG + Intergenic
973937919 4:55869238-55869260 CTCCTGTGGTCCCAGCTACTTGG + Intronic
973943461 4:55933453-55933475 CTCCTGTGGTCCCAGCTACTCGG + Intergenic
974267050 4:59598786-59598808 CCCCTGGAGCCACCACCACTGGG - Intergenic
974292388 4:59948878-59948900 CCCCTGTGGCCACCACCACTAGG - Intergenic
974333245 4:60506326-60506348 CCCCTGTGGCCACCACCACTGGG - Intergenic
974352910 4:60773199-60773221 CCACTGTGGCCATCACCACTGGG + Intergenic
974414876 4:61594670-61594692 CCCCTGTGACCACCATCACTGGG + Intronic
974469755 4:62303008-62303030 CCCCTGTGGCCACCAGCACTGGG - Intergenic
974542972 4:63262637-63262659 CACCTGTAGTCCCAACCACTTGG - Intergenic
974559315 4:63495966-63495988 TCACTGTGGCCACCACCACTGGG - Intergenic
974656165 4:64825348-64825370 CACCTGTGGTCACAGCTACTTGG + Intergenic
974771794 4:66423806-66423828 CTCCTGTGGCCACCACCTCTAGG - Intergenic
974915063 4:68169507-68169529 CACCTGTGGTCCCAACTACTTGG + Intergenic
974989888 4:69074213-69074235 CACCTGTGGTCCCAGCCACTTGG + Intronic
975081095 4:70281234-70281256 CCCCTGTGGCCACTACTACTGGG - Intergenic
975179950 4:71333442-71333464 CCCCTGTGGTCATTACTACTGGG + Intronic
975313035 4:72924928-72924950 CTCCTGTGACCACCACCCCTAGG + Intergenic
975335569 4:73171112-73171134 CCCCTGTGGTCACCACCACTGGG - Intronic
975437727 4:74372931-74372953 CGCCTGTGGTCCCAACTACTCGG - Intronic
975629870 4:76388733-76388755 CTCCTGTGGCTGCCACCACTGGG - Intronic
976029920 4:80740528-80740550 ACCCTGTGGCCATCACCACTGGG + Intronic
976082712 4:81374787-81374809 CTCCTGTGTCCACCAGCACTGGG + Intergenic
976171614 4:82310642-82310664 ACCCTGTGGCTACCACCACTAGG + Intergenic
976178765 4:82379897-82379919 CACCTGTGGTCCCAACTACTTGG - Intergenic
976444212 4:85111194-85111216 CCACTGTGGCCACCATCACTGGG - Intergenic
976453828 4:85223013-85223035 TCCCTGGGGCCACCACCACTGGG + Intergenic
976461654 4:85319619-85319641 CTACTGAGGTCACCAGGACTTGG - Intergenic
976563199 4:86525169-86525191 CTCCTGTTGTCCCAACTACTTGG + Intronic
976578056 4:86699258-86699280 CGCCTGTGGTCCCAACTACTCGG + Intronic
976611688 4:87036955-87036977 CTCCTGTAGTCCCAACTACTTGG - Intronic
976722161 4:88179131-88179153 CCCCTGTGGCCACCAACACAGGG - Intronic
976728393 4:88239291-88239313 CCCCTGTGGCCACCACCACTGGG + Intergenic
976908343 4:90267574-90267596 CCCCTGTGGTCACCCCCACTGGG - Intronic
976971882 4:91113976-91113998 CGCCTGTGGTCCCAACTACTCGG - Intronic
976971999 4:91115450-91115472 CACCTGTAGTCCCAACCACTTGG - Intronic
976982159 4:91244411-91244433 CCCCTGTGACCACCACTACTGGG - Intronic
977166824 4:93710487-93710509 CTGCTGTAGCCACCATCACTGGG + Intronic
977325594 4:95571719-95571741 CCCCTGCGGTGACCAACACTGGG + Intergenic
977341606 4:95764833-95764855 CCCTTGTGGCCATCACCACTAGG - Intergenic
977458565 4:97296094-97296116 CCTTTGTGGCCACCACCACTGGG + Intronic
977873586 4:102123340-102123362 CCCATGTGGCCACCTCCACTGGG + Intergenic
977985721 4:103380317-103380339 CCCCTGTGGCCACCACCTCTGGG - Intergenic
978082831 4:104615937-104615959 ATCCTGTGGCCACCGCCACTGGG + Intergenic
978112521 4:104979271-104979293 ACCCTATGGCCACCACCACTGGG - Intergenic
978287917 4:107099700-107099722 CCCCTATGGCCATCACCACTGGG - Intronic
978298271 4:107234760-107234782 CTCCTGTGGTCTCAGCTACTTGG + Intronic
978445815 4:108779060-108779082 CGCCTGTGGTCTCAGCCACTTGG - Intergenic
978516399 4:109573325-109573347 CACCTGTAGTCCCCACTACTCGG + Intronic
978520413 4:109609681-109609703 CCCCTATGGTCACCACCACTGGG + Intronic
978654477 4:111049615-111049637 CCCCTGTGGTCATCACTACTGGG - Intergenic
978883344 4:113735347-113735369 CGCCTGTGGTCACAGCTACTTGG + Intronic
978934502 4:114358903-114358925 CCCCTGTGGCAAACACCACTGGG + Intergenic
979257121 4:118617587-118617609 CACCTGTGGTCCCTACTACTTGG - Intergenic
979331226 4:119422955-119422977 CACCTGTGGTCCCTACTACTTGG + Intergenic
979892694 4:126119620-126119642 CCCCTGTGTTCACTACTACTGGG + Intergenic
979945945 4:126830924-126830946 CCCCAGTGGCTACCACCACTGGG - Intergenic
980646920 4:135653783-135653805 ACCCTGTGGACACCACCACTGGG - Intergenic
980657795 4:135812089-135812111 CCCCTGTAGCCACCACCACATGG - Intergenic
981068377 4:140508728-140508750 CCCCTGTGGACTCCACCTCTAGG + Intergenic
981076929 4:140601673-140601695 CCCCTGAGGCCACCACAACTAGG + Intergenic
981140337 4:141260078-141260100 CCCCTGTGACCACCACCACTGGG - Intergenic
981286550 4:143025244-143025266 CCCCTGTGGCCACCACCACTGGG - Intergenic
981429302 4:144641801-144641823 CACCTGTAGTCCCAACCACTTGG - Intergenic
981652322 4:147073847-147073869 CTCCTGTGGTCCCAGCCAATTGG + Intergenic
981965293 4:150592751-150592773 CACCTGTGGTCCCAGCCACTTGG - Intronic
981975652 4:150724202-150724224 AGTCTGTGGCCACCACCACTAGG - Intronic
982138581 4:152296012-152296034 CACCTGTGGTCCCAACTACTGGG - Intergenic
982339947 4:154285958-154285980 CCCCTGTGACCACCACCACTGGG - Intronic
982368153 4:154603317-154603339 CTCCTGTAGTCACAGCTACTCGG + Intergenic
982490515 4:156023858-156023880 CGCCTGTGGTCCCAACTACTTGG + Intergenic
982828193 4:160026907-160026929 CCCCTGTAGCCACCAGCACTGGG + Intergenic
982911670 4:161149466-161149488 CCCTTGTGAGCACCACCACTGGG - Intergenic
982932795 4:161429451-161429473 CCCCAGTGGCCAACACCACTGGG - Intronic
983017336 4:162629081-162629103 CTGCTGTGGACACCCCCAATGGG - Intergenic
983079180 4:163364346-163364368 CTCCTGTAGTCCCTGCCACTCGG + Intergenic
983133484 4:164051088-164051110 CTCCTGTGTGCACCACGAATTGG + Intronic
983165859 4:164476998-164477020 CCCCTGTTGCCACCACCATTGGG + Intergenic
983269259 4:165542223-165542245 CTGCTGATGTCACCACCACGTGG + Intergenic
983340130 4:166449862-166449884 TTCCTGTAGTCCCAACCACTCGG + Intergenic
983354070 4:166632846-166632868 CTCCTGTAGTCCCCGCTACTCGG + Intergenic
983724713 4:170906386-170906408 CGCCTGTAGTCACAACTACTCGG - Intergenic
984052788 4:174887649-174887671 CACCTGTAGTCCCAACCACTTGG + Intronic
984247269 4:177289917-177289939 CTCCTGTAGTCCCAACTACTTGG + Intergenic
984396727 4:179211374-179211396 CCCCTGTGGCCACCAACACTGGG + Intergenic
