ID: 1187836316

View in Genome Browser
Species Human (GRCh38)
Location X:23435603-23435625
Sequence ACTCCTGTGGTCACCACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 872
Summary {0: 3, 1: 25, 2: 116, 3: 255, 4: 473}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187836316_1187836318 6 Left 1187836316 X:23435603-23435625 CCAGTGGTGGTGACCACAGGAGT 0: 3
1: 25
2: 116
3: 255
4: 473
Right 1187836318 X:23435632-23435654 ATCACCACTGTCCCAACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187836316 Original CRISPR ACTCCTGTGGTCACCACCAC TGG (reversed) Intergenic
900317008 1:2061915-2061937 ACACCTGTGAACACCCCCACAGG - Intronic
902143877 1:14379962-14379984 ACCTCTGTGCCCACCACCACCGG - Intergenic
902359804 1:15936096-15936118 ACCCCATGGGTCACCACCACAGG - Exonic
902903454 1:19536351-19536373 ACACCTGTGGTCACAACTACTGG + Intergenic
903001438 1:20268944-20268966 AGACCTCTGGTCACCACCAAGGG - Intergenic
903078409 1:20789284-20789306 ACGCCTGTGGTCACCTACATGGG + Intergenic
904610743 1:31725003-31725025 GCTCCGCTGGTCACCACCTCTGG - Intergenic
905866206 1:41378094-41378116 ACTCCTGTCCCCACCACCATTGG + Intronic
906826944 1:48992388-48992410 ATCCCTGTGGCCACCACCACTGG + Intronic
906915559 1:50005228-50005250 ACTCCTGTGGCCACCAGCACTGG - Intronic
907261705 1:53222989-53223011 ACCCCTGTGGCCACCACTGCTGG - Intergenic
908093145 1:60707378-60707400 ACTCTTGTGGCCACCACAGCTGG - Intergenic
908397481 1:63739850-63739872 ACCTCTGTGGCCACTACCACTGG + Intergenic
909103928 1:71384838-71384860 ACCTCTGTGGCCACTACCACTGG - Intergenic
909209607 1:72807377-72807399 ACCCCTGTGGCCACCAGCAATGG + Intergenic
909271415 1:73627728-73627750 ACCCCCATGGTCACCACCAGTGG - Intergenic
909309499 1:74129014-74129036 ATCCCTGTGGCCACCACCACTGG + Intronic
909316360 1:74224081-74224103 ATCCCTGTGGCCACCACCACTGG - Intronic
909320618 1:74280837-74280859 ACTCCCTTGGTCACCACCGCTGG - Intronic
909438735 1:75673655-75673677 ACTCTTGTGGTCGCCAGCACTGG - Intergenic
909443678 1:75724694-75724716 ACTCCTCTGGTCCCGCCCACTGG - Intronic
909615808 1:77606575-77606597 ACCCCTGTGGCCACCACCACTGG - Intronic
909823574 1:80097783-80097805 ACTCCTGTGGCCATCAAAACTGG + Intergenic
909870431 1:80731688-80731710 ACTCCTGCGGCCACCACCACTGG - Intergenic
910102434 1:83593457-83593479 ACTGCTGTGGCCACCAACACTGG + Intergenic
910264797 1:85327210-85327232 ACACCTGTAGTCACCTCCTCAGG + Intronic
910384574 1:86666649-86666671 AGCCCTGTGGCCACCATCACTGG - Intergenic
910388026 1:86705275-86705297 GCTCCTGTGGCCTCCACCCCGGG + Intronic
910515273 1:88053833-88053855 ACCCCTCTAGCCACCACCACTGG + Intergenic
910643639 1:89490292-89490314 GCCCCTGTGGCCACCACCACTGG - Intergenic
910725027 1:90328833-90328855 ACCCCTGCAGCCACCACCACTGG - Intergenic
910733238 1:90421495-90421517 ACCCCTGTGGCCACCAGCCCAGG - Intergenic
911084638 1:93966140-93966162 ACTCATGTTGTCACCAGCAACGG + Intergenic
911487268 1:98516999-98517021 ACCCCTGTGGCTACCACCACAGG - Intergenic
911961034 1:104302187-104302209 ACCACTGTGGCCATCACCACTGG - Intergenic
911981234 1:104569135-104569157 ACCCCAGTTGCCACCACCACTGG - Intergenic
912117067 1:106419565-106419587 ACCCCTGTGGCCAACACCACTGG - Intergenic
912152865 1:106880817-106880839 ACTCCTGCAGTCACCAGCACTGG - Intergenic
912242769 1:107928003-107928025 ACCCCTCTGGCTACCACCACCGG - Intronic
912304765 1:108556257-108556279 ACTGCTGCTGCCACCACCACTGG - Intergenic
912316530 1:108671624-108671646 ACCCCTGTGGTCACCACCACTGG - Intergenic
912633154 1:111266937-111266959 ACCCCTGTGGCCACCACCGCTGG + Intergenic
912644007 1:111373341-111373363 ATCTCTGTGGCCACCACCACTGG - Intergenic
912899167 1:113629856-113629878 ATCCCTGTGGCCACCACCACTGG + Intronic
913146972 1:116002250-116002272 ACTCTTTTGGTCACTACCACTGG + Intronic
915005473 1:152630873-152630895 ACCACTGCGGTCACCACCACTGG - Intergenic
915433036 1:155881426-155881448 TCTCCAGTGTTCAGCACCACTGG - Exonic
915752942 1:158228797-158228819 ACTCCTGTGGCCACCACCACTGG - Intergenic
916360672 1:163963510-163963532 ACTCCTGTGGCCACCTCCACTGG - Intergenic
917191483 1:172423219-172423241 ACTCCTGTGGCCACCACTACTGG - Intronic
917246235 1:173004442-173004464 ACCCCTGTGGCCACCATCACTGG + Intergenic
917387166 1:174490482-174490504 GCCCCTGTGGTTACCACCACTGG + Intronic
917986501 1:180325930-180325952 AACCCTGTGGCCACCACCACTGG + Intronic
918358112 1:183724906-183724928 ACCCCTGTGGCCACTACCACTGG - Intronic
918905519 1:190487463-190487485 ACACCTGTGGTCCCAACCTCCGG + Intergenic
918989837 1:191684569-191684591 ACCCCTGTGGCCACCATCACTGG + Intergenic
919067870 1:192715274-192715296 AACCCTGTGGCTACCACCACTGG - Intergenic
919169898 1:193939911-193939933 ACCCCTATGGCCACCACCACTGG - Intergenic
919959100 1:202449113-202449135 ACTCCTGTGCTCTCCATTACTGG + Exonic
920596668 1:207279149-207279171 ACCCCTGTAGCCACCAGCACTGG + Intergenic
921011965 1:211150630-211150652 ACCCCTGTGACCACCACCACTGG - Intergenic
921257654 1:213356992-213357014 GCTGCTGTGGGCACCAGCACAGG + Intergenic
921296048 1:213705026-213705048 ACCCCTGTGGTCACCACCACTGG + Intergenic
921769854 1:219022869-219022891 ACCCCTGTGGTCACTACTACTGG - Intergenic
921823231 1:219641174-219641196 ACCCCTGTGACCACCACCACTGG - Intergenic
921929254 1:220741925-220741947 CCTCCTATGGCCACCACCATAGG + Intergenic
922320380 1:224481659-224481681 ATCCCTGTGGCCACCACCACTGG + Intronic
922336523 1:224622980-224623002 ACTCCTATGGGCCCCTCCACTGG + Intronic
922357995 1:224795087-224795109 ACCTCTGTGGCCACCATCACTGG + Intergenic
922642364 1:227246458-227246480 ACCCCTGTGGCCACCATCACTGG - Intronic
923390251 1:233507744-233507766 ACTCCTGTGCTCTCAAACACTGG - Intergenic
923886509 1:238163967-238163989 ACTCCTATGGTCACCACCAGTGG + Intergenic
923960172 1:239072173-239072195 ACCCCTGTGGCCATCACCACTGG - Intergenic
924193733 1:241583201-241583223 ACTCCTGTGGCCACCACAGCTGG + Intronic
1066527288 10:36295735-36295757 ACTTCTGTGTACACCATCACTGG + Intergenic
1066708351 10:38204577-38204599 ACCCCTGTGGCCACCACCACTGG - Intergenic
1068103845 10:52590363-52590385 ACTTCTGTGGCCACCACCGCTGG + Intergenic
1068545661 10:58342371-58342393 ACTCCTCAGCTCACCCCCACTGG - Intronic
1069470334 10:68682918-68682940 ACTTCTGTGCTCATCCCCACAGG + Exonic
1070059273 10:72966982-72967004 ACCCCTGTGGTCACCACTATTGG + Intergenic
1070776140 10:79111048-79111070 GCTCCTGGGCTGACCACCACCGG + Intronic
1070892759 10:79954339-79954361 CCACCTGTGGTCACCAACAGCGG - Intronic
1071831039 10:89372343-89372365 AATCCTGTTGTCTCCCCCACTGG - Intronic
1071896630 10:90075418-90075440 ACTCTTGTGATCAACTCCACTGG + Intergenic
1071963105 10:90825057-90825079 AGCCCTGTATTCACCACCACTGG - Intronic
1072058898 10:91788764-91788786 ACCACTGTGATCACCACCGCTGG - Intergenic
1072435149 10:95407812-95407834 ACGCCTGTGGTCCCAACTACTGG + Intronic
1072492212 10:95919548-95919570 ACTCCCATGGCCACCACCACTGG + Intronic
1072843129 10:98796762-98796784 ACCCCTGTGGTCACTACCACTGG - Intronic
1072853640 10:98924278-98924300 ACCCCTGTGGCCACCACCACTGG + Intronic
1073708092 10:106010109-106010131 ACCCCTGTGACCACCACCATTGG + Intergenic
1073827003 10:107336109-107336131 ACTCCTGTGGCCACAACTACTGG + Intergenic
1073890195 10:108091756-108091778 ACCCCTGTGGCCACGAGCACTGG - Intergenic
1074302048 10:112241878-112241900 ACCCCTGTGGCCACCACCACTGG + Intergenic
1074408585 10:113202385-113202407 ACACCTGTGGCCACCACCGCTGG - Intergenic
1075210074 10:120483514-120483536 TCCACTGTGGTCACCACCATGGG + Intronic
1075625217 10:123959241-123959263 CCTCCTGCTTTCACCACCACTGG + Intergenic
1075652004 10:124133515-124133537 TCACCTGTGGTTACCAACACTGG + Intergenic
1076150328 10:128157136-128157158 CCTCTTGTGGACACCACCCCTGG + Intergenic
1077427544 11:2490513-2490535 TTACCTGTGGCCACCACCACTGG - Intronic
1078842971 11:15096330-15096352 ACCTCCGTGGTCACCACCACTGG + Intergenic
1079473780 11:20807454-20807476 CACCCTGTGGTCACCACCACTGG + Intronic
