ID: 1187836317

View in Genome Browser
Species Human (GRCh38)
Location X:23435616-23435638
Sequence TGGTGATAGACGCACTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187836317_1187836323 24 Left 1187836317 X:23435616-23435638 CCACAGGAGTGCGTCTATCACCA No data
Right 1187836323 X:23435663-23435685 CACAGAGAAAGAGACTGTTTAGG No data
1187836317_1187836318 -7 Left 1187836317 X:23435616-23435638 CCACAGGAGTGCGTCTATCACCA No data
Right 1187836318 X:23435632-23435654 ATCACCACTGTCCCAACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187836317 Original CRISPR TGGTGATAGACGCACTCCTG TGG (reversed) Intergenic
No off target data available for this crispr