985086039 4:186313220-186313242 CTCCTGTTGTGACGATCACTTGG + Intergenic
985722158 5:1495029-1495051 TTCCTGTGGTCGCCGCCGCTGGG + Intronic
985757969 5:1730473-1730495 CCTCTGTGGTCACCTCCCCTGGG - Intergenic
985793846 5:1947688-1947710 CACCTGTGGTCCCAACTACTTGG - Intergenic
986254024 5:6086838-6086860 CACATGTGGACACCAGCACTAGG + Intergenic
986260893 5:6145426-6145448 CACCTGTGGTCCCAGCCACTTGG - Intergenic
986548435 5:8924994-8925016 CTCCTGTCACCACCACCACTGGG - Intergenic
986631061 5:9774838-9774860 CCTCTGTGGCCACCACCAGTGGG + Intergenic
986657469 5:10030015-10030037 CCCCTGTGGCCACCACCATTAGG + Intergenic
986913356 5:12585435-12585457 CCCCTGTGGCCACCACTATTAGG + Intergenic
987481831 5:18468508-18468530 CGCCTGTAGTCCCCACTACTCGG + Intergenic
987631561 5:20478841-20478863 CTTCTGTGGCCATCATCACTGGG - Intronic
987645974 5:20672628-20672650 CCCCTGTGGCTGCCACCACTGGG - Intergenic
987903979 5:24051383-24051405 CCCTTGTTGCCACCACCACTAGG - Intronic
988039745 5:25874197-25874219 CCCCTGTGGCTACCACCACTGGG + Intergenic
988064864 5:26220122-26220144 CTCCTGTGGCCACCGGCACTGGG - Intergenic
988117947 5:26920575-26920597 CCCCTGTGGCCCCCGCCACTGGG - Intronic
988265224 5:28941264-28941286 CCCCTGTGTCCACCACCACTGGG + Intergenic
988376335 5:30440015-30440037 CCCCTGTGGTCACCATCACTGGG - Intergenic
988384309 5:30540534-30540556 ACCCTGTGGCCACCACCAATGGG - Intergenic
988511095 5:31865436-31865458 CACCTGTGGTCCCAACTACTTGG - Intronic
988608311 5:32701936-32701958 CTGTTGTGGCCACCACCACTGGG + Intronic
988683717 5:33507449-33507471 CCCCTGTGGTCCTCACTACTTGG - Intergenic
988825697 5:34932293-34932315 CGCCTGTGGTCCCAGCCACTTGG + Intronic
988939450 5:36127990-36128012 CCCCTGTGGTCACCATCACTGGG - Intronic
988956276 5:36323669-36323691 CCCCTATGGCCACCACCACAGGG + Intergenic
989083181 5:37647804-37647826 TGCTTGTGGCCACCACCACTGGG + Intronic
989472135 5:41832268-41832290 TCCCTATGGCCACCACCACTGGG - Intronic
989514569 5:42327017-42327039 CACCTGTGGTCCCCGCTACTCGG - Intergenic
990041035 5:51378965-51378987 GTCCTTGGGCCACCACCACTTGG + Intergenic
990214121 5:53512627-53512649 CCCCTGTTGCCATCACCACTGGG + Intergenic
990774321 5:59287650-59287672 CCCCTGTGGCCACCACCACTGGG - Intronic
990828034 5:59923445-59923467 CCCTTGTGGCCACCACCACTGGG - Intronic
990900062 5:60739903-60739925 CCCCTGTGGCCACCATGACTGGG - Intergenic
991100010 5:62781610-62781632 GTACTGTGCTCACCACGACTCGG - Intergenic
991107360 5:62860372-62860394 CCCCTGTGGCCACCACCACTGGG + Intergenic
991209036 5:64083818-64083840 CTCATGTGGCCACCACCACTGGG + Intergenic
991237866 5:64419628-64419650 CCTCTGTGACCACCACCACTGGG - Intergenic
991395191 5:66197931-66197953 CCCCTGTGGCCACCACTACTGGG + Intergenic
991682017 5:69149470-69149492 TCCCTGTGGCCACCACCACTAGG + Intergenic
992285062 5:75226378-75226400 CCCCTATAGCCACCACCACTGGG - Intronic
992285069 5:75226415-75226437 CTCCTGTGGCTACCACCACTGGG - Intronic
992291483 5:75283983-75284005 CTCCTGTGGCCACCACCACTGGG - Intergenic
992309669 5:75482619-75482641 CCACTGTGGCCACTACCACTGGG - Intronic
992466814 5:77014247-77014269 CACCTGTGGTCCCAACTACTAGG + Intergenic
992467290 5:77019005-77019027 CTCCTGTGGTCCCAGCTACTTGG - Intergenic
992692600 5:79255840-79255862 CTCCTGTGGCCATCACCACTGGG + Intronic
992848183 5:80776013-80776035 CTCCTGTGGTCCCAGCTACTCGG - Intronic
992850692 5:80804685-80804707 CCTCTGTGACCACCACCACTGGG + Intronic
993120639 5:83769751-83769773 CACCTGTAGTCCCCACCACTTGG + Intergenic
993155700 5:84219091-84219113 CCTCTGTGGCCACCAACACTGGG - Intronic
993206965 5:84894714-84894736 CCCCTGTGGCCACCACCACTGGG + Intergenic
993278757 5:85898082-85898104 CCCCTGTGGCCACCACCACTAGG + Intergenic
993515018 5:88821378-88821400 CACCTGTGTTCCCAACCACTTGG - Intronic
993677563 5:90835454-90835476 CTCTTGTGGTCACTGCCACTGGG + Intronic
994138592 5:96317349-96317371 CTCCTGTAGTCCCAACTACTAGG + Intergenic
994310887 5:98268689-98268711 CTCCTATGGCCACCACCTCTGGG - Intergenic
994344015 5:98663838-98663860 TTCCTGTGGCCACAACCACCAGG - Intergenic
994457788 5:100034477-100034499 CTCCTGTGGTCCCAGCTACTCGG + Intergenic
994974207 5:106780704-106780726 CCCCTGTGGCCACCAACACTGGG - Intergenic
995049745 5:107688589-107688611 CTCTTATATTCACCACCACTGGG - Intergenic
995290158 5:110442991-110443013 CCCTTGTGTTCACCACCACTGGG + Intronic
995372450 5:111434165-111434187 CTCCTGTAGTCCCAACTACTCGG + Intronic
995557646 5:113345499-113345521 CCCCTGTGGTTCCCACCACTAGG - Intronic
995697691 5:114898992-114899014 CCCCTGTGGCCAACACCACTAGG + Intergenic
996039918 5:118798058-118798080 ATCCTGTAGTCAGGACCACTGGG + Intergenic
996060715 5:119030186-119030208 CGCCTGTGGTCACAACTACTTGG + Intergenic
996259413 5:121446857-121446879 CACCAGTGGCCAACACCACTGGG - Intergenic
996341936 5:122448373-122448395 CACCTGTAGTCCCCACTACTTGG + Intronic
996459642 5:123726105-123726127 CCCCTGTGGCCACTGCCACTGGG - Intergenic
996531945 5:124535694-124535716 CACCTGTAGTCCCCACTACTCGG - Intergenic
996931554 5:128895675-128895697 CCCCTGTGGCCACCACCACTGGG + Intronic
997180509 5:131824073-131824095 CCCCTGTGACCACCACCAATGGG + Intronic
997435411 5:133870625-133870647 CTCATGTGGTCAATGCCACTTGG - Intergenic
997755142 5:136389008-136389030 CACCTGTAGTCCCCACTACTTGG + Intronic
997936546 5:138117081-138117103 CTCCTGTGGTCCCAGCTACTTGG + Intronic
998022461 5:138781428-138781450 CCCCTGTAGTCACAGCCACTTGG + Intronic
998066312 5:139161885-139161907 CTCCCGTAGTCCCCACTACTTGG + Intronic
999559597 5:152786178-152786200 TCCCTGTGGCCAACACCACTAGG - Intergenic
999685667 5:154100788-154100810 CTCCAGTGGGCACCAAAACTGGG + Intronic
999919407 5:156302877-156302899 CCACTGTGGCCACCAACACTGGG + Intronic
1000308180 5:160015333-160015355 CGCCTGTGGTCCCAGCCACTTGG - Intronic
1000376676 5:160589135-160589157 CGCCTGTGGTCACAGCTACTCGG - Intronic
1000433627 5:161180682-161180704 ACCCTGTGGCCACCAACACTGGG - Intergenic
1000478534 5:161743579-161743601 CGCCTGTGGCCACTACCACTAGG + Intergenic