1079517081 11:21281642-21281664 ACCCCTGTGGCTACCACCACTGG - Intronic
1079686972 11:23371054-23371076 ACCCCAGTGGTCACCACCACTGG - Intergenic
1079723193 11:23845821-23845843 ACTCCTGTGGCCACCACAGCTGG + Intergenic
1080096941 11:28419227-28419249 ACTCCTATGGTCACCACCACTGG - Intergenic
1080351233 11:31387338-31387360 ACCTCTGTGGCCATCACCACTGG - Intronic
1080489721 11:32750250-32750272 ACCCCTGTGACGACCACCACTGG + Intronic
1080726158 11:34901298-34901320 TCTCCAGTGGTCTCCGCCACAGG - Intronic
1081049268 11:38316604-38316626 ACCCCTGTGGTCACCACCACTGG - Intergenic
1081073615 11:38641764-38641786 ACCCTTGTGGCCACTACCACTGG + Intergenic
1081245801 11:40764674-40764696 ACCCCTGTGGCCACCACCACTGG - Intronic
1081319164 11:41669077-41669099 ACTCCTGTGGCCATCACAGCTGG - Intergenic
1082749702 11:57002772-57002794 ACAGGTTTGGTCACCACCACTGG + Intergenic
1083528720 11:63397286-63397308 ACCTCTGTGGCCACCACCACTGG + Intronic
1084763738 11:71294071-71294093 ACCCCTGTGGCCACCAACACTGG + Intergenic
1085178559 11:74511860-74511882 ACTCCTGTGGCCATTACCACTGG - Intronic
1085220839 11:74872621-74872643 TCTCCAGTGGTCCCAACCACTGG - Intronic
1085223558 11:74896664-74896686 ACCCCTGTGGCCCCCACCACTGG - Intronic
1085572011 11:77568215-77568237 TCCCCTGTGGTCACCACCACTGG + Intronic
1085686804 11:78630980-78631002 ACTCTTGTGGCCACCACAGCTGG + Intergenic
1086068873 11:82776595-82776617 ACCCCTGTGGTCACCACTAATGG - Intergenic
1086569713 11:88267409-88267431 ACCCCTGTGTCCACCACCACTGG - Intergenic
1087299422 11:96414353-96414375 ACCCTTGTGGCCACCACCATTGG - Intronic
1087313268 11:96576553-96576575 ACCCCTGTGGCCACCATCACTGG + Intergenic
1087598281 11:100282491-100282513 ACCCTGGTGGCCACCACCACTGG + Intronic
1087720869 11:101664514-101664536 AACCCTGTGGCCACCAGCACTGG + Intronic
1087887671 11:103498456-103498478 ACCCCTGTGGCCACCAACACTGG - Intergenic
1087950708 11:104218148-104218170 CTCCCTGTGGCCACCACCACTGG + Intergenic
1088406137 11:109480845-109480867 TCCCCTATGGCCACCACCACTGG - Intergenic
1088864977 11:113838941-113838963 ACTGCTGTGGTGAGCACCAAGGG + Intronic
1088944387 11:114495121-114495143 ACCTCTGTGGCCACCACCAGTGG + Intergenic
1088952958 11:114589165-114589187 TCACCAGTGGTCCCCACCACAGG - Intronic
1089578743 11:119468365-119468387 ACCCCTTTAGCCACCACCACTGG + Intergenic
1090065139 11:123497325-123497347 ACCCCTGTCGCCACCACCATGGG + Intergenic
1090065253 11:123498001-123498023 CTCCCTGTGGCCACCACCACCGG + Intergenic
1090676787 11:129006635-129006657 ACCCCTGTGGCCACCACCACTGG + Intronic
1091155974 11:133373496-133373518 ACTCCTGTAGTCTCAACTACTGG + Intronic
1091815184 12:3432306-3432328 AGTCCTGGGTTCACCTCCACAGG - Intronic
1092476974 12:8828011-8828033 ACCCCTGTGGCCACCAGCATTGG + Intronic
1093122996 12:15295301-15295323 ACTCCTGTGGCCACCAGCACTGG - Intronic
1093620164 12:21278477-21278499 ACCCCTGTGGCCACCACCACTGG - Intronic
1093903189 12:24660508-24660530 ACCCCTTTGGCCACCACCACTGG + Intergenic
1093931912 12:24962074-24962096 ACCCCTGTGGCCACCACCACTGG - Intergenic
1094419883 12:30258863-30258885 TCCCCTGTGGTCACCACAACTGG - Intergenic
1094510799 12:31095399-31095421 CCTCCTGAAGTCACCTCCACGGG - Intronic
1094559286 12:31535328-31535350 ACCCCTGTGGCTACCACCACTGG - Intronic
1094787263 12:33863299-33863321 ACTCCTGTGGGCAGCACCACTGG + Intergenic
1095824262 12:46515659-46515681 ACTCCTGGGGGCTCCACCCCAGG + Intergenic
1095888381 12:47212142-47212164 ACTCCTGTGGTCCCAGCTACTGG + Intronic
1096343851 12:50828261-50828283 ACCTCTGTGACCACCACCACTGG + Intergenic
1096567906 12:52496531-52496553 ACACCTCTGGGCACCACCATGGG - Intergenic
1097466364 12:59929321-59929343 ACTCCTATGACTACCACCACTGG - Intergenic
1097519264 12:60647216-60647238 TCTCCAGTGTTCCCCACCACGGG + Intergenic
1097714708 12:62954345-62954367 ACCCCTGTGGCCACCTCCACTGG + Intergenic
1097899158 12:64856588-64856610 ACCCCTGTGGCCACTACCACTGG + Intronic
1098060432 12:66555138-66555160 ACCCCTGTGGCCACTATCACTGG - Intronic
1098333676 12:69380510-69380532 ACCCCTTTAGCCACCACCACTGG + Intronic
1098395418 12:70011567-70011589 ACCCCTGTGGCCACCACCACTGG - Intergenic
1098648969 12:72940809-72940831 ACCCCTGTGGTCACCACTGCTGG + Intergenic
1098652643 12:72992504-72992526 CCTTCTGTGGTGCCCACCACTGG + Intergenic
1099024599 12:77448929-77448951 ACCCCTGTGGTCACCACCACTGG - Intergenic
1099562135 12:84192224-84192246 TCCCCTGTGGCCACCAACACTGG + Intergenic
1099609991 12:84856670-84856692 ACCCCTGTGGTCACCACCACTGG + Intergenic
1099616218 12:84938815-84938837 AGCCCTGTGGCCACCATCACTGG - Intergenic
1100060915 12:90575078-90575100 ACCCCTGTGGCTACTACCACTGG + Intergenic
1100905014 12:99287139-99287161 ACCCCTATGGTCACCATCACTGG - Intronic
1101162513 12:101993757-101993779 ACCCCTGTGGGCACCACCACTGG + Intronic
1102152496 12:110698539-110698561 ACTCCTGGCTTCTCCACCACCGG + Intronic
1103461499 12:121108327-121108349 ACCCCTGTGGCCATCACCACTGG - Intergenic
1103565647 12:121814190-121814212 GCTCCTGGGGTCACCACCATGGG - Exonic
1105558921 13:21472684-21472706 ACCCCTGTGGCTACCATCACTGG + Intergenic
1107178217 13:37423834-37423856 ACCCCTGTGGCTGCCACCACTGG - Intergenic
1109045890 13:57409972-57409994 ACCCCTGTGGCCACCATCACTGG - Intergenic
1109100605 13:58180280-58180302 ATTCCTGTGCTCACCACCACTGG + Intergenic
1109211143 13:59537626-59537648 ACCACTGTGGCCACCAACACTGG + Intergenic
1109506826 13:63312461-63312483 ACACCTGTGGCCACCACCACTGG - Intergenic
1110078835 13:71286107-71286129 AACCCTCTGGCCACCACCACTGG + Intergenic
1110376832 13:74803314-74803336 ACCCCTGTGGCTACCACAACTGG - Intergenic
1110448665 13:75617306-75617328 ACACCTGTGGCTACCACCACTGG + Intergenic
1110665683 13:78115525-78115547 ACCCCTGTGGCCACCACCACTGG + Intergenic
1110901595 13:80831751-80831773 ACCCCTGTGACCACCACCACTGG - Intergenic
1110916698 13:81030288-81030310 ACCCCAGTGGTCACCACCACTGG + Intergenic
1111449220 13:88391665-88391687 ACCCTTGTGGCCACCACCAATGG - Intergenic
1111513278 13:89294258-89294280 ACTGCTGTGGCCACCACCCCTGG + Intergenic
1111639425 13:90948030-90948052 ACCCCTGTGGCCATCATCACTGG - Intergenic
1112176948 13:97034981-97035003 ACTCCTGGGGCCACCATAACTGG - Intergenic
1113212832 13:108002744-108002766 ACCCCTGTGGCCACCACCAGTGG + Intergenic
1113217719 13:108061578-108061600 ATCTCTGTGGTCACCACCACTGG - Intergenic
1113254010 13:108486907-108486929 AGCCCTGTGGCCACCACCATGGG - Intergenic
1113558761 13:111259321-111259343 ACCCCTGTAGTCACCACCATTGG - Intronic
1114251005 14:20960147-20960169 ACCCCTGTGGTCACCACCACTGG - Intergenic
1114465897 14:22922496-22922518 AGTACTGTGTTCACCTCCACAGG + Exonic
1114506362 14:23217502-23217524 ACCCATGTGGCAACCACCACTGG - Intronic
1114783639 14:25569651-25569673 ACCCTTGTGGTCACCACTAGTGG + Intergenic
1114985038 14:28216804-28216826 ACCTCTGTGACCACCACCACTGG + Intergenic
1115476780 14:33822261-33822283 ACCCCTGTGGCCACCACCACTGG - Intergenic
1116154807 14:41189597-41189619 ACCCCTGTGGCCACCACCACTGG - Intergenic
1116257047 14:42570492-42570514 ACTCTCTTGGTCACCACAACTGG - Intergenic
1116413320 14:44650347-44650369 ACCCCTCTGGCCACCACCACTGG - Intergenic
1116434169 14:44877822-44877844 AGCCCTATGGCCACCACCACTGG - Intergenic
1116497684 14:45582648-45582670 ACCCCTATGGCCACAACCACTGG + Intergenic
1116584603 14:46686884-46686906 ACGCCTGTGGTCACCACAGCTGG + Intergenic
1116834994 14:49761949-49761971 ACTCCTGTGGCCACCACCACAGG + Intergenic
1116889229 14:50250637-50250659 ACTCCTGTGGCCACCACCACTGG - Intronic
1117208350 14:53469425-53469447 ACCCCTGTAGCCACCACCACTGG + Intergenic
1117606314 14:57431972-57431994 AGCCCTGTGGCCACCACCACTGG - Intergenic
1118034111 14:61848482-61848504 ACCCCTGTGGCCACCACCATTGG + Intergenic
1118084302 14:62398088-62398110 ACTCCTGTGGCCACTACCAGTGG + Intergenic
1118097018 14:62547747-62547769 ACCCCTGTGGCCACCACCACTGG - Intergenic
1118431101 14:65719866-65719888 ACTTTTGTGGCTACCACCACTGG + Intronic
