ID: 1187836320

View in Genome Browser
Species Human (GRCh38)
Location X:23435643-23435665
Sequence GTGCTGAGCTGCCTGGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1381
Summary {0: 5, 1: 73, 2: 194, 3: 307, 4: 802}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187836320_1187836323 -3 Left 1187836320 X:23435643-23435665 CCCAACTCCAGGCAGCTCAGCAC 0: 5
1: 73
2: 194
3: 307
4: 802
Right 1187836323 X:23435663-23435685 CACAGAGAAAGAGACTGTTTAGG No data
1187836320_1187836324 12 Left 1187836320 X:23435643-23435665 CCCAACTCCAGGCAGCTCAGCAC 0: 5
1: 73
2: 194
3: 307
4: 802
Right 1187836324 X:23435678-23435700 TGTTTAGGAATAACTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187836320 Original CRISPR GTGCTGAGCTGCCTGGAGTT GGG (reversed) Intergenic
900377184 1:2360387-2360409 GTCCTGAGTTGCCTGGTGTCCGG - Intronic
901063208 1:6483239-6483261 GGGCTGATCTGCATGGAGCTGGG + Intronic
901219620 1:7575969-7575991 GTGCTGAGCCTCCTGCAGTCAGG - Intronic
903949098 1:26983989-26984011 TTGCTGTGCAGCCTGGAATTGGG - Intergenic
906060151 1:42943260-42943282 GTGCTTGGCTCCCTGCAGTTTGG - Exonic
906294769 1:44642833-44642855 CTGCTGAGCTGCGTGTACTTGGG + Intronic
906940750 1:50253091-50253113 GTGCAGAGGTGCAGGGAGTTGGG - Intergenic
907004140 1:50893558-50893580 GTACTGAGTTGCTTGGAGCTGGG + Intronic
907023878 1:51095622-51095644 GTGCTGAGGTGCCTATAGCTGGG - Intergenic
907261576 1:53222272-53222294 GAGCTGTGCTGCCTGGGGTTGGG - Intergenic
907261709 1:53223029-53223051 ATGCTGAGCTGCCTGGAGTTGGG - Intergenic
907565491 1:55430071-55430093 ATGCTCAGCAGCCTGGAGTTGGG + Intergenic
907868695 1:58423535-58423557 GTGCTGCTCTGCTTGGAGGTCGG - Intronic
908024810 1:59939453-59939475 GTTCCAAGCTGCCTAGAGTTGGG + Intergenic
908175460 1:61551733-61551755 GTGCTGAGCTGTCTGGAGCTGGG + Intergenic
908302191 1:62773418-62773440 GTGCTGAGATGCCTGGAGCTGGG + Intergenic
908599048 1:65719275-65719297 GAGCTGAGCAGCCTGGGTTTAGG + Intergenic
908907929 1:69037897-69037919 ATGCTGTGCAGCCTGGAGTTAGG - Intergenic
909084392 1:71154544-71154566 GTGCTAAGCTGCCTTAAGCTGGG + Intergenic
909245654 1:73279309-73279331 GGGTTGTGCTGCCTGGGGTTGGG - Intergenic
909582571 1:77254229-77254251 ATGCTGGGCTGCCTGGAGTTGGG - Intergenic
909615813 1:77606613-77606635 GTGCTGAGCTGCTTGGGGCTGGG - Intronic
909642413 1:77883427-77883449 CTGCTGTGCAGCCTGGGGTTTGG + Intergenic
909782034 1:79559250-79559272 GTTCTGAACCACCTGGAGTTGGG - Intergenic
909848715 1:80433535-80433557 GTGCTGAGCCACCTGGAAATGGG + Intergenic
910102427 1:83593417-83593439 GTGCTGAGCTGCCTGGAGCTGGG + Intergenic
910289901 1:85589457-85589479 GTGCTGAGCCACCTGGGGCTTGG - Intergenic
910349180 1:86276896-86276918 GTTCTGAGCCACCTGGAGCTGGG + Intergenic