1001031634 5:168267512-168267534 CTCCTGTGGTCCCAGCTACTTGG - Intergenic
1001310885 5:170609729-170609751 CTCCTGTAGTCCCAACTACTTGG + Intronic
1001431103 5:171662945-171662967 CACCTGTGGTCCCAGCCACTTGG - Intergenic
1001709015 5:173762951-173762973 CCCCTGTGGTCACAGCTACTCGG + Intergenic
1002384639 5:178857237-178857259 CTCCTGTGGTCCCAGCTACTTGG - Intergenic
1002727975 5:181313420-181313442 CACCTGTGGTCCCTACTACTTGG - Intergenic
1003057001 6:2830723-2830745 CTCCTGTGGTCCCAGCTACTTGG + Intergenic
1003506897 6:6747389-6747411 GCCCTGTGGACACCACCAATGGG - Intergenic
1003638672 6:7858207-7858229 CTCCTGTAGTCCCAACTACTCGG - Intronic
1003952219 6:11127043-11127065 CCCCTGTGGCCACCACTGCTGGG + Intronic
1004090079 6:12492254-12492276 CGCCTGTGGTCACAGCTACTCGG - Intergenic
1004473078 6:15946500-15946522 CACCTGTGGTCCCAACTACTTGG - Intergenic
1004591046 6:17052124-17052146 CTCCTGTGGCCCCAACTACTTGG - Intergenic
1005210545 6:23455342-23455364 CACCTGTAGTCACAGCCACTTGG - Intergenic
1005280030 6:24262959-24262981 CCCATATGGCCACCACCACTGGG - Intronic
1005967036 6:30733924-30733946 CCCCTGTGGTCCCAACTACTGGG + Intronic
1005969954 6:30752967-30752989 CTCCCAGGGTCAGCACCACTTGG - Intergenic
1006236961 6:32642059-32642081 CTCCTGTGGTCAACATCACATGG + Exonic
1006246956 6:32745878-32745900 CTCCTGTGGTCAACATCACCTGG + Exonic
1006494342 6:34410918-34410940 CACCTGTGGTCCCAACTACTTGG + Intronic
1006963841 6:37961591-37961613 CTCCTATGGCCACCAGCTCTAGG - Intronic
1007015621 6:38463904-38463926 TTCCTGTGGTCCCAACTACTTGG + Intronic
1007189707 6:40003135-40003157 CTTCTGTGCTCATCACCCCTTGG + Intergenic
1007254467 6:40519032-40519054 CTCCTATGGTTAGCACCCCTGGG - Intronic
1007594546 6:43043452-43043474 CTCCTGTGGTGGCCACTCCTCGG - Exonic
1007845122 6:44747987-44748009 CTTCTGTGGACCCCACCTCTGGG + Intergenic
1008118290 6:47579207-47579229 TTCCTGTGGTCCCAGCCACTTGG + Intronic
1008192467 6:48476224-48476246 CCCCTGTGTCCACCACTACTGGG - Intergenic
1008622875 6:53288938-53288960 CTCCTGTAGTCCCAGCCACTTGG + Intronic
1008848418 6:55995893-55995915 CTCCTGTGGCCACCACCACTGGG + Intergenic
1009039246 6:58157735-58157757 ACCCTGTGGCCACCACCACTGGG + Intergenic
1009183357 6:60545117-60545139 CACCTGTGGTCCCAACTACTTGG - Intergenic
1009215145 6:60912578-60912600 ACCCTGTGGCCACCACCACTGGG + Intergenic
1009309105 6:62126569-62126591 CTTTTGTGGCCATCACCACTGGG - Intronic
1009353320 6:62708857-62708879 CCCTGGTGGCCACCACCACTTGG + Intergenic
1009744944 6:67799697-67799719 TCCCTGTGGCTACCACCACTGGG - Intergenic
1009978414 6:70699310-70699332 CCCATGTGACCACCACCACTGGG + Intronic
1010139824 6:72601699-72601721 CCACTGTGGCCACCACCACTAGG + Intergenic
1010235057 6:73568252-73568274 CGCCTGTGGTCCCAACTACTCGG + Intergenic
1010502298 6:76615632-76615654 CCCTTGTGGCCACCATCACTGGG - Intergenic
1010548115 6:77183945-77183967 ACCCTGTGGCCACCACCACTGGG - Intergenic
1010560187 6:77340094-77340116 CCCCTGTGGCCACCACCAATAGG + Intergenic
1010748348 6:79589895-79589917 CGCCTGTAGTCACGGCCACTTGG - Intergenic
1010975752 6:82312067-82312089 CCCATGTGGCAACCACCACTAGG + Intergenic
1011060839 6:83265420-83265442 CTCCTGTGGTCCCAGCCACTAGG - Intronic
1011102819 6:83743513-83743535 CCCCAGTGGCCACCACCACTGGG + Intergenic
1011236119 6:85218849-85218871 CCCCTGTGACCACCACAACTGGG - Intergenic
1011291072 6:85778341-85778363 CTCCTGTGGCCACTACCACTGGG + Intergenic
1011322741 6:86115347-86115369 CCCCTGTGGCCACCACCACTGGG + Intergenic
1011333130 6:86232968-86232990 CTCCTGGAGCCACCACCATTAGG + Intergenic
1011343336 6:86341191-86341213 ACCCCTTGGTCACCACCACTGGG - Intergenic
1011479470 6:87779770-87779792 ATTCTGTGGATACCACCACTCGG - Intergenic
1011609668 6:89138737-89138759 CTCCTGTAGTCCCAACTACTTGG + Intergenic
1011791747 6:90906642-90906664 CTCCTGGGGCCACCACCACTGGG + Intergenic
1012028719 6:94030354-94030376 TCCCAGTGGCCACCACCACTGGG - Intergenic
1012415446 6:99008167-99008189 CTCCTGTGGTCCCAGCTACTTGG - Intergenic
1012712650 6:102628359-102628381 CTCCTATGGTCATCACCGCTGGG + Intergenic
1012807001 6:103907869-103907891 CCCCTGTGGCCACCACCAGTGGG + Intergenic
1012892221 6:104908950-104908972 CCCCTGTGGCTGCCACCACTGGG - Intergenic
1012940581 6:105410400-105410422 CCCCTGTGGTCACCACCACTGGG - Intergenic
1013069960 6:106719700-106719722 CACCTGTAGTCCCAACCACTCGG + Intergenic
1013246887 6:108295180-108295202 CTCCTCTGGCCACCGCCCCTGGG + Exonic
1013291676 6:108725221-108725243 CACCTGTGGTCCCAACTACTTGG - Intergenic
1013522149 6:110943086-110943108 CACCTGTGGTCCCAACTACTCGG + Intergenic
1013524810 6:110964187-110964209 CGCCTGTGGTCCCAACTACTGGG - Intronic
1013673333 6:112429605-112429627 CTCCTGTGGCCATCACCACTGGG + Intergenic
1013730812 6:113164541-113164563 CTCCTGTAGTCCCAACTACTTGG + Intergenic
1014073823 6:117214768-117214790 CCCCTGTGGCTACAACCACTGGG + Intergenic
1014234742 6:118941026-118941048 CCCTTGTGGCCACAACCACTGGG - Intergenic
1014435246 6:121413660-121413682 TGCCTGTGGTCCCCACCACTTGG + Intergenic
1014467765 6:121777835-121777857 CTCCTGTGGTCTCAGCTACTTGG - Intergenic
1014692534 6:124578795-124578817 ACCCTCTGGCCACCACCACTGGG - Intronic
1014838873 6:126193616-126193638 CTCCTGTGGTCCCAGCTACTCGG - Intergenic
1014855455 6:126395944-126395966 CCCCTGTGGCCACCACCACTGGG + Intergenic
1015183309 6:130383992-130384014 CACCTGTGGTCCCAACTACTTGG + Intronic
1015578704 6:134701128-134701150 CCCCTGCAGCCACCACCACTAGG + Intergenic
1015957255 6:138611618-138611640 CTCCTGTAGTCCCAGCCACTCGG + Intronic
1015970584 6:138739316-138739338 CTCCTGTGGTCCCAGCTACTTGG - Intergenic
1015995353 6:138990675-138990697 CACCTGTGGTCCCAACTACTCGG + Intergenic
1016007927 6:139108241-139108263 CACCTGTGGTCCCAGCCACTTGG + Intergenic
1016061475 6:139635821-139635843 ACCCTGTGGCCACCAGCACTGGG + Intergenic
1016127788 6:140427640-140427662 CCCTTGTGGCCACCACCACTGGG + Intergenic
1016136777 6:140554328-140554350 CCCCTGTGGCCACCACCACCAGG + Intergenic
1016229897 6:141789656-141789678 CACCTTTGGCCACCACTACTAGG - Intergenic
