ID: 1187836319

View in Genome Browser
Species Human (GRCh38)
Location X:23435636-23435658
Sequence GCTGCCTGGAGTTGGGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187836319_1187836324 19 Left 1187836319 X:23435636-23435658 CCACTGTCCCAACTCCAGGCAGC No data
Right 1187836324 X:23435678-23435700 TGTTTAGGAATAACTCTGCCTGG No data
1187836319_1187836323 4 Left 1187836319 X:23435636-23435658 CCACTGTCCCAACTCCAGGCAGC No data
Right 1187836323 X:23435663-23435685 CACAGAGAAAGAGACTGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187836319 Original CRISPR GCTGCCTGGAGTTGGGACAG TGG (reversed) Intergenic
No off target data available for this crispr