910349370 1:86277949-86277971 GAGCTGTGCAGCCTGGGGTTGGG + Intergenic
910470307 1:87546326-87546348 GTGCTGAGCTTCCTGGAGCTGGG + Intergenic
910515268 1:88053793-88053815 CCGCTGAGCTGTCTGGAGCTGGG + Intergenic
910515455 1:88054877-88054899 AAGCTGAGCTGCCTGGGATTAGG + Intergenic
910560331 1:88582786-88582808 GTGCTGAGTCACCTGGAGCTGGG - Intergenic
910639652 1:89446215-89446237 GTGCTGAGCCACCTGGAGCTAGG + Intergenic
910725029 1:90328864-90328886 GTGCTGAGCTGCCTGGAGGGGGG - Intergenic
910818996 1:91325431-91325453 GTGCTGAGCCACTTGGAATTGGG - Intronic
911012537 1:93296698-93296720 GAGCTGTGCTAACTGGAGTTGGG + Intergenic
911019692 1:93374409-93374431 GAGCTGTGCTGCCTTGGGTTAGG + Intergenic
911019980 1:93376082-93376104 ATGCTGAGCTGCGTGGAGCTGGG - Intergenic
911239456 1:95449341-95449363 GAGCTACGCTGCCTGGGGTTTGG + Intergenic
911343878 1:96673702-96673724 GTGCTCAGCTGCCTAGAGCAGGG + Intergenic
911487274 1:98517039-98517061 GTTCTGAGCTGCCTAGAACTGGG - Intergenic
911666352 1:100557387-100557409 GAGCTGTACTGCTTGGAGTTGGG + Intergenic
911666416 1:100557794-100557816 GGGCTGCACTGCCTGCAGTTGGG + Intergenic
911981242 1:104569175-104569197 GTGCTGAACTACCCGGAGATTGG - Intergenic
912015447 1:105028127-105028149 GTGCTGAGCTCCCTGAATCTGGG - Intergenic
912102762 1:106232522-106232544 GAGCTGTGCTGCCTGGGGTAGGG + Intergenic
912127428 1:106555944-106555966 GTGTTAAGCTACCTGGAGCTGGG - Intergenic
912152870 1:106880857-106880879 GTGCTGAGCCACCTGGAACTGGG - Intergenic
912242776 1:107928043-107928065 GTTCTGAGCCACCTGGAGCTGGG - Intronic
912453620 1:109783391-109783413 GTGCTGAGCTTGCAGGTGTTGGG + Intergenic
912598483 1:110903324-110903346 GAGCTGTGCAGCCTGGGGTTAGG - Intergenic
912723051 1:112036035-112036057 GTGCTGGGCTTCTTGAAGTTTGG - Intergenic
912871462 1:113310829-113310851 GAGCTGAGCTGCCTGGGGTTGGG - Intergenic
912906689 1:113714901-113714923 GTGCTGAGCTGCTTGGAGCCAGG - Intronic
913042472 1:115040877-115040899 GTGCTGCACTGCCTGGGGTTGGG - Intergenic
913042530 1:115041276-115041298 TTGCTGCACTGCCTGGAGTTGGG - Intergenic
913146965 1:116002210-116002232 ATGCTGAGCTCCCTGGAGTTAGG + Intronic
914676478 1:149910541-149910563 GGGCTGAGCTGCATGGGGTGGGG - Intronic
915186161 1:154106636-154106658 CTGCTAAGCTGTCTGGAGCTGGG - Intronic
915312938 1:155013572-155013594 GTGCAGAGCAGCCAGGAGGTGGG - Intronic
915638750 1:157204848-157204870 ATGTTTAGCTTCCTGGAGTTGGG + Intergenic
915693520 1:157715726-157715748 GTGCTGTGCCGCCTGGATCTGGG + Intergenic
915777495 1:158506721-158506743 GCACTGGGTTGCCTGGAGTTGGG + Intergenic
916341720 1:163744590-163744612 GTGCTGAGCTGCCTGATTTTGGG + Intergenic
916641051 1:166729467-166729489 ATGGAGAGCTGCCTGGAGTCTGG + Intergenic