1016457265 6:144244569-144244591 CCCCTGTGGCCACCACCACTGGG + Intergenic
1017387482 6:153902274-153902296 CACCTGTAGCCACCACCAGTGGG - Intergenic
1017467043 6:154703981-154704003 CACCTGTGGTCCCAGCCACTCGG + Intergenic
1017508341 6:155089330-155089352 CGCCTGTAGTCCCCACTACTTGG - Intronic
1017897436 6:158692823-158692845 CGCCTGTGGTCCCAGCCACTCGG + Intronic
1017924713 6:158901123-158901145 CCCCCGTGGCCATCACCACTGGG + Intronic
1018251519 6:161876435-161876457 CGCCTGTAGTCACAACTACTTGG - Intronic
1018738739 6:166711071-166711093 CACCAGTGGACACCACCCCTGGG - Intronic
1018870832 6:167780965-167780987 TGCCTGTGGTCCCAACCACTCGG + Intergenic
1018917504 6:168145818-168145840 CCCCTATGGCTACCACCACTGGG + Intergenic
1019437435 7:1029251-1029273 CTCCTGTGGTCCCAGCTACTCGG - Intronic
1019505932 7:1391001-1391023 CTCCTGTGGTCCCAGCTACTTGG - Intergenic
1019509315 7:1409429-1409451 CACCTGTGGTCCCAGCCACTCGG + Intergenic
1019546763 7:1581372-1581394 CTCCTGTGGTCCCAGCTACTAGG + Intergenic
1020028125 7:4913785-4913807 CACCTGTGGTCCCAACTACTCGG - Intronic
1020188580 7:5976903-5976925 TGCCTGTGGTCACAACTACTTGG + Intronic
1020294335 7:6747867-6747889 TGCCTGTGGTCACAACTACTTGG - Intergenic
1020812758 7:12865510-12865532 CTCCTGTGGCCACCACCACTGGG - Intergenic
1021034908 7:15785535-15785557 CCCCTGTGGCCACCATCACTGGG - Intergenic
1021353834 7:19628879-19628901 CCCCTGTGGCCACCACCCCTAGG - Intergenic
1021720438 7:23499525-23499547 CGCCTGTGGTCCCAACTACTTGG - Intergenic
1022068097 7:26882178-26882200 CACCTGTGGTCCCAACTACTGGG - Intronic
1022153961 7:27640402-27640424 CACCTGTGGTCCCAACTACTTGG + Intronic
1022223481 7:28339543-28339565 CCCCTGTGGCCCCCACTACTTGG + Intronic
1022259996 7:28695099-28695121 CACCTGTGGTCCCAGCCACTTGG + Intronic
1022716386 7:32902339-32902361 CTCCTGTGGTCCCCACTACTTGG + Intergenic
1022749767 7:33212920-33212942 GTCTTGTGGCCACCAACACTGGG + Intronic
1022758838 7:33325897-33325919 CTCCCATGGCCACCACCAATGGG + Intronic
1023378834 7:39585972-39585994 CACCTGTGGTCCCAGCCACTTGG + Intronic
1023399096 7:39778863-39778885 CACCTGTGGTCCCTACTACTTGG - Intergenic
1024170388 7:46778727-46778749 CCCCTGTGGCCACCAGCACTAGG - Intergenic
1024415124 7:49097018-49097040 CCCCTGTGGCTACCACCATTAGG - Intergenic
1024529023 7:50375296-50375318 CACCTGTAGTCACAACTACTGGG + Intronic
1024691772 7:51810339-51810361 CTCCAGAGATCATCACCACTTGG - Intergenic
1024956614 7:54927325-54927347 ACCCTGTGGTCACCAACACTAGG - Intergenic
1025055482 7:55761424-55761446 CACCTGTGGTCCCCACTACTTGG + Intergenic
1025133554 7:56391649-56391671 CACCTGTGGTCCCTACTACTTGG + Intergenic
1025160573 7:56655666-56655688 CCCCTGTGGCCACCATCACTAGG - Intergenic
1025185149 7:56851828-56851850 CACCTGTGGTCCCCACTACTTGG + Intergenic
1025686783 7:63725136-63725158 CACCTGTGGTCCCCACTACTTGG - Intergenic
1025726155 7:64063536-64063558 CCCCTGTGGCCACCATCACTAGG + Intronic
1025754911 7:64329670-64329692 CCCCTGTGGCCACCATCACTAGG + Intronic
1025910475 7:65824726-65824748 CACCTGTGGTCCCCACTACTTGG - Intergenic
1026017275 7:66681522-66681544 CACCTGTGGTCCCAACTACTGGG - Intronic
1026044657 7:66898666-66898688 CACTTGTGGTCCCCACTACTTGG - Intergenic
1026428897 7:70324497-70324519 CATCTGTGGTCCCAACCACTCGG + Intronic
1026628026 7:72013375-72013397 CACCTGTGGTCCCAACTACTGGG - Intronic
1026628954 7:72021147-72021169 CACCTGTGGTCCCAGCCACTTGG + Intronic
1026686049 7:72511091-72511113 CTCCTGTGGTCCCAGCTACTTGG - Intergenic
1026787910 7:73313331-73313353 CTCCTGCGGCCGCCACTACTGGG - Exonic
1026871110 7:73852375-73852397 CACCTGTGGTCCCAACTACTTGG - Intergenic
1026943968 7:74304817-74304839 CACCTGTGGTCCCAACTACTCGG + Intronic
1026996271 7:74618772-74618794 CACCTGTGGTCCCAACTACTTGG + Intergenic
1027244046 7:76353945-76353967 CTCCTGTAGTCCCAACTACTTGG + Intronic
1027490154 7:78813658-78813680 CGCCTGTGGTCCCAGCCACTCGG + Intronic
1027524180 7:79245862-79245884 CTCCTCTGGCCACCACCGCTGGG - Intronic
1027604992 7:80288710-80288732 CCCCTGTGACCACCACCTCTGGG - Intergenic
1027663855 7:81020011-81020033 CTCCTGTGGTCCCAGCTACTTGG + Intergenic
1027760559 7:82273611-82273633 CTCCTGTGGTCAAAGCTACTTGG - Intronic
1028001490 7:85502718-85502740 CCCCTGTGTCCACCACCCCTAGG - Intergenic
1028022472 7:85793162-85793184 GCACTGTGGCCACCACCACTGGG - Intergenic
1028186344 7:87790115-87790137 CTCCTATGGCCACCATCACTGGG - Intronic
1028190891 7:87850640-87850662 CTCCTGTGGTCCCAGCTACTTGG + Intronic
1028207439 7:88033453-88033475 CCCATGTGGCCACCATCACTGGG + Intronic
1028266468 7:88732918-88732940 CACCTGTGGCCACCACCACTGGG + Intergenic
1028420553 7:90628078-90628100 CACCTGTGGTCCCAACTACTTGG - Intronic
1028828535 7:95301969-95301991 CGCCTGTGGTCCCAACTACTTGG + Intronic
1028929428 7:96397037-96397059 TTCCTGTGGCCACCAACACTGGG + Intergenic
1029359838 7:100080685-100080707 CGCCTGTAGTCCCAACCACTCGG + Intronic
1029394963 7:100301548-100301570 CACCTGTAGTCACAGCCACTCGG - Intergenic
1029659609 7:101951203-101951225 CGCCTGTGGTCCCAACCACTTGG + Intronic
1029820308 7:103140516-103140538 CTCCTGTAGTCCCAGCCACTTGG - Intronic
1029840598 7:103359096-103359118 CACCTGTGGTCCCAGCCACTTGG - Intronic
1030662807 7:112239465-112239487 CTCCTGTGGTCACCACCACTGGG - Intronic
1030666123 7:112280749-112280771 CACCTGTAGTCCCCACTACTCGG - Intronic
1030785995 7:113662450-113662472 CACCTGTGGTCCCAACTACTCGG + Intergenic
1030791336 7:113732640-113732662 CTCCTGTAGTCCCAACTACTTGG - Intergenic
1031098587 7:117449486-117449508 TCCCTGTGGCCACCACCACTGGG - Intergenic
1031306375 7:120131717-120131739 CCCATGTGGCCACTACCACTGGG - Intergenic
1031336392 7:120538574-120538596 CTCTTGGGGCCACCAGCACTGGG + Intronic
1031412408 7:121456241-121456263 CCCCTGTGGCTACCACCACTGGG + Intergenic
1031565982 7:123297189-123297211 CTTCTGTGGCCACCGCCACTGGG - Intergenic
1031606694 7:123776537-123776559 CACCTGTAGTCCCAACCACTTGG - Intergenic
1031753920 7:125613314-125613336 CCCCTGTGGCCACCAGCACTGGG - Intergenic