1118549319 14:66932279-66932301 ACTCTTGTGGCCACCACCACTGG + Intronic
1120275884 14:82371446-82371468 ACCCCTGTGGCCACCATCACTGG - Intergenic
1120439569 14:84519851-84519873 ACCCCTGTGGCTGCCACCACTGG + Intergenic
1120468076 14:84886221-84886243 ACGCCTGTGGCCACCAACCCAGG - Intergenic
1120697558 14:87660396-87660418 ACTTCTGTGGCCACCACCACTGG - Intergenic
1124081269 15:26500709-26500731 ACTCCAGTGGCCACCACCACTGG + Intergenic
1125276888 15:38003302-38003324 ACTCCTGTGGCTACCACAACTGG + Intergenic
1125878282 15:43168699-43168721 ACTCCCCTGGCCACCACAACTGG + Intronic
1126246989 15:46518548-46518570 ATTCCTGTGGTCACCACAGCTGG - Intergenic
1126440657 15:48684211-48684233 ACTCCTTTGGCCACCGCCACTGG - Intergenic
1126660617 15:51030092-51030114 ACCCCTGTGGCCACCACCACTGG + Intergenic
1126706978 15:51414885-51414907 ACCCTTATGGCCACCACCACTGG - Intergenic
1127033976 15:54894991-54895013 CCTCCTATGGCCACTACCACTGG + Intergenic
1127132712 15:55883620-55883642 ATCCCTGTGGCCACCACCACTGG - Intronic
1127140493 15:55970503-55970525 AATCCTGTGGCCACCATCACTGG - Intronic
1127173590 15:56329017-56329039 ACTTCTGAGGCCACCACCACTGG - Intronic
1127177909 15:56381763-56381785 ACCCCTGTGCCCAGCACCACTGG + Intronic
1127447689 15:59081896-59081918 ACTCCTGTGGTCCCAGCTACTGG + Intronic
1127477016 15:59344425-59344447 ACCCCTATGGCCACCACCACTGG + Intronic
1127783327 15:62335107-62335129 ACCCTTGTGGCCACCAACACTGG + Intergenic
1127971397 15:63965365-63965387 ACTCCTGTGGCCATCACCACTGG + Intronic
1128858601 15:71044657-71044679 ACGCCTGTGGTCACAACTGCTGG + Intronic
1128900937 15:71422596-71422618 ACCCCTGTGGCCACCACCACTGG + Intronic
1129030566 15:72614973-72614995 CACCCTGTGGCCACCACCACAGG + Intergenic
1129209659 15:74060327-74060349 CACCCTGTGGCCACCACCACAGG - Intergenic
1129209719 15:74060669-74060691 ATCCCTATGGCCACCACCACTGG - Intergenic
1129477345 15:75795128-75795150 ATCCCTATGGCCACCACCACTGG + Intergenic
1129477409 15:75795486-75795508 CACCCTGTGGCCACCACCACAGG + Intergenic
1129561872 15:76578441-76578463 ACCCCTGTAGCCCCCACCACTGG - Intronic
1129642507 15:77394366-77394388 ACTTCTGTGGCCACCATTACTGG - Intronic
1130136358 15:81184942-81184964 GGTCCTGTGGTCTCCACCATAGG + Intronic
1130441037 15:83954905-83954927 ACCCCTATGGCCACCAACACTGG + Intronic
1130511911 15:84596212-84596234 ATCCCTATGGCCACCACCACTGG - Intergenic
1130646534 15:85732190-85732212 ACTACTATGGTCACGTCCACAGG - Intronic
1130819598 15:87480477-87480499 ACATCTGTGGTTACCACCATAGG + Intergenic
1130997328 15:88911262-88911284 TCTCCTGTGTTCTCCACCACCGG - Intronic
1131180173 15:90233987-90234009 GCTCCTGGGGCCACCACCCCCGG + Exonic
1131945019 15:97609795-97609817 ACCCCTGTGGCCACAACCACTGG - Intergenic
1133834051 16:9350940-9350962 ACTCCTGTGACCACCACCACTGG + Intergenic
1135459947 16:22633462-22633484 ACTCCTGTGGTTCCCAGAACAGG + Intergenic
1136679318 16:31946438-31946460 ACTCCTGTGGCCACCACCACTGG - Intergenic
1137225794 16:46506913-46506935 ACCTCTGTGTCCACCACCACTGG - Intergenic
1137892823 16:52180277-52180299 GCTCTTGTGGTCAACTCCACAGG + Intergenic
1138238620 16:55407638-55407660 ACTCCTGTGGACTGCACCTCTGG - Intronic
1138316190 16:56072411-56072433 ACTCCTGTAGTCAGCCCCTCGGG + Intergenic
1139123073 16:64043559-64043581 ACCTCTGTGGCCACCACCACTGG - Intergenic
1139235653 16:65335885-65335907 ACTCCTGTAGTCACAGCTACTGG + Intergenic
1139372938 16:66479828-66479850 ACTCCTGTGGGCATGATCACAGG - Intronic
1140567006 16:76055546-76055568 ACCCCTGTGGCCACCAAAACTGG + Intergenic
1141493300 16:84389621-84389643 ACTCCTGCTGTCCCCACCTCTGG + Intronic
1142282064 16:89153890-89153912 CCTCCTGCAGTCACCACCCCTGG + Intronic
1143407228 17:6685602-6685624 CCTCCTGTGGCCACCACCAAAGG - Exonic
1144437073 17:15251669-15251691 ACTCATGTGGCCCCCAGCACTGG + Intronic
1144452761 17:15394899-15394921 CCTCCTGTCCTCACCACCAGTGG + Intergenic
1145069296 17:19789174-19789196 ACCCCTGTGGCCACCACCACTGG - Intronic
1145117355 17:20224251-20224273 ACTTCTGTGGCTACCACTACTGG + Intronic
1145200903 17:20944032-20944054 ACCCCTCTGGCTACCACCACTGG + Intergenic
1145415878 17:22713639-22713661 ACTTCTGAGGTGACCACCAGAGG - Intergenic
1146242441 17:31243250-31243272 AGCCCTGTGGACACCAGCACTGG + Intronic
1146343142 17:32039348-32039370 ACTCCTGTAGTCCCCGCTACTGG + Intronic
1146615264 17:34351222-34351244 ACCCCCATGGTCACCACTACTGG - Intergenic
1146722864 17:35135382-35135404 ATTCCTGTGGTCCCCAGCAGAGG - Exonic
1148221255 17:45863971-45863993 TGTCCTGTGGTCGCCTCCACTGG + Intergenic
1149111203 17:53033137-53033159 ACCCCCGTGGCCACCACCACTGG + Intergenic
1149231384 17:54537696-54537718 ACCCCTGTAGCCACCAACACTGG - Intergenic
1149239888 17:54636294-54636316 ACCCCTGTGGTCACTACTATTGG - Intergenic
1153088724 18:1319030-1319052 AACCCTGTGGCCACCACCACTGG - Intergenic
1153429591 18:5000805-5000827 ACCCCTGTGGCCAGCACCACGGG - Intergenic
1154930964 18:20995639-20995661 ACCCTTGTAGCCACCACCACTGG - Intronic
1154937800 18:21078628-21078650 TCTCCAGTAGTCTCCACCACAGG + Intronic
1155443531 18:25885780-25885802 ACCCTTGTGGCCACCACCACTGG - Intergenic
1155533908 18:26795577-26795599 AACCCTGTGGCCACCACCATGGG - Intergenic
1156055698 18:32999575-32999597 ACTCCTGTGGCCACCACCACTGG - Intronic
1156197457 18:34791107-34791129 ACTCCTGTGGTCACTCCCATGGG + Intronic
1156619790 18:38835921-38835943 ACTCCTGAGGTCACAGCCAAGGG + Intergenic
1158116969 18:54006074-54006096 ACCCTTGTGGCCACCACCACTGG - Intergenic
1158481165 18:57823309-57823331 ACCCCTGTGGCCACCACCACTGG + Intergenic
1159284815 18:66336112-66336134 ATTCCCGTGATCAGCACCACTGG + Intergenic
1159446423 18:68545963-68545985 CCCTCTGTGGCCACCACCACTGG - Intergenic
1159565058 18:70038346-70038368 ATCCCTGTGGCTACCACCACTGG - Intronic
1159648175 18:70943861-70943883 ACCACTGTGGCCACCACCAGTGG - Intergenic
1160138367 18:76295617-76295639 ACCCCTATGGCAACCACCACTGG + Intergenic
1160695757 19:483581-483603 ACACCTGTGGTCGTCACGACTGG + Intergenic
1161366844 19:3884972-3884994 ACACCTGTGGTCACAGCTACTGG + Intronic
1161828826 19:6588280-6588302 ACACCTGTGGCCACCACCCCTGG + Intronic
1163430245 19:17262987-17263009 AGTCCTGTGGACACCAACTCAGG + Exonic
1165645535 19:37432263-37432285 ACCCCTGTGGCTACCACCACTGG - Intronic
1166438731 19:42791825-42791847 TCTCCAGTGGTCTCCACCACAGG + Intronic
1166473742 19:43102614-43102636 TCTCCAGTGGTCTCCACCACAGG + Intronic
1166487693 19:43227679-43227701 TCTCCAGCGGTCTCCACCACAGG + Intronic
1166494526 19:43289551-43289573 TCTCCAGTGGTCTCCACCACAGG + Intergenic
1166757311 19:45201380-45201402 ACCCTTGTGGCCACCACCACTGG + Intronic
1166876476 19:45901028-45901050 ACACCTGGGGTCATCAGCACAGG - Intronic
1168449071 19:56448897-56448919 ACTCCCATGGCCACCAACACTGG - Intronic
925269531 2:2592368-2592390 ACCCCTGTGGCCACCACCACTGG - Intergenic
925588647 2:5488025-5488047 ACCTCTGTGGCCACCAGCACTGG - Intergenic
926702632 2:15813882-15813904 ACTCCTGTGGACATCACCTTTGG + Intergenic
926910752 2:17850678-17850700 CCTCCTGTAGTCACCAACCCTGG - Intergenic
927570169 2:24152684-24152706 ACCCCTGTGGCCACCATTACTGG + Intronic
928495559 2:31828553-31828575 ACCCCTGTGACCACCACCACTGG + Intergenic
929281616 2:40086831-40086853 ACCCCTGTGTCCACCACCAATGG + Intergenic
929524929 2:42693180-42693202 ACTCTTGTGGCTACCACCACTGG + Intronic
929529178 2:42736343-42736365 ACCCCTGTGGCGACTACCACTGG + Intronic
929600389 2:43200840-43200862 ACACCTGTGGTCCCAGCCACTGG - Intergenic
930727515 2:54695969-54695991 ACTCCTGTGGCCACCACCACTGG - Intergenic
930778372 2:55197434-55197456 ACCACTGTGGTCACCAGCTCTGG - Intronic
931085864 2:58830345-58830367 ACCCCTGTGGCCACCACCACTGG + Intergenic
931248732 2:60512150-60512172 ACCCCTGTGCTCACCACCCCTGG + Intronic
931406803 2:61987591-61987613 ACCCCTGTGGCCACTACCACTGG + Intronic
931736656 2:65200134-65200156 ACCCCTGTGGCCACCACCACTGG - Intergenic