916769033 1:167890425-167890447 GTGCTGAGCTGCTTGGAGCTGGG + Intronic
916993240 1:170267518-170267540 AAGCTGTGCTGCCTGGGGTTGGG + Intergenic
917306381 1:173628910-173628932 GTGCTGAGCTGCCTAGAACTGGG - Intronic
917376437 1:174352946-174352968 GTGCTGAGCTACCTGGTGTTTGG + Intronic
917377497 1:174365075-174365097 GAGCTTCACTGCCTGGAGTTGGG + Intronic
917404986 1:174696326-174696348 AAGCTGCCCTGCCTGGAGTTGGG + Intronic
918018629 1:180663509-180663531 GTGCTGAGGTGCCTGGAGCTTGG + Intronic
918088908 1:181270796-181270818 GTTCTTAGCTTCCTTGAGTTGGG + Intergenic
918476129 1:184927520-184927542 GTGTTGAGCTGCCTGGAGCTGGG + Intronic
918915652 1:190633847-190633869 GTGCCAACCTGCCTGGAGCTGGG + Intergenic
918989830 1:191684530-191684552 GTGCTGAGCAACCTGGACTGGGG + Intergenic
919283770 1:195526408-195526430 GAGCTTTGCTGCTTGGAGTTGGG - Intergenic
919325272 1:196099551-196099573 GAGCTGTGCAGCCTGGGGTTAGG - Intergenic
919336744 1:196244978-196245000 GTGCTGACCTGCCTGGAGCTGGG - Intronic
919511622 1:198472410-198472432 GTGCTGAGCTGCCTGGAGCTGGG - Intergenic
919514976 1:198511360-198511382 GGTCTGTGCTGCCTGGGGTTGGG + Intergenic
919598982 1:199599679-199599701 TTGCTGGGCTCCCTGGGGTTGGG - Intergenic
920594827 1:207258863-207258885 ATGCTGAGCTGTCTGGAGCTGGG + Intergenic
920596661 1:207279109-207279131 GTGCTGAGCTGCCTGGAGTTAGG + Intergenic
920953713 1:210598277-210598299 GAGCTATGCTGCCTGGGGTTGGG + Intronic
921147076 1:212368006-212368028 GCTCTGAGTTGCCTGGAGTTGGG - Intronic
921217012 1:212946527-212946549 GTCCTGAGGTGCCTGGAGGCAGG + Intergenic
921746352 1:218744143-218744165 ATGCTGAGCTGCCTAGTGCTGGG - Intergenic
921823237 1:219641214-219641236 GTGCTGAGCTGCCTAGAGCTGGG - Intergenic
921929244 1:220741885-220741907 GTGCTGAGCTGCTTGGAGTTGGG + Intergenic
922226076 1:223646952-223646974 TGGCTGAGCTGCCTGAGGTTTGG - Intronic
922320373 1:224481619-224481641 GTGCTGAGATACCTGGAGCTGGG + Intronic
922357990 1:224795045-224795067 ATGCTGAGCTGCCTGGAGTTCGG + Intergenic
922388615 1:225114434-225114456 GAGCTGTGCTGCCTGGGGTTGGG + Intronic
922396784 1:225210223-225210245 TTGCTGGGCTCCCTGGGGTTGGG - Intronic
922725269 1:227920117-227920139 GCACTGAGCTGCCTGGAGGCCGG + Exonic
923059570 1:230458287-230458309 GTGGGGAGCTTCCTGGGGTTAGG - Intergenic
923328201 1:232898977-232898999 GGGATGAGCTGCCTGCAGATAGG + Intergenic
923752657 1:236760638-236760660 GTTCTGAGCTGCCTTCAGTTTGG + Intronic
924193727 1:241583161-241583183 ATGCTAGGCTGCCTGGAGTTGGG + Intronic
924204861 1:241701572-241701594 GTTCTGGGCTTCCTGGAATTTGG + Intronic
924481524 1:244439594-244439616 ATGCTGTGCTGCCTGCGGTTGGG + Intronic
924490696 1:244535131-244535153 GTGCTGAGCTGCCTGGAGCTGGG + Intronic
924490873 1:244536205-244536227 GAGCTGTGCTGCCTAGTGTTGGG + Intronic