1031862393 7:126994980-126995002 CCCCTGTGGCCACCACCACTGGG - Intronic
1032049428 7:128638365-128638387 CACCTGTGGTCCCTACTACTTGG - Intergenic
1032109534 7:129063725-129063747 CACCTGTGGTCCCAACTACTGGG + Intergenic
1032138680 7:129307010-129307032 GCCCTGTGGCCACCAACACTGGG + Intronic
1032506384 7:132437754-132437776 TTGCTGTGGTCACCACTTCTGGG - Intronic
1032742390 7:134751849-134751871 CTCCTGTGGTCCCAGCTACTTGG + Intronic
1033020564 7:137720381-137720403 CGCCTGTGGTCCCAGCCACTCGG - Intronic
1033194300 7:139314327-139314349 CTCCTGTAGTCCCAGCCACTGGG + Intergenic
1033213318 7:139476563-139476585 CACCTGTAGTCCCCACTACTTGG - Intronic
1033296544 7:140143053-140143075 CGCCTGTAGTCCCCACTACTCGG + Intronic
1033499995 7:141937763-141937785 TCCCTGTGACCACCACCACTGGG - Intronic
1033813967 7:145050598-145050620 CTCCCAGGGACACCACCACTGGG + Intergenic
1033867676 7:145713026-145713048 GCCCTGTGACCACCACCACTGGG + Intergenic
1034003337 7:147441932-147441954 CCCCTATGGCAACCACCACTAGG + Intronic
1034272287 7:149809083-149809105 TTCCTGTAGCCACCACCACAGGG - Intergenic
1034398179 7:150843100-150843122 CCCCTGTGGCCACCGCCACTGGG - Intronic
1034404761 7:150896092-150896114 TTCCTGTGGCCACCACCACAAGG - Intergenic
1034521231 7:151621696-151621718 CGCCTGTGGTCCCAACTACTTGG - Intronic
1034733373 7:153407300-153407322 CACCTGTGGTCTCAACTACTCGG - Intergenic
1035018107 7:155783810-155783832 CACCTGTGGTCCCAGCCACTGGG - Intergenic
1035084417 7:156246333-156246355 ACCCTGTGGCCAACACCACTAGG + Intergenic
1035139197 7:156739532-156739554 CTCCTGTGGCCACCAACACTGGG - Intronic
1035414358 7:158670438-158670460 CTCCTGTGGTCCTAGCCACTTGG + Intronic
1035753945 8:2017336-2017358 TCCCTCTGGTCACCACCACTGGG + Intergenic
1036578652 8:10052998-10053020 CACCTGTGGTCCCAACTACTTGG - Intergenic
1036643791 8:10599925-10599947 CTCCTGTGGCCACCTCCATCTGG + Intergenic
1036759861 8:11500639-11500661 CACCTGTGGTCCCAACTACTTGG - Intronic
1036814630 8:11892323-11892345 CTCCTGTGGTCCCAGCTACTTGG - Intergenic
1036945877 8:13094538-13094560 CTCCTGTAGTCCCAGCCACTTGG + Intronic
1037254922 8:16942398-16942420 CCCCTGTGGTCACCACTACTGGG - Intergenic
1037277222 8:17193444-17193466 CCTCTGTGGCCAACACCACTGGG + Intronic
1037295751 8:17397809-17397831 CCCCTGTGGCCACCACCACTGGG - Intronic
1037431065 8:18813705-18813727 CTCCAGTGGTCACCAGTTCTGGG + Intronic
1038568851 8:28642318-28642340 CACCTGTGGTCCCAGCCACTTGG + Intronic
1038600081 8:28931665-28931687 CTCCTGTGGTCCCAGCTACTTGG - Intronic
1038736139 8:30171373-30171395 CACCTGTGGTCCCAACTACTTGG - Intronic
1038944047 8:32337134-32337156 CTCCTGTAGTCACAGCTACTTGG - Intronic
1039484507 8:37900151-37900173 CGCCTGTGGTCCCCGCTACTTGG + Intergenic
1040415153 8:47188919-47188941 CTCCTGGAGCCACCACCGCTGGG + Intergenic
1040485735 8:47869592-47869614 TCCCTGTGGCCACCACAACTGGG - Intronic
1040511395 8:48099604-48099626 CCCCTGTGGCCACCAGCACTAGG + Intergenic
1040721016 8:50323699-50323721 CCTCTGTGGCCACCACCACTGGG + Intronic
1040742993 8:50603877-50603899 CCCCTGTGGCCACCATCATTAGG + Intronic
1041416124 8:57610138-57610160 ACCCTGTGTTCTCCACCACTGGG - Intergenic
1041500292 8:58532912-58532934 CCCCTGTGGCCACCAATACTGGG + Intergenic
1041579803 8:59446278-59446300 CCCCTGTGGCCACAACCACTGGG + Intergenic
1041790710 8:61693586-61693608 CTCCCACGGCCACCACCACTGGG + Intronic
1042082440 8:65070468-65070490 CTCCTGTGGCCACTACCACTGGG + Intergenic
1042279678 8:67042148-67042170 CGCCTGTGGTCCCAACTACTTGG - Intronic
1042424010 8:68624859-68624881 TGCCTGTGGTCCCCACTACTCGG - Intronic
1042428284 8:68673868-68673890 CCCCTGTGGTCACCACAGCTGGG - Intronic
1042558762 8:70056605-70056627 CACCTGTGGTCCCAGCCACTCGG - Intronic
1042589292 8:70380948-70380970 CGCCTGTGGTCCCGACTACTTGG + Intronic
1042607144 8:70556833-70556855 CACCTGTGGTCACAGCTACTTGG + Intergenic
1043062777 8:75526252-75526274 CACCTGTGGTCACAGCTACTCGG - Intronic
1043134108 8:76500209-76500231 CCGCTGTGGCCACCACCACTCGG + Intergenic
1043215047 8:77574721-77574743 CCCCTGTGGCCACTACCACTGGG - Intergenic
1043493925 8:80779365-80779387 CTCCTGTGGTCCCAGCTACTCGG - Intronic
1043567443 8:81563015-81563037 CCCCTGTGGCCACCCCCACTGGG - Intergenic
1044058263 8:87599686-87599708 CACCTGTGGTCCCAGCCACTTGG - Intronic
1044124365 8:88438758-88438780 CTCCTGTGGCCACCATCACTGGG - Intergenic
1044192961 8:89341938-89341960 ACTCTGTGGCCACCACCACTGGG + Intergenic
1044516094 8:93140464-93140486 CTCCTGTGGTCCCAGCTACTTGG + Intronic
1044519808 8:93186362-93186384 CACCTGTGGTCCCAACTACTTGG + Intergenic
1044968758 8:97599353-97599375 CACCTGTGGTCCCAGCCACTGGG + Intergenic
1045041200 8:98226672-98226694 CCCCTGTGGCCACTCCCACTGGG + Intronic
1045193811 8:99909639-99909661 CGCCTGTGGTCCCAACTACTGGG + Intergenic
1045275094 8:100697006-100697028 CGCCTGTAGTCCCAACCACTTGG + Intronic
1045804039 8:106136041-106136063 CTCCTGTGGTCCTAACTACTTGG - Intergenic
1045983685 8:108222166-108222188 CTCCTGTGGCCCCAACTACTTGG - Intronic
1045995020 8:108352294-108352316 CCCCTGTGGCCACCACCACTGGG - Intronic
1046114053 8:109764637-109764659 CCCTTGGGGCCACCACCACTGGG + Intergenic
1046335538 8:112781664-112781686 CTCCTGTGGTCAGCACCACTGGG - Intronic
1046381152 8:113452790-113452812 CTCATGTGTTCAATACCACTGGG - Intergenic
1046631614 8:116627472-116627494 CGCCTGTAGTCCCCACTACTTGG + Intergenic
1047150656 8:122258258-122258280 TTCCTGTTGTCAGCACCCCTGGG - Intergenic
1047328891 8:123866741-123866763 CACCTGTGGTCCTCACTACTCGG - Intronic
1047342668 8:123998467-123998489 CTTCTGTTGCTACCACCACTGGG + Intronic
1047501427 8:125444835-125444857 CACCTGTGGTCACAGCAACTTGG - Intergenic
1047697901 8:127421077-127421099 CTCCTGAGCTCACCATCTCTGGG - Intergenic
1047901199 8:129423790-129423812 CCCCTATGGCCATCACCACTGGG - Intergenic
1047910216 8:129519233-129519255 CCCCTGTGGCTACCACCACTAGG - Intergenic
1047937903 8:129799946-129799968 CCTCTGTGGCTACCACCACTGGG + Intergenic
1048029779 8:130620659-130620681 CCCCTGTGGCCACCACGACTGGG + Intergenic