932648689 2:73532150-73532172 ACCCCTGTGGCCACCACCAGTGG + Intronic
932889599 2:75580379-75580401 ACTCCTATAGCCACCACCACTGG - Intergenic
933053713 2:77634170-77634192 ATCCCTGTGGCCACCATCACTGG + Intergenic
933097983 2:78211473-78211495 ACCCCTGTGGCCACCACCACTGG - Intergenic
933601084 2:84330856-84330878 ACCCCTGTGGCCACCACCAGTGG - Intergenic
934750819 2:96793113-96793135 ACTCCTGAGGTCAGGAGCACTGG + Intronic
934870685 2:97861965-97861987 ATCCCTGTGGCCACCACCACTGG - Intronic
935078502 2:99769905-99769927 ACCCCTGTGGCTACCACGACTGG + Intronic
935437756 2:103055506-103055528 ACCCATATGGCCACCACCACTGG + Intergenic
935989548 2:108706489-108706511 ACCCCTGTGGCCACCACCACTGG - Intergenic
936940283 2:117877886-117877908 ACCCCTGTGGCCACCAGCACTGG + Intergenic
937512605 2:122612498-122612520 ACCCCTGTGGCTACCACCAGTGG - Intergenic
937793880 2:125994328-125994350 ACTCCTATAGTCACCACCACTGG + Intergenic
938177837 2:129152720-129152742 ACCCTTGTGGCCACCAGCACTGG + Intergenic
939144626 2:138397099-138397121 AACCCTGTGGCCACCACCAGTGG - Intergenic
939146598 2:138423250-138423272 AGTCCTGGGTTCACCATCACAGG - Intergenic
939273699 2:139971713-139971735 ACCCCTGTGGCCACCACCACTGG - Intergenic
939707789 2:145477337-145477359 ACCTCTGTGAACACCACCACTGG + Intergenic
939812722 2:146854242-146854264 ATACCTGAGGTCACCTCCACAGG - Intergenic
940315125 2:152320288-152320310 CATCCTGTGGTCACCACCACAGG + Intergenic
940546970 2:155100902-155100924 ACACCTTTGATCACCACCACTGG - Intergenic
940559724 2:155280580-155280602 ACTGCTGTGGCCACCACAACTGG + Intergenic
940795507 2:158072567-158072589 AGCCCTGTGGCCACCACCACTGG - Intronic
940803139 2:158154810-158154832 ACCCCTATGACCACCACCACTGG - Intergenic
941138372 2:161745990-161746012 ACTCCTATGGCCACCACTGCTGG + Intronic
941528145 2:166631670-166631692 ATCCCTGTGGCCACCATCACTGG + Intergenic
941742329 2:169047777-169047799 ACCTCTGAGGCCACCACCACTGG - Intergenic
942001475 2:171652541-171652563 ACCCCTGGGGCCACCACCACTGG + Intergenic
942294816 2:174507251-174507273 ACCCCTGTGGTCACCACTAATGG - Intergenic
942295039 2:174508556-174508578 ACTCCTGTGGTCACCACCACTGG - Intergenic
942814212 2:180033371-180033393 ACCTTTATGGTCACCACCACTGG + Intergenic
942882009 2:180872036-180872058 ATCCCTGTGGCCACCACTACTGG - Intergenic
943208093 2:184927406-184927428 ACCCCTGTGGCCACCACCACTGG + Intronic
943427781 2:187758581-187758603 ACCACTGTGGCCACTACCACTGG + Intergenic
943933687 2:193886595-193886617 ACCCCTGTGGCCACCACCACTGG - Intergenic
944005227 2:194896767-194896789 ACCCCTGGGGCCACCACCACTGG + Intergenic
944133153 2:196369424-196369446 ACTCCTGTTGTCACCACCACTGG + Intronic
945489717 2:210441002-210441024 ACTCCTCTAGGCACCACCAAAGG + Intronic
946697382 2:222372963-222372985 ACCCCTGTGGCCACGACCACTGG - Intergenic
946862919 2:224017048-224017070 ACTTGTGTGGGCACCACCACAGG - Intronic
947009034 2:225546090-225546112 ACCCCTGTGGCCACCACCGCTGG + Intronic
947268328 2:228306140-228306162 TCTCCAGTGTTCTCCACCACAGG + Intergenic
947505227 2:230703641-230703663 ACCACTGTGGCCACCACCACTGG + Intergenic
948475385 2:238215765-238215787 ACCCCTGTGGCCACCACCACTGG + Intergenic
948774780 2:240278451-240278473 ACTCCTGAGGTCACTACCCCTGG - Intergenic
1168867691 20:1103103-1103125 ACTACAGTGCACACCACCACAGG + Intergenic
1169628732 20:7600997-7601019 ACCTCTTTGGCCACCACCACTGG - Intergenic
1169684797 20:8259487-8259509 ACTCCTGTGGTCCCAGCTACTGG + Intronic
1170668486 20:18407196-18407218 ACTCCTGTGGCCACCACTATTGG - Intronic
1170712181 20:18801375-18801397 ACTCCTGTAGTCCCCACTACTGG - Intergenic
1171943033 20:31349321-31349343 ACTCCTGTGATTACCACTACTGG - Intergenic
1172014800 20:31866940-31866962 ACTCATTTGGTCTCCACCACTGG - Intronic
1172028806 20:31967786-31967808 TCTCCTGTGTTCACCTCCAGTGG - Intergenic
1173126992 20:40346200-40346222 ATCCCTGTGGCCACCACCACTGG - Intergenic
1173204108 20:40979344-40979366 ACACCTGTGGTCACCATCACTGG + Intergenic
1174938661 20:54899118-54899140 GCTCCTGTGGCCACCGCCACTGG - Intergenic
1174982039 20:55407624-55407646 ACCCTTGTGGCCACCACCACTGG + Intergenic
1177275875 21:18912796-18912818 ACACCTGTAGCTACCACCACTGG + Intergenic
1177740517 21:25148085-25148107 ACCCCAGTGGCCACCACCACTGG + Intergenic
1177771421 21:25519949-25519971 ACTCCTGTGGCCACCACCACTGG - Intergenic
1177849940 21:26333823-26333845 GCCCCTGTGGCCACCACAACTGG - Intergenic
1178032194 21:28540836-28540858 AATCTTGTGTTCACAACCACTGG - Intergenic
1179579350 21:42330587-42330609 AGTCCTGTGGACACCAGCCCTGG - Intergenic
1180002752 21:45002537-45002559 CCTCCTGTGGTCACCCCTAGTGG + Intergenic
1180178543 21:46105257-46105279 ACACCTGTGGTCCCAACTACTGG + Intronic
1181753550 22:25007054-25007076 ACTGCTGTGGTCACCATCTGTGG + Intronic
1182488322 22:30653152-30653174 CCTTCTGTGCTCCCCACCACTGG + Intronic
1182701084 22:32238984-32239006 ACTGCTGTTTACACCACCACTGG - Exonic
1182770687 22:32794102-32794124 ATTCCAGTGCTCACAACCACTGG - Intronic
1184832368 22:46996803-46996825 ACTCCTGCTGTCACCACCTAAGG - Intronic
1185202062 22:49513670-49513692 ACTCCTGTGGCCCCACCCACAGG + Intronic
949158491 3:853937-853959 ACTCCTGTGGCCACCAGCACTGG - Intergenic
949622991 3:5837276-5837298 ACTCATGTGACCACCACCACTGG + Intergenic
949967682 3:9372451-9372473 ACTCCTGTGGTCCCAGCTACTGG + Intronic
950221406 3:11199276-11199298 AATCCTGGGGTCACCACTAATGG - Intronic
950392685 3:12709029-12709051 ACTCCTGTGGGAAGCAGCACTGG + Intergenic
950695526 3:14698679-14698701 ACCCCTGTGGCCACCACCACTGG + Intronic
950800966 3:15551654-15551676 ACCCCTATGTCCACCACCACTGG + Intergenic
951172046 3:19554183-19554205 ACCCCTGTGGCCACCACCACTGG + Intergenic
951259814 3:20494885-20494907 ACCCCTGTGGCCATCACCACTGG + Intergenic
951398801 3:22204074-22204096 AACCCTGTGGCCACCACCATTGG - Intronic
951972882 3:28467581-28467603 ACCCTTGTGGCCACCACCACTGG - Intronic
952008788 3:28875408-28875430 ACCTCTGTGGCCACCATCACTGG + Intergenic
952725848 3:36583191-36583213 ACTCCTTTGGTCACCACCACTGG - Intergenic
952912597 3:38203743-38203765 ACCCCTGTGGCTACCAGCACTGG + Intronic
953203664 3:40800637-40800659 TCTCATGTGGTCAGCTCCACAGG + Intergenic
954808984 3:53236415-53236437 TCTTCTGTGGCCTCCACCACAGG + Intronic
954880361 3:53831498-53831520 ACCCCTGTGGCCACCAACACTGG - Intronic
954923766 3:54214539-54214561 TCTCCTGTGGTCCTCATCACTGG + Intronic
955585130 3:60470118-60470140 ACTCCTGTGGCCACCGCCACTGG + Intronic
955683333 3:61525423-61525445 ACTCCTGTGGTTCCCAGGACAGG + Intergenic
956222837 3:66922690-66922712 ACTTCTGTGGCCATCACCACTGG - Intergenic
956223069 3:66924199-66924221 ACCTCTGTGGTCACCACCACTGG - Intergenic
956393162 3:68796112-68796134 ACCCCTGTGGCCATCACCACTGG + Intronic
956549606 3:70442747-70442769 AACCCTGTGGCCACTACCACTGG - Intergenic
957041591 3:75340086-75340108 ACTACTGAGGGCACCACAACAGG + Intergenic
957485672 3:80858994-80859016 ACTCCTGTGACCGCCACCACTGG - Intergenic
957890085 3:86345643-86345665 ACCCCTGTGGCCACCACAACTGG + Intergenic
957925548 3:86805754-86805776 ACTCCTGTGGCCACCAACAATGG - Intergenic
958682941 3:97353863-97353885 ACCCCTGTGGCCACCACCACTGG - Intronic
958976875 3:100678865-100678887 ACCCTTGTGGCCACCACCACTGG + Intronic
959127624 3:102308687-102308709 ACTCCTTTGGCCATTACCACTGG - Intronic
959191241 3:103113719-103113741 ACCCATGTGGCCATCACCACTGG - Intergenic
959285053 3:104397918-104397940 ACTCCTGTGGCCAACACAGCTGG - Intergenic
959328644 3:104973061-104973083 ATCACTGTGGCCACCACCACCGG + Intergenic
959448172 3:106466636-106466658 ACCCCTGTGGCCACCACCGCTGG + Intergenic
959547333 3:107612652-107612674 ACCCCTGTGGCCAACACCACCGG + Intronic
959717137 3:109444896-109444918 ACGCCTGGGGCCACCACCACTGG - Intergenic
959817798 3:110695684-110695706 ACTGCTGTGGTAGCCACCACAGG + Intergenic
959818880 3:110708516-110708538 ACTCCTGTGGCTACCACCAATGG + Intergenic
959913601 3:111792946-111792968 ACCCCTGTGGCCACCAACACTGG + Intronic