924516068 1:244767587-244767609 GTGCTGAGCTGCCTGGAGCTGGG + Intergenic
924629191 1:245721219-245721241 GAGCTGTGCTGCCTGGGGTTGGG - Intergenic
924629319 1:245721929-245721951 GTGCTGAGCTACCTGGAGTTGGG - Intergenic
1063663202 10:8047789-8047811 GAGCTGAGCTGCCCGGAGGGAGG + Intergenic
1064601024 10:16992984-16993006 GAGCGGTGCTCCCTGGAGTTGGG - Intronic
1064696863 10:17975616-17975638 GAGCTGTGCAGCCTGGGGTTAGG + Intronic
1064987394 10:21225252-21225274 GTGCTTAGCTCCATGGAGCTGGG + Intergenic
1065228412 10:23571212-23571234 ACACTGTGCTGCCTGGAGTTGGG - Intergenic
1065988430 10:30981261-30981283 GGGGTGAGCAGCCTGGAGTAAGG - Intronic
1066659776 10:37728117-37728139 GTGCTGCACTGCCTGCAGTGGGG + Intergenic
1067223266 10:44359119-44359141 GTGCAAAGGTGCCTGGACTTTGG + Intergenic
1067809804 10:49417906-49417928 GTGCTGGGCTGCCTGGTGGGTGG - Intergenic
1068008860 10:51422491-51422513 TGGAGGAGCTGCCTGGAGTTGGG - Intronic
1068447870 10:57146528-57146550 ATGCTGTGCTGCCTGCATTTAGG - Intergenic
1068713021 10:60155218-60155240 ATGCTGTGCTGCCTGGGGCTGGG - Intronic
1068713154 10:60156163-60156185 GAGCTGCACTGCCTGGAATTGGG - Intronic
1069343604 10:67440610-67440632 GTGCTGAGCTGCCTGCATCTGGG - Intronic
1069391844 10:67944231-67944253 ATGCTGAGCTCTCTGGAGCTGGG - Intronic
1069933659 10:71900503-71900525 GAGCTGTGCAGCCTGGGGTTAGG + Intergenic
1070059264 10:72966942-72966964 GTGCTGGGCTGCCTGGAACTGGG + Intergenic
1070680755 10:78447532-78447554 GAGGTGAGCTTGCTGGAGTTAGG + Intergenic
1071046588 10:81386939-81386961 GTTCTGAGCAACCTGGAGCTGGG + Intergenic
1071243478 10:83736859-83736881 ATACTGGGCTGCCTGGGGTTGGG + Intergenic
1071935412 10:90525643-90525665 GTGCTGAGCTGTCTGGAGCTGGG + Intergenic
1071963110 10:90825097-90825119 GTGTTGAGTTGCCTGGAGCTGGG - Intronic
1072058905 10:91788804-91788826 GTGCTGAGCTGCCTGGAGCTGGG - Intergenic
1072083545 10:92056775-92056797 GAGCTGTGCAGCCTGGGGTTAGG - Intronic
1072492207 10:95919508-95919530 ATGCTGAGCTGCCTGGAGTTGGG + Intronic
1072492437 10:95920960-95920982 GAGCTGTACTGCCTGAAGTTGGG + Intronic
1072862633 10:99022548-99022570 GAGCTGTGCAGCCTGGGGTTAGG - Intronic
1072877796 10:99191388-99191410 GTGCTGAGCTGCCTTGAGATAGG - Intronic
1073103361 10:101018679-101018701 GGTCTGAGCAGCCTGGAGCTTGG + Intronic
1073708084 10:106010069-106010091 GTTCTGAGCCGCCTTGAGCTGGG + Intergenic
1074302040 10:112241838-112241860 GTGCTGAGCTGCCTGGAGCCGGG + Intergenic
1074302227 10:112242881-112242903 AAGCTGTGCTGCCTGGGGTTGGG + Intergenic
1074383022 10:112995566-112995588 GTTCTGAGCTGCCTGATGTGGGG - Intronic
1074408590 10:113202425-113202447 GTGCTGAACTGACTGGAGCTGGG - Intergenic
1075195051 10:120348921-120348943 GTTCTCAGCTGCCTGGAGTTAGG - Intergenic