1048057582 8:130882915-130882937 GTCCTGTTGCCATCACCACTGGG + Intronic
1048118877 8:131556165-131556187 TCCCCGTGGCCACCACCACTGGG - Intergenic
1048358270 8:133671869-133671891 CTGCTGAGCTCACTACCACTGGG - Intergenic
1048471862 8:134711494-134711516 CACCTGTGGTCACAGCTACTTGG + Intronic
1048706121 8:137155615-137155637 CACCTGTGTCCACCACCACAGGG + Intergenic
1048720902 8:137323397-137323419 CTCCTGTGGTCACAGCTACTCGG - Intergenic
1049062703 8:140288215-140288237 CACCTGTGGTCCCAACTACTTGG + Intronic
1049063975 8:140298524-140298546 CACCTGTGGTCCCACCCACTCGG + Intronic
1049142148 8:140964501-140964523 CACCTGTGGTCCCAACTACTTGG - Intronic
1049528122 8:143139557-143139579 CTCCTGTGGTCCCAGCTACTTGG - Intergenic
1049963550 9:758407-758429 CGCCTGTGGTCCCAGCCACTTGG - Intergenic
1050248276 9:3714341-3714363 CTTCTCTTGCCACCACCACTGGG - Intergenic
1050251608 9:3750458-3750480 CTCCTGTGGTCCCAGCCACTGGG - Intergenic
1050316123 9:4402135-4402157 CCCCTGTGGCCACCACCACTGGG - Intergenic
1050572796 9:6958792-6958814 CACCTGTGGTCCCAACCACATGG - Intronic
1050722074 9:8601474-8601496 ACCCTGTGGCCATCACCACTGGG - Intronic
1050906810 9:11015548-11015570 CCCCTGTGAGCATCACCACTGGG + Intergenic
1050930083 9:11311924-11311946 CTCCCATTGCCACCACCACTGGG + Intergenic
1051029790 9:12659277-12659299 CTAGTGTGGCCACCACCACTGGG - Intergenic
1051047287 9:12889591-12889613 CCCTTGTGGCCACAACCACTGGG - Intergenic
1051306829 9:15718563-15718585 CCCCTGTGGCCACCACCAGTAGG - Intronic
1051465173 9:17368586-17368608 CCCCTGTGGCCACCACCACTGGG - Intronic
1051966545 9:22835679-22835701 CCACTGTGGCCACCATCACTGGG + Intergenic
1052204823 9:25827191-25827213 CTTCTGTAGTCACCACCACCGGG + Intergenic
1052298773 9:26930228-26930250 CGCCTGTGGTCCCAGCCACTCGG - Intronic
1052420349 9:28235108-28235130 CCCTTGTGGCCACCACCACTGGG - Intronic
1052446057 9:28562970-28562992 CGCCTGTTGTCCCCACTACTTGG - Intronic
1052733000 9:32311262-32311284 CCCCTGTGGTCACCACCAGTGGG - Intergenic
1052831491 9:33219783-33219805 CACCTGTGGTCCCAACTACTTGG - Intronic
1053028116 9:34748465-34748487 AGCCTGTGGCCACCACAACTAGG - Intergenic
1053040170 9:34863363-34863385 CCCCTGTGGCCACCACCACTGGG - Intergenic
1053504652 9:38631289-38631311 CTCCTGTGGTCCCAGCTACTGGG - Intergenic
1053506321 9:38646436-38646458 CTCCTGTGGTCCCAGCTACTTGG + Intergenic
1053682560 9:40495248-40495270 CTCCTGTAGTCCCAACTACTTGG - Intergenic
1053854059 9:42319899-42319921 CGCCTGTGGTCCCAACTACTAGG + Intergenic
1053932543 9:43123588-43123610 CTCCTGTAGTCCCAACTACTTGG - Intergenic
1054281154 9:63129681-63129703 CTCCTGTAGTCCCAACTACTTGG + Intergenic
1054295658 9:63330762-63330784 CTCCTGTAGTCCCAACTACTTGG - Intergenic
1054393678 9:64635257-64635279 CTCCTGTAGTCCCAACTACTTGG - Intergenic
1054428327 9:65140470-65140492 CTCCTGTAGTCCCAACTACTTGG - Intergenic
1054502052 9:65881075-65881097 CTCCTGTAGTCCCAACTACTTGG + Intronic
1054883549 9:70171372-70171394 CACCTGTGGTCACAGCTACTTGG + Intronic
1054956304 9:70914686-70914708 CTCCTGTGACCACCAGCACTAGG - Intronic
1055181120 9:73388386-73388408 ATCCTGGGGCCACCATCACTGGG + Intergenic
1055302161 9:74892773-74892795 CCCTTGTGGCCACCACCACTGGG - Intergenic
1055387370 9:75776543-75776565 CCCCTGTGGCCACCACCACTGGG - Intergenic
1055407422 9:75989366-75989388 CTCCTGTGGTCCCAGCTACTTGG + Intronic
1055550260 9:77426428-77426450 CACCTGTGGTCCCAGCCACTCGG - Intronic
1055886363 9:81068829-81068851 GCCCTGTGGCCACCACCAGTGGG + Intergenic
1056084258 9:83129279-83129301 CACCTGTGGTCCCAGCCACTTGG + Intergenic
1056159003 9:83869599-83869621 CACCTGTGGTCCCAGCCACTTGG + Intronic
1056230469 9:84538338-84538360 CCCCTGTGGCCACCACCACTGGG + Intergenic
1056519704 9:87388884-87388906 TTCCTGTGGTCCCCGCTACTTGG - Intergenic
1056935535 9:90912801-90912823 CTCCTGCTCTCTCCACCACTTGG + Intergenic
1056941442 9:90960073-90960095 CACCTGTAGTCCCCACTACTTGG - Intergenic
1057599290 9:96443221-96443243 CTCCTGTGGTCCCAGCTACTTGG - Intergenic
1057644549 9:96860359-96860381 CCCCTGTAGCCACCACCACTGGG - Intronic
1058004057 9:99896381-99896403 CTCCCGTAACCACCACCACTGGG - Intergenic
1058065876 9:100547139-100547161 TACCTGTGGTCTCCACTACTTGG - Intronic
1058232600 9:102447569-102447591 CTTCTGTGGCCACCATCATTGGG - Intergenic
1058236036 9:102491130-102491152 CACCTGTGGTCCCAACTACTCGG + Intergenic
1058248974 9:102668296-102668318 CCCCTGGGGCCACCACCACAGGG + Intergenic
1058267879 9:102928638-102928660 TTCCTGTGATCTCCAGCACTAGG + Intergenic
1058267940 9:102929756-102929778 TTCCTGTGATCTCCAGCACTAGG - Intergenic
1058285159 9:103168760-103168782 CCCCTGTGGCCACCACCACTGGG + Intergenic
1058630855 9:106984983-106985005 CACCTGTGGTCCCAACTACTTGG + Intronic
1058839041 9:108887802-108887824 CTCCTATACTCACCAACACTGGG - Intronic
1059041883 9:110823356-110823378 CCCCTGTGACCACAACCACTAGG - Intergenic
1059839198 9:118192600-118192622 CCACTGTGGCCACCACCACTGGG - Intergenic
1060054508 9:120402165-120402187 CGCCTGTGGTCACAGCTACTTGG + Intronic
1060063375 9:120481636-120481658 CGCCTGTGGTCCCAACTACTTGG - Intronic
1060078065 9:120612960-120612982 CTCCTGTAGTCCCAGCCACTTGG - Intronic
1060084016 9:120680535-120680557 CCCCTGTGGCCACCACCACTGGG + Intronic
1060095459 9:120785132-120785154 CACCTGTGGTCCCAACTACTTGG - Intronic
1060240650 9:121899527-121899549 CACCTGTAGTCCCAACCACTTGG - Intronic
1060304599 9:122399135-122399157 CCCCTGTGGCCACCACCACTGGG - Intergenic
1060328796 9:122644566-122644588 CCACTGTGGTCACCACCACTGGG - Intergenic
1060747433 9:126146712-126146734 TTCCTGTGGAAACCACCACAAGG + Intergenic
1061019537 9:128005127-128005149 CACCTGTGGTCACAGCTACTTGG + Intergenic
1061027257 9:128057801-128057823 CTCCTGTGGTCCCAGCTACTAGG + Intergenic
1061290028 9:129645437-129645459 CCCCTGTGGTCACCAGGAGTGGG - Intergenic
1061397390 9:130350778-130350800 CTCCTGTAGTCTCCGCTACTTGG + Intronic
1061474610 9:130856039-130856061 CGCCTGTGGTCCCAACTACTCGG - Intronic