960153439 3:114274415-114274437 GCCCCTCTGGACACCACCACTGG + Intergenic
960404263 3:117239436-117239458 ACCCCTATGGCCACTACCACTGG - Intergenic
960565016 3:119123596-119123618 AGCCCTGTGGCCATCACCACTGG - Intronic
961435166 3:126911892-126911914 AGCCCTGTGGGCACAACCACAGG + Intronic
961986334 3:131138621-131138643 ACTCCTTTGGTCACCACTACTGG - Intronic
962078634 3:132113938-132113960 ACTTGTGTGGCAACCACCACAGG + Intronic
962465623 3:135655314-135655336 ACTCCTGTGGCCATCACCAATGG - Intergenic
962483435 3:135817206-135817228 ACCCTTGTGGCCACCATCACTGG - Intergenic
962667923 3:137674272-137674294 ACATCTGTGGCTACCACCACTGG - Intergenic
962998462 3:140653677-140653699 ACCCCTGTGGCCACCACCACTGG - Intergenic
963154233 3:142078372-142078394 ATCCCTGTGGCCACCACCACTGG - Intronic
963179538 3:142339172-142339194 ACCCCTGTGGCCACCACCACTGG - Intronic
963310200 3:143700892-143700914 ACCCCTGTGGCCACCACCAATGG - Intronic
963330636 3:143910740-143910762 CACCCTGTGGCCACCACCACTGG - Intergenic
963763244 3:149307251-149307273 ACCCCTGTGGCCACCAATACTGG + Intergenic
964021876 3:152022396-152022418 ATTCCTGTGGCCACCAGCTCTGG - Intergenic
964339089 3:155689049-155689071 ACCCCTGTAATCACAACCACTGG - Intronic
964398325 3:156272111-156272133 ACCCCCGTGGCTACCACCACTGG + Intronic
964804174 3:160588283-160588305 ACCCCTGTGGCCACCACCACTGG - Intergenic
965000006 3:162941163-162941185 ATTCCTGTAGCCACCATCACTGG - Intergenic
965035028 3:163426620-163426642 ACCCCTATAGCCACCACCACTGG - Intergenic
965045719 3:163573980-163574002 ACCCCTGTGACAACCACCACTGG - Intergenic
965175140 3:165321807-165321829 ACCCCTGTGGCCACCGCAACTGG + Intergenic
965181145 3:165404959-165404981 ACTCCTATGGGCACCACCAGTGG - Intergenic
965236781 3:166135597-166135619 ACTACTGTGGTCAATACTACTGG + Intergenic
965317430 3:167209325-167209347 ACCCCTGTGGCCACCAGCACTGG - Intergenic
965358797 3:167710790-167710812 ACCCCTGTTGCCACCACCTCTGG - Intronic
966142044 3:176767665-176767687 ATTCCTGTGGCCACTACCACTGG - Intergenic
966151787 3:176874220-176874242 ACCCCTGTGGCCACCACCCCTGG - Intergenic
966329086 3:178790694-178790716 ACCTCTGTGGCCACCACCACTGG - Intronic
966401048 3:179547056-179547078 ACACCTGTGGCCACCAGCACTGG - Intergenic
966463593 3:180204038-180204060 ACCCCTGTGGCCACCACCACTGG - Intergenic
966472004 3:180300297-180300319 ACTCCTGCCCTAACCACCACAGG + Intergenic
967609376 3:191484729-191484751 ACTGTTGTGGCCACCACCACTGG - Intergenic
967677589 3:192317818-192317840 ACCCCTGTGGCCACCACCACTGG - Intronic
968096372 3:195933518-195933540 ACTCCTGTGGCCACCAGCACTGG - Intergenic
969621053 4:8279052-8279074 ACCCCAGTGGTAACCAGCACAGG - Intronic
970144059 4:13014298-13014320 ACCACTGTGGTTTCCACCACTGG - Intergenic
970892915 4:21067701-21067723 ATCCCTATGGCCACCACCACTGG - Intronic
971272513 4:25163813-25163835 GCCCCTGTGGGCACCACAACTGG - Intronic
971954384 4:33396686-33396708 ACTCCTATGGTCGCCAACACTGG - Intergenic
972904568 4:43728754-43728776 ATTCCTGTGTCCACCACTACTGG - Intergenic
972909647 4:43798170-43798192 ATCCCTGTGGCCACCACCACTGG - Intergenic
972934339 4:44114014-44114036 ATCCCTGTGGCCACCACCACTGG + Intergenic
973074097 4:45901040-45901062 ACTCCAGTGGCCACCACAACTGG - Intergenic
973852873 4:54978079-54978101 ACTCCTGTGGCCGTCACTACTGG - Intergenic
973919699 4:55672916-55672938 ACAGTTGTGGCCACCACCACTGG + Intergenic
974267052 4:59598787-59598809 ACCCCTGGAGCCACCACCACTGG - Intergenic
974290709 4:59926077-59926099 ACCCCTGTGGCCACCACGAATGG - Intergenic
974333247 4:60506327-60506349 ACCCCTGTGGCCACCACCACTGG - Intergenic
974352908 4:60773198-60773220 ACCACTGTGGCCATCACCACTGG + Intergenic
974414874 4:61594669-61594691 ACCCCTGTGACCACCATCACTGG + Intronic
974469757 4:62303009-62303031 CCCCCTGTGGCCACCAGCACTGG - Intergenic
974647739 4:64716391-64716413 TCTCCAGTGGTCTCCACCACGGG + Intergenic
974758246 4:66241299-66241321 ATTGCTTTGGTCACCATCACAGG - Intergenic
975179948 4:71333441-71333463 ACCCCTGTGGTCATTACTACTGG + Intronic
975335571 4:73171113-73171135 ACCCCTGTGGTCACCACCACTGG - Intronic
975629871 4:76388734-76388756 ACTCCTGTGGCTGCCACCACTGG - Intronic
976082711 4:81374786-81374808 ACTCCTGTGTCCACCAGCACTGG + Intergenic
976444214 4:85111195-85111217 ACCACTGTGGCCACCATCACTGG - Intergenic
976453827 4:85223012-85223034 ATCCCTGGGGCCACCACCACTGG + Intergenic
976722163 4:88179132-88179154 ACCCCTGTGGCCACCAACACAGG - Intronic
976728391 4:88239290-88239312 ACCCCTGTGGCCACCACCACTGG + Intergenic
976908345 4:90267575-90267597 ACCCCTGTGGTCACCCCCACTGG - Intronic
976982161 4:91244412-91244434 ACCCCTGTGACCACCACTACTGG - Intronic
977166823 4:93710486-93710508 ACTGCTGTAGCCACCATCACTGG + Intronic
977325592 4:95571718-95571740 ACCCCTGCGGTGACCAACACTGG + Intergenic
977458563 4:97296093-97296115 ACCTTTGTGGCCACCACCACTGG + Intronic
977873584 4:102123339-102123361 ACCCATGTGGCCACCTCCACTGG + Intergenic
977985723 4:103380318-103380340 ACCCCTGTGGCCACCACCTCTGG - Intergenic
978008534 4:103650248-103650270 CAGCCTGTGGCCACCACCACTGG + Intronic
978082830 4:104615936-104615958 CATCCTGTGGCCACCGCCACTGG + Intergenic
978287919 4:107099701-107099723 ACCCCTATGGCCATCACCACTGG - Intronic
978520411 4:109609680-109609702 ACCCCTATGGTCACCACCACTGG + Intronic
978654479 4:111049616-111049638 ACCCCTGTGGTCATCACTACTGG - Intergenic
978934500 4:114358902-114358924 ACCCCTGTGGCAAACACCACTGG + Intergenic
979073361 4:116240418-116240440 ATCCCTGTGGCCACCAGCACTGG + Intergenic
979396830 4:120198533-120198555 ACCCCTGTGGTCCCCACCACTGG - Intergenic
979573104 4:122252890-122252912 ACCCCTGTGGCTACCACCAGTGG - Intronic
979892692 4:126119619-126119641 ACCCCTGTGTTCACTACTACTGG + Intergenic
979945947 4:126830925-126830947 ACCCCAGTGGCTACCACCACTGG - Intergenic
980646921 4:135653784-135653806 AACCCTGTGGACACCACCACTGG - Intergenic
981140339 4:141260079-141260101 ACCCCTGTGACCACCACCACTGG - Intergenic
981286552 4:143025245-143025267 ACCCCTGTGGCCACCACCACTGG - Intergenic
982138582 4:152296013-152296035 ACACCTGTGGTCCCAACTACTGG - Intergenic
982339949 4:154285959-154285981 ACCCCTGTGACCACCACCACTGG - Intronic
982622882 4:157728468-157728490 ACCCCTGTGGCCACCACCACTGG - Intergenic
982683279 4:158458670-158458692 ACCTTTGTGGCCACCACCACTGG + Intronic
982828191 4:160026906-160026928 ACCCCTGTAGCCACCAGCACTGG + Intergenic
982899418 4:160980254-160980276 ACCCCTGTGGCCACCACCACTGG + Intergenic
982911672 4:161149467-161149489 ACCCTTGTGAGCACCACCACTGG - Intergenic
982932797 4:161429452-161429474 ACCCCAGTGGCCAACACCACTGG - Intronic
983017337 4:162629082-162629104 ACTGCTGTGGACACCCCCAATGG - Intergenic
983064430 4:163192641-163192663 TCTCCAGTGGTCTCCACCACAGG + Intergenic
983165857 4:164476997-164477019 ACCCCTGTTGCCACCACCATTGG + Intergenic
984364604 4:178782319-178782341 TCTCCTTTAGTCCCCACCACTGG + Intergenic
984396725 4:179211373-179211395 ACCCCTGTGGCCACCAACACTGG + Intergenic
984668774 4:182457682-182457704 ACACCTGTGGTCCCAACCATTGG - Intronic
986548436 5:8924995-8925017 CCTCCTGTCACCACCACCACTGG - Intergenic
986631059 5:9774837-9774859 ACCTCTGTGGCCACCACCAGTGG + Intergenic
987631562 5:20478842-20478864 ACTTCTGTGGCCATCATCACTGG - Intronic
987645976 5:20672629-20672651 ACCCCTGTGGCTGCCACCACTGG - Intergenic
988039743 5:25874196-25874218 ACCCCTGTGGCTACCACCACTGG + Intergenic
988064865 5:26220123-26220145 ACTCCTGTGGCCACCGGCACTGG - Intergenic
988082839 5:26434471-26434493 ATCCCTGTGGCCAACACCACTGG - Intergenic
988117949 5:26920576-26920598 ACCCCTGTGGCCCCCGCCACTGG - Intronic
988196777 5:28014544-28014566 TCTCCAGTGGTCTCCACCACAGG - Intergenic
988265222 5:28941263-28941285 ACCCCTGTGTCCACCACCACTGG + Intergenic
988376337 5:30440016-30440038 ACCCCTGTGGTCACCATCACTGG - Intergenic
988608310 5:32701935-32701957 TCTGTTGTGGCCACCACCACTGG + Intronic