1075496322 10:122922517-122922539 GAGCTGTGCTGCCTGGGGTTGGG - Intergenic
1075496488 10:122923564-122923586 CTGCTGAGCTGTCTGGAGTTGGG - Intergenic
1075716009 10:124555636-124555658 GTCCTGCGCTGCCTGGTGTGCGG + Intronic
1075733378 10:124649472-124649494 CTGCTGACTTGCCTGGAGGTGGG - Intronic
1075830474 10:125406941-125406963 GTGCTGAGCTTCCTGGAGCTGGG + Intergenic
1076492707 10:130873869-130873891 GTGTTGAGCTGCCAGGAGCAAGG + Intergenic
1076874976 10:133211382-133211404 CTGCTGAGCTGCCAGGATGTGGG - Intronic
1077393241 11:2309341-2309363 ATGCTGACCTGCCTGGAGGAGGG + Intronic
1077730154 11:4721915-4721937 ATGCTGAGATGCCTGGAGACTGG - Intronic
1077858808 11:6157165-6157187 GAGCTGTGCTGCCTGGGGTTGGG - Intergenic
1078180550 11:9006404-9006426 GAGCTGAGCAGCCTGGAGAGTGG - Intergenic
1078244592 11:9562833-9562855 GTGCTGAGCTGCCTGGAGATGGG + Intergenic
1078992760 11:16665818-16665840 GTGATGAGCTGCTTGGATTTGGG - Intronic
1079293054 11:19205912-19205934 GTTCTGAGCTACTGGGAGTTAGG + Intronic
1079473949 11:20808459-20808481 GAGCTGCACTGCCTGGGGTTGGG + Intronic
1079565791 11:21880360-21880382 ATGCTGAGCTGCCTTGAGCTGGG - Intergenic
1079590221 11:22174583-22174605 GTTCTGACCTGCAAGGAGTTGGG + Intergenic
1079747785 11:24155192-24155214 ATGGAGAGCTGCCTGGAGTATGG + Intergenic
1080096949 11:28419271-28419293 ATGCTGAGCTGCCTGGAGCTGGG - Intergenic
1080351240 11:31387378-31387400 GTGCTAAGCTGCCTGGAGCTGGG - Intronic
1080489716 11:32750210-32750232 GTGCTGAGCTTCCTGGAGTTGGG + Intronic
1080796510 11:35568370-35568392 ATGCTGAGCTGCCTGGAGTTAGG - Intergenic
1081049274 11:38316644-38316666 GTGCTGAATTGCTTGGAGCTGGG - Intergenic
1081555470 11:44157098-44157120 GTGATGAGCTGCCTAGAACTGGG + Intronic
1081897683 11:46600699-46600721 GTGCTGAGCTGGCTGAACATTGG - Intergenic
1082721238 11:56679568-56679590 GAGCTGTGCTGCCCGGAGTTGGG - Intergenic
1082823753 11:57562605-57562627 GTGCTGAGCTCCCTGGAGCTGGG - Intronic
1083528712 11:63397246-63397268 ATACTGAGCTGCCTCGAGCTGGG + Intronic
1084008931 11:66337144-66337166 GCGCTGGGCTGCCTGGCGCTGGG - Intergenic
1084761217 11:71272373-71272395 GTGCTAAGCCACCTGGAGTGGGG - Intergenic
1084763730 11:71294031-71294053 GTGCTGAACTGCCTGGAGCTGGG + Intergenic
1085025770 11:73235688-73235710 GAGCTGAGCTACCTGGGGTGGGG + Exonic
1085147442 11:74213609-74213631 GTGCTGAGCTTCCTGGAGCTGGG - Intronic
1085178565 11:74511899-74511921 GTGCTGAGCTGCCTGGGGCTTGG - Intronic
1085572005 11:77568175-77568197 GTACTGAACTTCCTGGAGCTGGG + Intronic
1085686861 11:78631362-78631384 GTGTTTCACTGCCTGGAGTTGGG + Intergenic
1086028684 11:82326809-82326831 ATGCTGGGCTGCCTGGGGTTGGG - Intergenic
1086249643 11:84798040-84798062 GCGCTGAGCCACCTGGAGCTGGG + Intronic
