ID: 1187836318

View in Genome Browser
Species Human (GRCh38)
Location X:23435632-23435654
Sequence ATCACCACTGTCCCAACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187836312_1187836318 19 Left 1187836312 X:23435590-23435612 CCTCAGTACAGTCCCAGTGGTGG No data
Right 1187836318 X:23435632-23435654 ATCACCACTGTCCCAACTCCAGG No data
1187836316_1187836318 6 Left 1187836316 X:23435603-23435625 CCAGTGGTGGTGACCACAGGAGT 0: 3
1: 25
2: 116
3: 255
4: 473
Right 1187836318 X:23435632-23435654 ATCACCACTGTCCCAACTCCAGG No data
1187836317_1187836318 -7 Left 1187836317 X:23435616-23435638 CCACAGGAGTGCGTCTATCACCA No data
Right 1187836318 X:23435632-23435654 ATCACCACTGTCCCAACTCCAGG No data
1187836315_1187836318 7 Left 1187836315 X:23435602-23435624 CCCAGTGGTGGTGACCACAGGAG 0: 3
1: 29
2: 130
3: 290
4: 1260
Right 1187836318 X:23435632-23435654 ATCACCACTGTCCCAACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187836318 Original CRISPR ATCACCACTGTCCCAACTCC AGG Intergenic
No off target data available for this crispr