988939452 5:36127991-36128013 ACCCCTGTGGTCACCATCACTGG - Intronic
988956274 5:36323668-36323690 ACCCCTATGGCCACCACCACAGG + Intergenic
989083180 5:37647803-37647825 ATGCTTGTGGCCACCACCACTGG + Intronic
989472136 5:41832269-41832291 ATCCCTATGGCCACCACCACTGG - Intronic
990214119 5:53512626-53512648 ACCCCTGTTGCCATCACCACTGG + Intergenic
990774323 5:59287651-59287673 ACCCCTGTGGCCACCACCACTGG - Intronic
990828036 5:59923446-59923468 ACCCTTGTGGCCACCACCACTGG - Intronic
990900064 5:60739904-60739926 ACCCCTGTGGCCACCATGACTGG - Intergenic
990938661 5:61177712-61177734 ATTCCTTTGGCCACCACCACAGG - Intergenic
991107358 5:62860371-62860393 ACCCCTGTGGCCACCACCACTGG + Intergenic
991209035 5:64083817-64083839 ACTCATGTGGCCACCACCACTGG + Intergenic
991237868 5:64419629-64419651 ACCTCTGTGACCACCACCACTGG - Intergenic
991395189 5:66197930-66197952 ACCCCTGTGGCCACCACTACTGG + Intergenic
992285064 5:75226379-75226401 ACCCCTATAGCCACCACCACTGG - Intronic
992285070 5:75226416-75226438 ACTCCTGTGGCTACCACCACTGG - Intronic
992291484 5:75283984-75284006 ACTCCTGTGGCCACCACCACTGG - Intergenic
992309671 5:75482620-75482642 ACCACTGTGGCCACTACCACTGG - Intronic
992531673 5:77658718-77658740 ACCCTTGTGGCCACCACCACAGG + Intergenic
992692599 5:79255839-79255861 ACTCCTGTGGCCATCACCACTGG + Intronic
992850690 5:80804684-80804706 ACCTCTGTGACCACCACCACTGG + Intronic
993155702 5:84219092-84219114 ACCTCTGTGGCCACCAACACTGG - Intronic
993206963 5:84894713-84894735 TCCCCTGTGGCCACCACCACTGG + Intergenic
993677562 5:90835453-90835475 ACTCTTGTGGTCACTGCCACTGG + Intronic
994310888 5:98268690-98268712 TCTCCTATGGCCACCACCTCTGG - Intergenic
994616127 5:102107060-102107082 CACCCTGTGGCCACCACCACAGG + Intergenic
994974209 5:106780705-106780727 ACCCCTGTGGCCACCAACACTGG - Intergenic
995049746 5:107688590-107688612 ACTCTTATATTCACCACCACTGG - Intergenic
995290156 5:110442990-110443012 ACCCTTGTGTTCACCACCACTGG + Intronic
996039917 5:118798057-118798079 AATCCTGTAGTCAGGACCACTGG + Intergenic
996259414 5:121446858-121446880 ACACCAGTGGCCAACACCACTGG - Intergenic
996459644 5:123726106-123726128 ACCCCTGTGGCCACTGCCACTGG - Intergenic
996653548 5:125912934-125912956 ACTTTTTTGGCCACCACCACTGG + Intergenic
996666665 5:126067307-126067329 ACCCCTGTGGCTACCACCACTGG - Intergenic
996931552 5:128895674-128895696 ACCCCTGTGGCCACCACCACTGG + Intronic
997180507 5:131824072-131824094 ACCCCTGTGACCACCACCAATGG + Intronic
998634091 5:143932789-143932811 ATCTCTGTGGCCACCACCACTGG - Intergenic
998859097 5:146425507-146425529 GCTCCTGTGGCCAACACCGCTGG - Intergenic
999919405 5:156302876-156302898 ACCACTGTGGCCACCAACACTGG + Intronic
1000433628 5:161180683-161180705 AACCCTGTGGCCACCAACACTGG - Intergenic
1000965266 5:167648463-167648485 AGTCCTGTTGTCCCCATCACTGG - Intronic
1002314616 5:178335009-178335031 ACGCCTGTGGTCTCCACCTATGG - Intronic
1003506898 6:6747390-6747412 AGCCCTGTGGACACCACCAATGG - Intergenic
1003952217 6:11127042-11127064 ACCCCTGTGGCCACCACTGCTGG + Intronic
1005037288 6:21568968-21568990 ATCCCTATGGCCACCACCACTGG + Intergenic
1006289138 6:33121057-33121079 TTTCCAGTGGTCTCCACCACAGG + Intergenic
1006936178 6:37720222-37720244 AATCCAGTGGTCCCAACCACAGG - Intergenic
1008060739 6:46993957-46993979 ATTCCTGGGGTCACCAGCATAGG - Intergenic
1008192469 6:48476225-48476247 ACCCCTGTGTCCACCACTACTGG - Intergenic
1008822563 6:55651299-55651321 AACCCTGTGGCCACCACTACTGG - Intergenic
1008848417 6:55995892-55995914 ACTCCTGTGGCCACCACCACTGG + Intergenic
1009039245 6:58157734-58157756 AACCCTGTGGCCACCACCACTGG + Intergenic
1009215144 6:60912577-60912599 AACCCTGTGGCCACCACCACTGG + Intergenic
1009309106 6:62126570-62126592 ACTTTTGTGGCCATCACCACTGG - Intronic
1009744945 6:67799698-67799720 ATCCCTGTGGCTACCACCACTGG - Intergenic
1009847263 6:69150012-69150034 ACCTCTGTGGCCACAACCACGGG + Intronic
1009978412 6:70699309-70699331 ACCCATGTGACCACCACCACTGG + Intronic
1010343323 6:74782174-74782196 ACCCCTGTGGCCACCATTACTGG - Intergenic
1010502300 6:76615633-76615655 ACCCTTGTGGCCACCATCACTGG - Intergenic
1010514286 6:76753913-76753935 ATTCCTGTTGCCAACACCACCGG - Intergenic
1010548116 6:77183946-77183968 CACCCTGTGGCCACCACCACTGG - Intergenic
1010838921 6:80623998-80624020 ACCCCTGTGGCCACCACCACTGG - Intergenic
1011102817 6:83743512-83743534 ACCCCAGTGGCCACCACCACTGG + Intergenic
1011236121 6:85218850-85218872 ACCCCTGTGACCACCACAACTGG - Intergenic
1011291071 6:85778340-85778362 ACTCCTGTGGCCACTACCACTGG + Intergenic
1011322739 6:86115346-86115368 ACCCCTGTGGCCACCACCACTGG + Intergenic
1011341071 6:86314459-86314481 ACCCCTGTGATCAGTACCACAGG - Intergenic
1011791746 6:90906641-90906663 ACTCCTGGGGCCACCACCACTGG + Intergenic
1012028720 6:94030355-94030377 ATCCCAGTGGCCACCACCACTGG - Intergenic
1012690204 6:102300577-102300599 ACCACTGTGGTCACCACCACTGG - Intergenic
1012712649 6:102628358-102628380 ACTCCTATGGTCATCACCGCTGG + Intergenic
1012717689 6:102698347-102698369 ACCCCTGTGGCCACCACTACTGG + Intergenic
1012806999 6:103907868-103907890 ACCCCTGTGGCCACCACCAGTGG + Intergenic
1012892223 6:104908951-104908973 ACCCCTGTGGCTGCCACCACTGG - Intergenic
1012940583 6:105410401-105410423 ACCCCTGTGGTCACCACCACTGG - Intergenic
1013524811 6:110964188-110964210 ACGCCTGTGGTCCCAACTACTGG - Intronic
1013673332 6:112429604-112429626 GCTCCTGTGGCCATCACCACTGG + Intergenic
1014073821 6:117214767-117214789 ACCCCTGTGGCTACAACCACTGG + Intergenic
1014110114 6:117611280-117611302 AATCCTATGGTCACCAACAAAGG + Intergenic
1014198324 6:118583098-118583120 TCTCCAGTGGTCTCCGCCACAGG - Intronic
1014234744 6:118941027-118941049 ACCCTTGTGGCCACAACCACTGG - Intergenic
1014689052 6:124539294-124539316 ACTCCTTTGGAAACCACCAGTGG + Intronic
1014855453 6:126395943-126395965 CCCCCTGTGGCCACCACCACTGG + Intergenic
1016013226 6:139159653-139159675 ATTACTGTGGTCACAACCAGAGG + Intronic
1016061474 6:139635820-139635842 AACCCTGTGGCCACCAGCACTGG + Intergenic
1016127786 6:140427639-140427661 ACCCTTGTGGCCACCACCACTGG + Intergenic
1016457263 6:144244568-144244590 ACCCCTGTGGCCACCACCACTGG + Intergenic
1017387483 6:153902275-153902297 ACACCTGTAGCCACCACCAGTGG - Intergenic
1017924711 6:158901122-158901144 ACCCCCGTGGCCATCACCACTGG + Intronic
1018917502 6:168145817-168145839 ACCCCTATGGCTACCACCACTGG + Intergenic
1019044489 6:169132587-169132609 ACCCCTGTGACCACCACCACTGG - Intergenic
1019539522 7:1545493-1545515 GCTCCAGTGGGCACCACCCCGGG - Exonic
1020275748 7:6623547-6623569 ACGCCTGTGTTCATCAACACAGG + Exonic
1020485278 7:8713873-8713895 ACTCCTTTGGCCACCACCACTGG + Intronic
1020537031 7:9412657-9412679 ATTCCTGTTTTCACCAGCACAGG - Intergenic
1020624328 7:10558752-10558774 ACCCCTGTGGCCACCAACATTGG - Intergenic
1020812759 7:12865511-12865533 ACTCCTGTGGCCACCACCACTGG - Intergenic
1021034910 7:15785536-15785558 ACCCCTGTGGCCACCATCACTGG - Intergenic
1022749766 7:33212919-33212941 AGTCTTGTGGCCACCAACACTGG + Intronic
1022758837 7:33325896-33325918 ACTCCCATGGCCACCACCAATGG + Intronic
1023690839 7:42785855-42785877 AATCCTGCTGTCAGCACCACAGG - Intergenic
1023716363 7:43047704-43047726 ACCCCTGTGGCCACCACTGCTGG - Intergenic
1024141530 7:46467406-46467428 CATCCAGTGGTCACCAGCACAGG + Intergenic
1024529022 7:50375295-50375317 ACACCTGTAGTCACAACTACTGG + Intronic
1024662314 7:51510428-51510450 ACCCCTGTGGCCACCATCACTGG + Intergenic
1025061699 7:55813969-55813991 ACTCCTGTGGCCATCACAGCTGG - Intronic
1026256975 7:68720833-68720855 ACTCATGTGGTTGCCTCCACTGG + Intergenic
1027524181 7:79245863-79245885 ACTCCTCTGGCCACCACCGCTGG - Intronic
1027604994 7:80288711-80288733 ACCCCTGTGACCACCACCTCTGG - Intergenic
1028022473 7:85793163-85793185 AGCACTGTGGCCACCACCACTGG - Intergenic
1028186345 7:87790116-87790138 CCTCCTATGGCCACCATCACTGG - Intronic
1028207437 7:88033452-88033474 ACCCATGTGGCCACCATCACTGG + Intronic