1086277249 11:85146262-85146284 CTCCTGAGCTTCCTGGAGTTGGG + Intronic
1086305817 11:85481480-85481502 TCCCTGTGCTGCCTGGAGTTGGG - Intronic
1087031900 11:93714863-93714885 GTGCTGAGCTGCCTGGAGCTGGG + Intronic
1087032086 11:93715930-93715952 GAGCTGTGCTGCCTGGGATTAGG + Intronic
1087345429 11:96965287-96965309 GTGCTTAGCTGCCTGGTATTGGG - Intergenic
1087350195 11:97020977-97020999 GTGCTGTGCTACCTGGACCTGGG - Intergenic
1087359167 11:97136402-97136424 AGGCTGAACTGCCTGGATTTGGG + Intergenic
1087381332 11:97408760-97408782 TTGCTGTGCTGCCTGGGGCTGGG - Intergenic
1087472869 11:98600227-98600249 TTGCTGAGCTGCCTAGAGCTGGG + Intergenic
1087598275 11:100282451-100282473 GTTCTGAGCCACCTGGAGCTGGG + Intronic
1087871318 11:103296058-103296080 GTGCTGTGCTGCCTGTGGTTGGG + Intronic
1087874430 11:103339189-103339211 ATGCTTGGCTGCCTTGAGTTGGG + Intronic
1087874499 11:103339613-103339635 GCACTGCGTTGCCTGGAGTTGGG + Intronic
1087887519 11:103497510-103497532 AAGCTGCACTGCCTGGAGTTTGG - Intergenic
1088154738 11:106789871-106789893 GTGCTGAGCCACCTGGGGCTTGG + Intronic
1088181936 11:107122164-107122186 ATGCTTAGCTGCTTGGAGCTGGG - Intergenic
1088938106 11:114425313-114425335 GTGCTGAGCCACCTGGAGCTGGG + Intronic
1088944381 11:114495081-114495103 ATGCTGAGTTGCCTGGAGCTGGG + Intergenic
1088960779 11:114662597-114662619 GAGCTGTGCAGCCTGGAATTAGG - Intergenic
1089678596 11:120107044-120107066 GTGTGGACCTGCCTGGAGTGGGG - Intergenic
1089762080 11:120735407-120735429 GTGCTTAGCCACCTGGAGCTGGG + Intronic
1090676783 11:129006601-129006623 GTGATAAGCTACCTGGAGCTGGG + Intronic
1091610509 12:2004074-2004096 CTGTGGAGCTACCTGGAGTTGGG - Intronic
1092403439 12:8197475-8197497 AAGCTGTGCTGCCTGGGGTTGGG + Intergenic
1092476969 12:8827976-8827998 GTGCTGAGCTGCCTGGAGAGAGG + Intronic
1092828939 12:12425152-12425174 GTGCGTAGCTGCCTGCAGTGGGG + Intronic
1092901857 12:13067198-13067220 GTGGTGAGCTGTCTCGATTTTGG - Exonic
1093259399 12:16917248-16917270 ATGCTGAGTTGCCTGAAGCTGGG + Intergenic
1093259560 12:16918331-16918353 GAGCTCCGCTGCCTGGGGTTGGG + Intergenic
1093419921 12:18963972-18963994 GTGCTGAGCTGCCTGGAGCTGGG + Intergenic
1093538307 12:20248678-20248700 GTGCTGAGCCTCCTGGACTTGGG - Intergenic
1093581689 12:20790830-20790852 GAGCTGCACTGCCTGCAGTTGGG + Intergenic
1093588503 12:20871741-20871763 GTGCTGAGCTGCCAGAAACTGGG + Intronic
1093608002 12:21118044-21118066 GTGCTAAGCTGCTTGGAGCTGGG + Intronic
1093931919 12:24962114-24962136 GTGCTGAGCCGCCTGGAGCTGGG - Intergenic
1094618869 12:32060867-32060889 GGTCTGGGCTGCCTGGGGTTGGG + Intergenic
1095133579 12:38571628-38571650 GAGCTGAGCAGCCTGGGCTTAGG - Intergenic
1095163436 12:38942470-38942492 GTTCTGAGCTGCCTGAATCTGGG - Intergenic