1061598986 9:131653627-131653649 CTCCAGTCCTCACCAACACTTGG - Intronic
1062300196 9:135862210-135862232 CGCCTGTGGTCCCAGCCACTCGG - Intronic
1062613540 9:137386166-137386188 CTCCTGAGGTCCCAGCCACTTGG + Intronic
1062644761 9:137541904-137541926 CACCTGTGGTCCCAGCCACTTGG - Intronic
1062730470 9:138105578-138105600 CACCTGCAGGCACCACCACTGGG + Intronic
1062753038 9:138270561-138270583 CACCTGTGGTCCCTACTACTTGG - Intergenic
1203575554 Un_KI270745v1:5338-5360 CACCTGTGGTCCCTACTACTTGG - Intergenic
1185541603 X:906926-906948 CTCCTGTGGTCCCGGCTACTTGG - Intergenic
1186014463 X:5175356-5175378 CGCCTGTAGTCCCCACCACTTGG - Intergenic
1186489970 X:9963896-9963918 CTCCTGTGGTCCCAGCTACTTGG + Intergenic
1187132880 X:16519032-16519054 ACCCTGTGGCCACCACCACTGGG - Intergenic
1187180059 X:16935693-16935715 CTCCTGTAGTCCCAACTACTTGG - Intergenic
1187314931 X:18184097-18184119 CCCCTGTGGACACCACCACTGGG - Intronic
1187480766 X:19653113-19653135 CACCTGTGGTCCCAGCCACTTGG - Intronic
1187509894 X:19908221-19908243 CACCTGTGGTCCCAACTACTCGG + Intergenic
1187533957 X:20120732-20120754 CACCTGTAGTCCCCACTACTTGG + Intergenic
1187579226 X:20591212-20591234 CCCCTTTTGCCACCACCACTGGG + Intergenic
1187588384 X:20689469-20689491 GCCCCGTTGTCACCACCACTGGG + Intergenic
1187618209 X:21021101-21021123 CCCCTGTGGCCATCACCACTGGG - Intergenic
1187623688 X:21086557-21086579 TGCCTGTGGCCACCACCAGTGGG - Intergenic
1187636928 X:21239026-21239048 CCCTGGTGGCCACCACCACTGGG - Intergenic
1187836315 X:23435602-23435624 CTCCTGTGGTCACCACCACTGGG - Intergenic
1188192065 X:27183134-27183156 CCCCTGTGGCCACCACCACTGGG - Intergenic
1188275910 X:28200006-28200028 CTCCTGTAGTCCCAACTACTTGG + Intergenic
1188716290 X:33463648-33463670 CCCCTGTGACCACCACCACTGGG + Intergenic
1188721419 X:33528017-33528039 TGCCTGTGGCCACCATCACTAGG + Intergenic
1188864729 X:35300642-35300664 CTCCTATGGCCATGACCACTAGG - Intergenic
1188924517 X:36023368-36023390 CTTCTGTGGCCACCACCACTAGG + Intergenic
1189405844 X:40721739-40721761 CCCATATGGCCACCACCACTAGG - Intronic
1189435906 X:40992514-40992536 CTCCTGTGGTCCCAGCTACTCGG + Intergenic
1189593954 X:42544209-42544231 CCTCTGTGGCCACCACCACTGGG - Intergenic
1189628290 X:42922140-42922162 CCCCTGTGGCCACCACCAGTGGG - Intergenic
1189640897 X:43068850-43068872 CCCCCGTGGCCACCACCACTGGG - Intergenic
1189870128 X:45372308-45372330 CCCCTGTGGCCACCATCACTGGG - Intergenic
1190015239 X:46820606-46820628 CCCCTGTGGCCACCATCACTGGG - Intergenic
1190018067 X:46845886-46845908 CGCCTGTTGTCTCCACTACTTGG - Intronic
1190037922 X:47042939-47042961 CCCCTATGGCCACCACCACTGGG - Intronic
1190046371 X:47114211-47114233 CCCCGGTGGCCACCACCAGTGGG - Intergenic
1190217234 X:48488090-48488112 CTCCTGTGGTCACAATGACAGGG - Intergenic
1190254154 X:48750067-48750089 CACCTGTGGTCCCAGCCACTTGG + Intergenic
1190299170 X:49046247-49046269 CACCTGTGGTCCCAACTACTTGG + Intergenic
1190374232 X:49774038-49774060 CCCCTGTGGCCACCACCACTGGG + Intergenic
1190523116 X:51299783-51299805 CCCCTGTGGCCACCACAATTGGG - Intergenic
1190537650 X:51446021-51446043 GCCCTGTGGCCGCCACCACTAGG + Intergenic
1190614708 X:52218033-52218055 GCCCTGTGGCCACCACCACTGGG - Intergenic
1191059234 X:56277561-56277583 TCCCTGTGGCCACCACCACTCGG + Intronic
1191180072 X:57552844-57552866 CTTCTGTGGTCACCACAACAAGG - Intergenic
1191222042 X:57999306-57999328 CCCCTGTGTCCACCACCACTAGG - Intergenic
1191612946 X:63136349-63136371 CTTCTGTGTGCAGCACCACTTGG + Intergenic
1191623351 X:63242577-63242599 CTTCTGTGTGCAGCACCACTTGG - Intergenic
1191646714 X:63489039-63489061 CTACTGTGGTCCGCACCACTGGG - Intergenic
1191829682 X:65402559-65402581 TCCCTGTGGCCATCACCACTAGG - Intronic
1192304319 X:69943581-69943603 CCACTGTGGCCACCACCACCTGG + Intronic
1192372352 X:70525053-70525075 TGCCTGTGGTCCCCACTACTCGG + Intergenic
1192397397 X:70795571-70795593 CCCCTGTGGCCACTACCCCTGGG - Intronic
1192680043 X:73242610-73242632 CTCCTGTGGCCACCACTACTAGG - Intergenic
1192841280 X:74858252-74858274 CCTCTGTGGCCACCACCACTGGG - Intronic
1192891029 X:75390440-75390462 CCCCTGTGGCCACCACCACTAGG - Intronic
1192940992 X:75911769-75911791 CACCTGTGGCCACCATAACTAGG + Intergenic
1192958683 X:76103582-76103604 CTCTTGCAGCCACCACCACTAGG + Intergenic
1193191039 X:78571941-78571963 TCCCTGTGGCCACCCCCACTTGG + Intergenic
1193215702 X:78861232-78861254 CCCCTGTGACCACCACCACCTGG - Intergenic
1193247382 X:79244718-79244740 CTCACGTGGCCACCACCACTGGG - Intergenic
1193305886 X:79950359-79950381 TTCCTGTGGCCACCACCACTGGG - Intergenic
1193469180 X:81878469-81878491 CTCCCTTGGCCACCACAACTGGG + Intergenic
1193529639 X:82641679-82641701 CCCATTTTGTCACCACCACTGGG + Intergenic
1193765732 X:85527526-85527548 CCCCTGTGATCACTACCACTGGG + Intergenic
1193846705 X:86480380-86480402 CCCCTTTGGCCACCACCACTGGG + Intronic
1193957829 X:87885181-87885203 CCCTTGTGGTCACCACCACTAGG + Intergenic
1194110312 X:89825169-89825191 CCCCTGTGGTCAACATCACTGGG - Intergenic
1194112748 X:89854797-89854819 TCCCTGTGGTCACCACACCTAGG - Intergenic
1194157778 X:90414971-90414993 CCCCTGTGGCCACCATCACTAGG + Intergenic
1194196618 X:90902695-90902717 TTGCTGTGGCCACCACCACAGGG + Intergenic
1194228126 X:91286994-91287016 CCTCTGTTGCCACCACCACTGGG - Intergenic
1194290983 X:92071832-92071854 CCTCTGTGGCCACTACCACTGGG + Intronic
1194327612 X:92539964-92539986 ACCATGGGGTCACCACCACTGGG + Intronic
1194340560 X:92700347-92700369 CCCCCATGGCCACCACCACTGGG + Intergenic
1194398562 X:93415066-93415088 CTCCTGTGGCCACCACCCCCAGG - Intergenic
1194410298 X:93549461-93549483 CACCTGTGGTCCCAACTACTCGG + Intergenic
1194415573 X:93607030-93607052 TTTCTGTGGCCACCACAACTGGG - Intergenic
1194479270 X:94400617-94400639 CCCCAGTGATCAACACCACTGGG + Intergenic
1194526594 X:94984274-94984296 CCCCTGTGGCCACCACCACTGGG - Intergenic
1194553412 X:95329792-95329814 TCCTTGTGGTCACCTCCACTAGG + Intergenic
1194690757 X:96981045-96981067 CACCTGTGGTCCCAACTACTTGG + Intronic
1194692811 X:97008833-97008855 CTCCTGTGGCGACCACCACTGGG + Intronic