1028266467 7:88732917-88732939 ACACCTGTGGCCACCACCACTGG + Intergenic
1028929427 7:96397036-96397058 ATTCCTGTGGCCACCAACACTGG + Intergenic
1030488552 7:110203438-110203460 ACCCCTGTGGCCACCAGCACTGG + Intergenic
1030662808 7:112239466-112239488 ACTCCTGTGGTCACCACCACTGG - Intronic
1030723609 7:112898679-112898701 ACTCTTGTGGCCACCACAGCTGG - Intronic
1030881161 7:114882120-114882142 ACCCCTGTGGCCATCACCACTGG + Intergenic
1031098588 7:117449487-117449509 ATCCCTGTGGCCACCACCACTGG - Intergenic
1031412406 7:121456240-121456262 ACCCCTGTGGCTACCACCACTGG + Intergenic
1031565983 7:123297190-123297212 ACTTCTGTGGCCACCGCCACTGG - Intergenic
1031753922 7:125613315-125613337 ACCCCTGTGGCCACCAGCACTGG - Intergenic
1031758715 7:125682183-125682205 ACCCCTGTGGCCACTACAACTGG - Intergenic
1031862395 7:126994981-126995003 ACCCCTGTGGCCACCACCACTGG - Intronic
1031983253 7:128144037-128144059 ACACCTGTGGTCACAGCTACTGG - Intergenic
1032138679 7:129307009-129307031 AGCCCTGTGGCCACCAACACTGG + Intronic
1032939216 7:136768863-136768885 ACTCCTGTGGCCACCAACACTGG - Intergenic
1033492753 7:141860356-141860378 ACACCTGTGTTAACCATCACAGG + Intergenic
1033499996 7:141937764-141937786 ATCCCTGTGACCACCACCACTGG - Intronic
1033813966 7:145050597-145050619 ACTCCCAGGGACACCACCACTGG + Intergenic
1033867675 7:145713025-145713047 AGCCCTGTGACCACCACCACTGG + Intergenic
1034272288 7:149809084-149809106 GTTCCTGTAGCCACCACCACAGG - Intergenic
1034398181 7:150843101-150843123 ACCCCTGTGGCCACCGCCACTGG - Intronic
1035018108 7:155783811-155783833 ACACCTGTGGTCCCAGCCACTGG - Intergenic
1035139198 7:156739533-156739555 ACTCCTGTGGCCACCAACACTGG - Intronic
1035197873 7:157238266-157238288 ACTCCTGGCGTCACCAGCAGAGG + Intronic
1035256362 7:157630970-157630992 CCTCCTGTGGGCACCACAACTGG + Intronic
1035753944 8:2017335-2017357 ATCCCTCTGGTCACCACCACTGG + Intergenic
1036693422 8:10959226-10959248 ACTCCTGTGGTCTCCAGGCCAGG - Intronic
1037254924 8:16942399-16942421 ACCCCTGTGGTCACCACTACTGG - Intergenic
1037277220 8:17193443-17193465 ACCTCTGTGGCCAACACCACTGG + Intronic
1037295753 8:17397810-17397832 ACCCCTGTGGCCACCACCACTGG - Intronic
1037385212 8:18332507-18332529 ACTCCTGTTGGCACTCCCACTGG - Intergenic
1037598369 8:20373483-20373505 ATTCCAGTGTTCACCAGCACAGG - Intergenic
1039656350 8:39412139-39412161 ACTCCTGTGGCCATCACAGCTGG - Intergenic
1040721014 8:50323698-50323720 ACCTCTGTGGCCACCACCACTGG + Intronic
1041416125 8:57610139-57610161 AACCCTGTGTTCTCCACCACTGG - Intergenic
1041500290 8:58532911-58532933 ACCCCTGTGGCCACCAATACTGG + Intergenic
1041579801 8:59446277-59446299 ACCCCTGTGGCCACAACCACTGG + Intergenic
1041790709 8:61693585-61693607 ACTCCCACGGCCACCACCACTGG + Intronic
1042082439 8:65070467-65070489 ACTCCTGTGGCCACTACCACTGG + Intergenic
1042428286 8:68673869-68673891 ACCCCTGTGGTCACCACAGCTGG - Intronic
1042748995 8:72137678-72137700 ACTCCTGTGGCGTGCACCACAGG - Intergenic
1043215049 8:77574722-77574744 ACCCCTGTGGCCACTACCACTGG - Intergenic
1043567445 8:81563016-81563038 ACCCCTGTGGCCACCCCCACTGG - Intergenic
1044124366 8:88438759-88438781 ACTCCTGTGGCCACCATCACTGG - Intergenic
1044968757 8:97599352-97599374 ACACCTGTGGTCCCAGCCACTGG + Intergenic
1045041198 8:98226671-98226693 ACCCCTGTGGCCACTCCCACTGG + Intronic
1045193810 8:99909638-99909660 ACGCCTGTGGTCCCAACTACTGG + Intergenic
1045621329 8:103981169-103981191 ACCCCTGTGGCTACCACCGCTGG - Intronic
1045733298 8:105266670-105266692 ACCCTTGTGGCCACCACCACTGG + Intronic
1045800781 8:106097792-106097814 ACCCCTGTGTCCACCACCCCTGG - Intergenic
1045995022 8:108352295-108352317 ACCCCTGTGGCCACCACCACTGG - Intronic
1046114051 8:109764636-109764658 ACCCTTGGGGCCACCACCACTGG + Intergenic
1046193750 8:110833029-110833051 TCTCCAGTGGTCTCCACCACAGG + Intergenic
1046335539 8:112781665-112781687 ACTCCTGTGGTCAGCACCACTGG - Intronic
1047150657 8:122258259-122258281 ATTCCTGTTGTCAGCACCCCTGG - Intergenic
1047342667 8:123998466-123998488 ACTTCTGTTGCTACCACCACTGG + Intronic
1047841271 8:128755430-128755452 ACCACTGTGGTTACCACCAATGG - Intergenic
1047901201 8:129423791-129423813 ACCCCTATGGCCATCACCACTGG - Intergenic
1047933741 8:129754237-129754259 ACCCCTGTGGCCACCACCACTGG - Intronic
1047937901 8:129799945-129799967 ACCTCTGTGGCTACCACCACTGG + Intergenic
1048029777 8:130620658-130620680 ACCCCTGTGGCCACCACGACTGG + Intergenic
1048118878 8:131556166-131556188 ATCCCCGTGGCCACCACCACTGG - Intergenic
1048706120 8:137155614-137155636 ACACCTGTGTCCACCACCACAGG + Intergenic
1049818355 8:144618986-144619008 ACTGCTATGGAGACCACCACAGG - Intergenic
1049965976 9:780302-780324 ACTCCTGCAGTCTCAACCACAGG - Intergenic
1050248277 9:3714342-3714364 ACTTCTCTTGCCACCACCACTGG - Intergenic
1050251609 9:3750459-3750481 ACTCCTGTGGTCCCAGCCACTGG - Intergenic
1050316125 9:4402136-4402158 ACCCCTGTGGCCACCACCACTGG - Intergenic
1050355981 9:4782775-4782797 ACTCCTGTGGCCACCACCACGGG - Intergenic
1050722075 9:8601475-8601497 AACCCTGTGGCCATCACCACTGG - Intronic
1050829934 9:9998206-9998228 TCTCCAGTGGTCTTCACCACAGG - Intronic
1050830385 9:10003759-10003781 ACTCATGTGGTCCTCACAACAGG + Intronic
1050906808 9:11015547-11015569 ACCCCTGTGAGCATCACCACTGG + Intergenic
1050930082 9:11311923-11311945 ACTCCCATTGCCACCACCACTGG + Intergenic
1051029791 9:12659278-12659300 CCTAGTGTGGCCACCACCACTGG - Intergenic
1051047289 9:12889592-12889614 ACCCTTGTGGCCACAACCACTGG - Intergenic
1051465175 9:17368587-17368609 ACCCCTGTGGCCACCACCACTGG - Intronic
1051966543 9:22835678-22835700 ACCACTGTGGCCACCATCACTGG + Intergenic
1052204822 9:25827190-25827212 TCTTCTGTAGTCACCACCACCGG + Intergenic
1052420351 9:28235109-28235131 ACCCTTGTGGCCACCACCACTGG - Intronic
1052733002 9:32311263-32311285 ACCCCTGTGGTCACCACCAGTGG - Intergenic
1053040172 9:34863364-34863386 ACCCCTGTGGCCACCACCACTGG - Intergenic
1053504653 9:38631290-38631312 ACTCCTGTGGTCCCAGCTACTGG - Intergenic
1055302163 9:74892774-74892796 ACCCTTGTGGCCACCACCACTGG - Intergenic
1055383374 9:75733507-75733529 ACTACTGTGGTCACGACAAAAGG - Intergenic
1055387372 9:75776544-75776566 ACCCCTGTGGCCACCACCACTGG - Intergenic
1055886362 9:81068828-81068850 AGCCCTGTGGCCACCACCAGTGG + Intergenic
1056230467 9:84538337-84538359 TCCCCTGTGGCCACCACCACTGG + Intergenic
1056338936 9:85604206-85604228 AACCCTGTGGCCACCACCGCTGG - Intronic
1057644551 9:96860360-96860382 ACCCCTGTAGCCACCACCACTGG - Intronic
1058004058 9:99896382-99896404 ACTCCCGTAACCACCACCACTGG - Intergenic
1058232601 9:102447570-102447592 ACTTCTGTGGCCACCATCATTGG - Intergenic
1058248972 9:102668295-102668317 TCCCCTGGGGCCACCACCACAGG + Intergenic
1058284981 9:103166441-103166463 CATCCTGTGGCCACCACCACAGG + Intergenic
1058285157 9:103168759-103168781 ACCCCTGTGGCCACCACCACTGG + Intergenic
1058839042 9:108887803-108887825 ACTCCTATACTCACCAACACTGG - Intronic
1059555353 9:115275615-115275637 GCCCCTGTGGCCACCACCACTGG + Intronic
1059839200 9:118192601-118192623 ACCACTGTGGCCACCACCACTGG - Intergenic
1059873332 9:118602584-118602606 ACTCCTCTGGCCACCAGCATAGG - Intergenic
1060084014 9:120680534-120680556 ACCCCTGTGGCCACCACCACTGG + Intronic
1060304601 9:122399136-122399158 ACCCCTGTGGCCACCACCACTGG - Intergenic
1060328798 9:122644567-122644589 ACCACTGTGGTCACCACCACTGG - Intergenic
1061290030 9:129645438-129645460 ACCCCTGTGGTCACCAGGAGTGG - Intergenic
1062371432 9:136241161-136241183 ACTCATGTGGTCGCCACAGCGGG + Intronic
1062521444 9:136959582-136959604 TCTCCTGTGGTCACCGTCGCAGG - Intergenic
1186438629 X:9565702-9565724 GCTCCTGTGGTCCCAGCCACTGG + Intronic
1186498950 X:10035569-10035591 ACTTCTGTGGCCAACACCTCAGG - Intronic
1187132881 X:16519033-16519055 AACCCTGTGGCCACCACCACTGG - Intergenic
1187133893 X:16528379-16528401 ACTCCTCTGGCACCCACCACTGG - Intergenic