1095181601 12:39153421-39153443 CTGATGAGCTCCCTGGAGCTGGG + Intergenic
1095307111 12:40651499-40651521 GTGGTCAGCCACCTGGAGTTGGG + Intergenic
1095511610 12:42956777-42956799 TTGCAGAGCTTCTTGGAGTTTGG - Intergenic
1095808031 12:46342846-46342868 ATGCTGAGCTGCCTGGAACTAGG + Intergenic
1095860352 12:46909185-46909207 GTGCTGGGCTGCATGGAGCTGGG - Intergenic
1095939276 12:47715645-47715667 AAGCCCAGCTGCCTGGAGTTGGG + Intronic
1095967578 12:47879221-47879243 TTGCTGAGCTCCCTGGTGGTGGG - Intronic
1096941984 12:55356456-55356478 GTTCTGAGCTTCCTTGTGTTGGG - Intergenic
1096959003 12:55558967-55558989 GTGGTGTGCTGCCTGGGGTTGGG - Intergenic
1097425933 12:59445281-59445303 GTGTTGAGCTGCCTGGAACTGGG + Intergenic
1097466367 12:59929361-59929383 ATGCTGAGCTGCCTGGAGTTGGG - Intergenic
1097508739 12:60508360-60508382 GTGATCAGCTGCCTGGAACTAGG - Intergenic
1097770046 12:63572705-63572727 GTGCTAAGCTGCCTGGAGCTGGG - Intronic
1097791278 12:63818014-63818036 AAGCTGTGCAGCCTGGAGTTAGG - Intergenic
1097899332 12:64857536-64857558 GAGCTGCACTGCCTGGGGTTGGG + Intronic
1098060438 12:66555178-66555200 GTGCTGAGCCACCTGGAGATGGG - Intronic
1098207984 12:68133044-68133066 GAGCTGTGCAGCCTGGTGTTAGG + Intergenic
1098648962 12:72940769-72940791 GTGCTAAACTGCCTGGAGCTGGG + Intergenic
1098959140 12:76719895-76719917 GTGTTGAGCTACCTGGAGTTAGG - Intergenic
1098975244 12:76895706-76895728 ATGCTGCACTGCCTAGAGTTGGG - Intergenic
1098975308 12:76896110-76896132 GAGCTGCGCTGCCTGGAATTGGG - Intergenic
1098975377 12:76896526-76896548 ATGCTGAGCTGCCTGGAGTTGGG - Intergenic
1099024447 12:77447944-77447966 GAGCTGTGCTGCCTGAGGTTGGG - Intergenic
1099024605 12:77448967-77448989 GTGCTGAGCTGCCTGGAGCTGGG - Intergenic
1099428666 12:82553966-82553988 GTCCTGTGCTGCCTGGGCTTTGG + Intergenic
1099491486 12:83293284-83293306 TGTCTGAGCTGCCTGGAGCTGGG - Intergenic
1099523434 12:83690911-83690933 CTGCTGAACTGCCTGGAGCCTGG - Intergenic
1099992334 12:89737347-89737369 CTGCTGAGCTGCCTGGGGCTGGG - Intergenic
1100832778 12:98532964-98532986 TTTCTTAGCTGCCTGTAGTTCGG - Exonic
1100909065 12:99337886-99337908 GTGCTGAGCTGCCTGGAGATAGG + Intronic
1101167320 12:102052227-102052249 ATGCTGTGCTGCCTGGAGTTGGG - Intronic
1101251857 12:102945136-102945158 GTGCTGAGCTGTCTGGAGCTGGG + Intronic
1101607422 12:106258235-106258257 AAGCTGTGCTGCCTGGGGTTTGG - Intronic
1102079438 12:110086121-110086143 GAGCTGAGGGGCCAGGAGTTCGG + Intergenic
1102266619 12:111491472-111491494 GAGCTGTGGTACCTGGAGTTGGG - Intronic
1102266725 12:111492147-111492169 GTGCTGAGCTGCTTGGAGTTTGG - Intronic
1102487676 12:113269148-113269170 CTGCTGAGCTGCCTGCATTTGGG - Intronic
1102519893 12:113471666-113471688 GCGCTGGGCTGCCCGGAGTGGGG + Exonic