1194784327 X:98063220-98063242 CACCTGTGGTCACAGCTACTAGG + Intergenic
1194787518 X:98105715-98105737 TCCCTGTGGCCACCACCCCTAGG + Intergenic
1194795989 X:98211313-98211335 CCCCTGTGGCCACCACCACTGGG - Intergenic
1194841885 X:98753508-98753530 CCTCTGTGGCCATCACCACTAGG + Intergenic
1194882875 X:99274892-99274914 CCCCTGTGGCCACCACTACAGGG - Intergenic
1194892196 X:99394262-99394284 CCTCTGTGGCCACCACCACTGGG + Intergenic
1194892441 X:99397546-99397568 CCCCTGTGGCCACCACTACTGGG + Intergenic
1195013285 X:100753573-100753595 CTCCTGTAGTCCCAACTACTCGG + Intergenic
1195199457 X:102533434-102533456 CCACTGTGGCCACCACCACTAGG - Intergenic
1195312391 X:103643992-103644014 CCCCTGTAGCCACCACCACTGGG - Intergenic
1195489417 X:105449889-105449911 CCCCTATGGCCATCACCACTGGG + Intronic
1195601389 X:106752280-106752302 CCCCTGTGGCCACCACTGCTGGG - Intronic
1195782922 X:108484708-108484730 CCCCTGTGGCCACCACCCCTGGG + Intronic
1195821070 X:108946024-108946046 TCCCTGTTGCCACCACCACTAGG + Intergenic
1195917329 X:109948473-109948495 CCCCTGTGGTCACCACTACTGGG - Intergenic
1195959308 X:110369204-110369226 CTCCTGTGGTCCCAGCTACTCGG + Intronic
1195971400 X:110477694-110477716 CCCCTGTGGCCACCACCACTAGG + Intergenic
1196096633 X:111808036-111808058 CCACTGTGGCCACCACCACTAGG + Intronic
1196247498 X:113416342-113416364 CCCCTGTGGCCACTACCACTAGG - Intergenic
1196269973 X:113699045-113699067 CCTCTGTGGCGACCACCACTGGG + Intergenic
1196355152 X:114782590-114782612 CACCTGTGGTCCCAACTACTTGG + Intronic
1196357182 X:114808905-114808927 AACCTGTGGCCACCACCACTGGG + Intronic
1196494266 X:116306349-116306371 CCTCTTTGGCCACCACCACTAGG + Intergenic
1196494487 X:116307879-116307901 CCTCTATGGCCACCACCACTAGG + Intergenic
1196576551 X:117325433-117325455 CCCCTGTGGCCACCACCATTTGG + Intergenic
1196619718 X:117807711-117807733 CCCCTGTAGCTACCACCACTGGG - Intergenic
1196639347 X:118039824-118039846 CCTCTGTGGCAACCACCACTGGG - Intronic
1196762060 X:119209043-119209065 CACCTGTGGTCACAGCTACTTGG + Intergenic
1196844546 X:119888030-119888052 CTCCTGTGGTCTCAGCTACTTGG - Intergenic
1196921869 X:120593572-120593594 CGCCTGTGGTCCCAACTACTCGG - Intergenic
1196962011 X:121013997-121014019 CCCCTGTGGCCACCACCACTGGG + Intergenic
1197025103 X:121738556-121738578 GCCCTGTGGCCACCACCACTAGG - Intergenic
1197099462 X:122636021-122636043 CTCCTTTGACCATCACCACTGGG + Intergenic
1197382667 X:125765055-125765077 CCCCTGTGTCCACCCCCACTGGG + Intergenic
1197458075 X:126702259-126702281 CGCCTGTGACCACCACCAGTGGG - Intergenic
1197670531 X:129272740-129272762 CCCCTGTGGCCACCACCACTGGG + Intergenic
1197876947 X:131118506-131118528 CACCTGTGGTCCCAGCCACTTGG - Intergenic
1198030894 X:132752344-132752366 CATCTGTGGTCACAACTACTTGG + Intronic
1198080099 X:133231648-133231670 CACCTGTGGTCACAGCTACTTGG + Intergenic
1198162947 X:134025675-134025697 CACCTGTGGTCTCAACTACTTGG + Intergenic
1198231790 X:134696904-134696926 CGCCTGTAGTCCCAACCACTCGG + Intronic
1198293118 X:135257662-135257684 CCTCTGTGGCTACCACCACTGGG - Intronic
1198340951 X:135713161-135713183 CGCCTGTGGTCCCAACTACTCGG - Intergenic
1198346983 X:135768484-135768506 CACCTGTGGTCCCAACTACTCGG + Intergenic
1198348890 X:135785756-135785778 CACCTGTGGTCCCAACTACTCGG + Intergenic
1198350795 X:135803034-135803056 CACCTGTGGTCCCAACTACTCGG + Intergenic
1198352702 X:135820293-135820315 CACCTGTGGTCCCAACTACTCGG + Intergenic
1198354611 X:135837561-135837583 CACCTGTGGTCCCAACTACTCGG + Intergenic
1198356521 X:135854823-135854845 CACCTGTGGTCCCAACTACTCGG + Intergenic
1198358434 X:135872101-135872123 CACCTGTGGTCCCAACTACTCGG + Intergenic
1198430696 X:136564127-136564149 CCCCTGTGGCCACCACCATTGGG + Intergenic
1198515103 X:137399647-137399669 CCCCTGTGGCCACCAGCACTGGG + Intergenic
1198523540 X:137475981-137476003 CCCCTGTAGTCCCAACCACTTGG + Intergenic
1198537677 X:137602068-137602090 CTCCTGTGGCCACCACCACTGGG - Intergenic
1198702457 X:139413177-139413199 CCCCTGTGGCCACCACCACTAGG + Intergenic
1198770471 X:140125508-140125530 CTCCTGTGGCCACCACCACTGGG + Intergenic
1198773659 X:140156568-140156590 CCCATGTGGCCACCACCAGTGGG - Intergenic
1198785357 X:140282752-140282774 CTCCTGTGGCCACCATCACTAGG + Intergenic
1198964533 X:142214090-142214112 CCCCTCTGGCCACCATCACTAGG + Intergenic
1199037153 X:143064493-143064515 CCCCAGTGGCCACCACTACTGGG - Intergenic
1199173693 X:144759422-144759444 CACCTGCAGTCACCACAACTAGG - Intergenic
1199177765 X:144811505-144811527 TTCTTGTGGCCACCACCACTAGG - Intergenic
1199181016 X:144854159-144854181 CCTCTGTAGTCACCACCTCTGGG + Intergenic
1199191920 X:144980883-144980905 CACCTGTGTTCACCACTCCTGGG - Intergenic
1199217819 X:145281722-145281744 CCCCTCTGGTCACCACCCCTAGG + Intergenic
1199316160 X:146380090-146380112 CCCCTGTGGCCACCACCACTGGG - Intergenic
1199455086 X:148019814-148019836 CCACTGAGGCCACCACCACTGGG + Intronic
1200462974 Y:3479910-3479932 CCCCTGTGGTCAACATCACTGGG - Intergenic
1200465401 Y:3509608-3509630 TCCCTGTGGTCACCACACCTAGG - Intergenic
1200504111 Y:3991940-3991962 CCCCTGTGGCCACCATCACTAGG + Intergenic
1200542465 Y:4476896-4476918 TTGCTGTGGCCACCACCACAGGG + Intergenic
1200608492 Y:5296407-5296429 CCTCTGTGGCCACTACCACTGGG + Intronic
1200648915 Y:5817085-5817107 CCCCCATGGCCACCACCACTGGG + Intergenic
1201536768 Y:15057912-15057934 CTCCTGTAGTCCCAACTACTTGG + Intergenic
1201677722 Y:16605724-16605746 CACCTGTGGTCCCAACTACTTGG + Intergenic
1201776140 Y:17668180-17668202 CTACTGTGGACTCCACCACTGGG - Intergenic
1201825416 Y:18237812-18237834 CTACTGTGGACTCCACCACTGGG + Intergenic
1201890873 Y:18942601-18942623 CACCTGTAGTCACAACTACTTGG + Intergenic
1201920249 Y:19226259-19226281 CTTCTGTGGTCTCAACTACTTGG - Intergenic
1201971483 Y:19802142-19802164 CTCCTGTAGACTCCACCTCTGGG + Intergenic
1202369825 Y:24188987-24189009 CACCCTCGGTCACCACCACTGGG + Intergenic
1202500959 Y:25481130-25481152 CACCCTCGGTCACCACCACTGGG - Intergenic