1187314933 X:18184098-18184120 ACCCCTGTGGACACCACCACTGG - Intronic
1187579224 X:20591211-20591233 ACCCCTTTTGCCACCACCACTGG + Intergenic
1187588383 X:20689468-20689490 AGCCCCGTTGTCACCACCACTGG + Intergenic
1187618211 X:21021102-21021124 ACCCCTGTGGCCATCACCACTGG - Intergenic
1187623689 X:21086558-21086580 ATGCCTGTGGCCACCACCAGTGG - Intergenic
1187636726 X:21237742-21237764 ACCATTGTGGCCACCACCACTGG - Intergenic
1187636930 X:21239027-21239049 ACCCTGGTGGCCACCACCACTGG - Intergenic
1187836316 X:23435603-23435625 ACTCCTGTGGTCACCACCACTGG - Intergenic
1187965406 X:24606512-24606534 GGTCCTGTGGTCACCACCCTTGG + Intronic
1188071663 X:25725960-25725982 ACCTCTGTGGTCACCACTACTGG + Intergenic
1188192067 X:27183135-27183157 ACCCCTGTGGCCACCACCACTGG - Intergenic
1188716288 X:33463647-33463669 ACCCCTGTGACCACCACCACTGG + Intergenic
1189013326 X:37070039-37070061 ACCACTGTGGCCACCACCACTGG + Intergenic
1189593956 X:42544210-42544232 ACCTCTGTGGCCACCACCACTGG - Intergenic
1189599001 X:42601441-42601463 CCTCCTCTTGTCACCTCCACAGG - Intergenic
1189628292 X:42922141-42922163 ACCCCTGTGGCCACCACCAGTGG - Intergenic
1189640899 X:43068851-43068873 ACCCCCGTGGCCACCACCACTGG - Intergenic
1189870130 X:45372309-45372331 ACCCCTGTGGCCACCATCACTGG - Intergenic
1189874239 X:45419764-45419786 ACCCTTGTGGCTACCACCACTGG + Intergenic
1190015241 X:46820607-46820629 ACCCCTGTGGCCACCATCACTGG - Intergenic
1190037924 X:47042940-47042962 ACCCCTATGGCCACCACCACTGG - Intronic
1190046373 X:47114212-47114234 ACCCCGGTGGCCACCACCAGTGG - Intergenic
1190179469 X:48179715-48179737 ACGCCTGTGGTCCCAACTACTGG + Intergenic
1190213432 X:48465836-48465858 ACTCCTGTGGTCAGAGCAACAGG + Intronic
1190217235 X:48488091-48488113 ACTCCTGTGGTCACAATGACAGG - Intergenic
1190374230 X:49774037-49774059 ACCCCTGTGGCCACCACCACTGG + Intergenic
1190507824 X:51145199-51145221 ACTCCTGTGGCCACCGCTGCTGG + Intergenic
1190507883 X:51145613-51145635 ACTCCCATGGCCACCACAACTGG + Intergenic
1190523118 X:51299784-51299806 ACCCCTGTGGCCACCACAATTGG - Intergenic
1190614709 X:52218034-52218056 TGCCCTGTGGCCACCACCACTGG - Intergenic
1191170816 X:57445403-57445425 ACTCCTGTGGCCACTACAGCTGG + Intronic
1191204472 X:57819850-57819872 ACTTCAGTGGTCTCCACCACAGG + Intergenic
1191646715 X:63489040-63489062 ACTACTGTGGTCCGCACCACTGG - Intergenic
1191974033 X:66850848-66850870 ACCTCTGTGGTCACCACCACTGG + Intergenic
1192191616 X:68994557-68994579 CCTACTGTGGCCACCATCACAGG - Intergenic
1192397399 X:70795572-70795594 ACCCCTGTGGCCACTACCCCTGG - Intronic
1192672560 X:73161290-73161312 ACCCCTGTGGCCACCACCACTGG + Intergenic
1192841282 X:74858253-74858275 ACCTCTGTGGCCACCACCACTGG - Intronic
1193247383 X:79244719-79244741 ACTCACGTGGCCACCACCACTGG - Intergenic
1193293702 X:79809034-79809056 ACCTCTGTGGCCACCACCACTGG + Intergenic
1193305887 X:79950360-79950382 ATTCCTGTGGCCACCACCACTGG - Intergenic
1193469179 X:81878468-81878490 ACTCCCTTGGCCACCACAACTGG + Intergenic
1193529637 X:82641678-82641700 ACCCATTTTGTCACCACCACTGG + Intergenic
1193738118 X:85185239-85185261 ACCCCTGTGGCCACCATCACTGG + Intergenic
1193765730 X:85527525-85527547 ACCCCTGTGATCACTACCACTGG + Intergenic
1193846703 X:86480379-86480401 ACCCCTTTGGCCACCACCACTGG + Intronic
1194110314 X:89825170-89825192 ACCCCTGTGGTCAACATCACTGG - Intergenic
1194196617 X:90902694-90902716 ATTGCTGTGGCCACCACCACAGG + Intergenic
1194228128 X:91286995-91287017 ACCTCTGTTGCCACCACCACTGG - Intergenic
1194253289 X:91603816-91603838 ACCTTTGTGGCCACCACCACTGG - Intergenic
1194290981 X:92071831-92071853 ACCTCTGTGGCCACTACCACTGG + Intronic
1194340558 X:92700346-92700368 ACCCCCATGGCCACCACCACTGG + Intergenic
1194415574 X:93607031-93607053 ATTTCTGTGGCCACCACAACTGG - Intergenic
1194500780 X:94678772-94678794 AGTCCCGTGGCCACCACCACTGG + Intergenic
1194526596 X:94984275-94984297 ACCCCTGTGGCCACCACCACTGG - Intergenic
1194533339 X:95077123-95077145 TCTCCAGTGGTCTCCACCACAGG + Intergenic
1194692810 X:97008832-97008854 GCTCCTGTGGCGACCACCACTGG + Intronic
1194780698 X:98022663-98022685 ACCCCTGTGGCCACCACCACTGG + Intergenic
1194795991 X:98211314-98211336 ACCCCTGTGGCCACCACCACTGG - Intergenic
1194882877 X:99274893-99274915 ACCCCTGTGGCCACCACTACAGG - Intergenic
1194892194 X:99394261-99394283 CCCTCTGTGGCCACCACCACTGG + Intergenic
1194892439 X:99397545-99397567 ACCCCTGTGGCCACCACTACTGG + Intergenic
1195199964 X:102539286-102539308 ACCCCTGTGGCCATCACCACTGG + Intergenic
1195312393 X:103643993-103644015 TCCCCTGTAGCCACCACCACTGG - Intergenic
1195489415 X:105449888-105449910 ACCCCTATGGCCATCACCACTGG + Intronic
1195601391 X:106752281-106752303 ACCCCTGTGGCCACCACTGCTGG - Intronic
1195782920 X:108484707-108484729 ACCCCTGTGGCCACCACCCCTGG + Intronic
1195917331 X:109948474-109948496 ACCCCTGTGGTCACCACTACTGG - Intergenic
1196234554 X:113263007-113263029 ACTCCCGTGGCCACTCCCACTGG + Intergenic
1196264419 X:113625765-113625787 ACTCCTGTGGCCAACACAGCTGG + Intergenic
1196269971 X:113699044-113699066 ACCTCTGTGGCGACCACCACTGG + Intergenic
1196357181 X:114808904-114808926 CAACCTGTGGCCACCACCACTGG + Intronic
1196619720 X:117807712-117807734 ACCCCTGTAGCTACCACCACTGG - Intergenic
1196639349 X:118039825-118039847 ACCTCTGTGGCAACCACCACTGG - Intronic
1196962009 X:121013996-121014018 ACCCCTGTGGCCACCACCACTGG + Intergenic
1197011678 X:121571300-121571322 AATACTGTGGCCACCACCACTGG - Intergenic
1197099461 X:122636020-122636042 ACTCCTTTGACCATCACCACTGG + Intergenic
1197382665 X:125765054-125765076 ACCCCTGTGTCCACCCCCACTGG + Intergenic
1197439372 X:126471317-126471339 ACTCTCATGGCCACCACCACAGG - Intergenic
1197458076 X:126702260-126702282 ACGCCTGTGACCACCACCAGTGG - Intergenic
1197520282 X:127489500-127489522 ACCCCTGTAGCCACCACCACTGG + Intergenic
1197670529 X:129272739-129272761 ACCCCTGTGGCCACCACCACTGG + Intergenic
1198430694 X:136564126-136564148 ACCCCTGTGGCCACCACCATTGG + Intergenic
1198515101 X:137399646-137399668 ACCCCTGTGGCCACCAGCACTGG + Intergenic
1198537678 X:137602069-137602091 ACTCCTGTGGCCACCACCACTGG - Intergenic
1198770470 X:140125507-140125529 ACTCCTGTGGCCACCACCACTGG + Intergenic
1198773661 X:140156569-140156591 ACCCATGTGGCCACCACCAGTGG - Intergenic
1198956518 X:142137128-142137150 ACCCCTGTGGCCACCACTACTGG - Intergenic
1199037155 X:143064494-143064516 ACCCCAGTGGCCACCACTACTGG - Intergenic
1199191921 X:144980884-144980906 ACACCTGTGTTCACCACTCCTGG - Intergenic
1199316162 X:146380091-146380113 ACCCCTGTGGCCACCACCACTGG - Intergenic
1199455084 X:148019813-148019835 ACCACTGAGGCCACCACCACTGG + Intronic
1200462976 Y:3479911-3479933 ACCCCTGTGGTCAACATCACTGG - Intergenic
1200536047 Y:4398647-4398669 AACCCTGTGGGCACCACCAAAGG - Intergenic
1200542464 Y:4476895-4476917 ATTGCTGTGGCCACCACCACAGG + Intergenic
1200608490 Y:5296406-5296428 ACCTCTGTGGCCACTACCACTGG + Intronic
1200648913 Y:5817084-5817106 ACCCCCATGGCCACCACCACTGG + Intergenic
1201372349 Y:13278977-13278999 ACCCTTGTGGCCATCACCACAGG - Intronic
1201776141 Y:17668181-17668203 GCTACTGTGGACTCCACCACTGG - Intergenic
1201792402 Y:17856734-17856756 CTTCCAGTGGTCGCCACCACTGG - Intergenic
1201792770 Y:17860197-17860219 CCTTCAGTGGTCACCACCACTGG + Intergenic
1201808784 Y:18045789-18045811 CCTTCAGTGGTCACCACCACTGG - Intergenic
1201809152 Y:18049252-18049274 CTTCCAGTGGTCGCCACCACTGG + Intergenic
1201825415 Y:18237811-18237833 GCTACTGTGGACTCCACCACTGG + Intergenic
1202093391 Y:21217540-21217562 ACCCCTGTGTCCACCACCCCGGG - Intergenic
1202353939 Y:24025982-24026004 CTTCCAGTGGTCGCCACCACTGG - Intergenic
1202354305 Y:24029447-24029469 CCTTCAGTGGTCACCACCACTGG + Intergenic
1202516474 Y:25640665-25640687 CCTTCAGTGGTCACCACCACTGG - Intergenic
1202516840 Y:25644130-25644152 CTTCCAGTGGTCGCCACCACTGG + Intergenic
1202576259 Y:26328982-26329004 ACTCCTGTGCTCTCCATTACTGG - Intergenic