1103073057 12:117960651-117960673 TTGCTCAGATGCCTGCAGTTAGG - Intronic
1103836102 12:123822328-123822350 GTGCTGTGCTGGTTGGAGTGTGG + Intronic
1103948085 12:124538150-124538172 AGGCTGAGCTGGCTGGGGTTGGG - Intronic
1105273475 13:18900099-18900121 GCACTGCACTGCCTGGAGTTGGG - Intergenic
1105558914 13:21472644-21472666 GTGCTGAGCTCCCTGGAGCTGGG + Intergenic
1106074893 13:26449353-26449375 GTACTGAGCTGCCTGGATCTGGG - Intergenic
1106855339 13:33846137-33846159 ATGCTGAGTTGCCTGGAGCTAGG + Intronic
1107524091 13:41213403-41213425 GTGCTGAGCCGCCTGGAACTGGG + Intergenic
1107524265 13:41214367-41214389 GAGCTGCACTGCCTGGGGTTGGG + Intergenic
1107552093 13:41486968-41486990 GTTCTGAGCCACCTGGAGCTAGG + Intergenic
1107582251 13:41802939-41802961 ATGCTCAGCTGTCTGGAGTTGGG - Intronic
1108138117 13:47386771-47386793 GTGCTAAGCTGCCTGGAGCTGGG - Intergenic
1108332536 13:49404162-49404184 TTGCTGAGCTGCCTACAGTTCGG - Intronic
1108816704 13:54301434-54301456 GTGCTGCATTGCCTGGAGTTGGG + Intergenic
1108879060 13:55087009-55087031 GTATTGAGCCGCCTGGAGCTAGG + Intergenic
1108890019 13:55245322-55245344 TGGCTAGGCTGCCTGGAGTTGGG - Intergenic
1108962242 13:56248209-56248231 GTGCTGACCTGCCTAGAGCTAGG + Intergenic
1109100604 13:58180241-58180263 GTATTGAGCTGCTTGGAGCTGGG + Intergenic
1109480918 13:62951028-62951050 GTGGTGAGCTGCATGCAGGTAGG + Intergenic
1109554586 13:63955463-63955485 GAGCTGCATTGCCTGGAGTTGGG + Intergenic
1109942228 13:69385150-69385172 ATGCTCTGCTGCCTGAAGTTAGG - Intergenic
1109961541 13:69638576-69638598 GTGCTAAGCTGCCTGGAGCTTGG + Intergenic
1110078829 13:71286067-71286089 TTTCTGAGCTGCCTGGAACTAGG + Intergenic
1110132905 13:72029177-72029199 TTGCTGTGCTGCCTGGGTTTGGG - Intergenic
1110274269 13:73626114-73626136 GTGCAGAGCTTCCTGTAGATTGG + Intergenic
1110376836 13:74803354-74803376 GTGCTGAGCTGCCTGTAACTGGG - Intergenic
1110448660 13:75617266-75617288 GTTTTGAGCTGCCTGGAGCTGGG + Intergenic
1110885977 13:80636424-80636446 GTGCTGAGCTTCCTGGAGCTGGG + Intergenic
1111303343 13:86373525-86373547 ATGCTGAGCTGTCTGGAGCTGGG + Intergenic
1111365285 13:87234968-87234990 GAGCTGTGCTGCTTGGGGTTAGG + Intergenic
1111542819 13:89690235-89690257 GTGCTGAGCCACCTGGAACTGGG - Intergenic
1111568685 13:90049061-90049083 CTGCTATGCTGCCTGGAGTTGGG + Intergenic
1111572123 13:90103215-90103237 GAGCTGTGCTGCCTGGTATTGGG + Intergenic
1111639242 13:90946984-90947006 GAGATGCGCTGCCTGGGGTTGGG - Intergenic
1111639431 13:90948070-90948092 ATGCTGAGCTGCCTGGAACCGGG - Intergenic
1112741042 13:102472735-102472757 GTGGCAAGCTGCCTGGAGTGTGG + Intergenic
1112861029 13:103829943-103829965 TTGCTGAGCTCCCTGGGGGTGGG + Intergenic
1113212827 13:108002704-108002726 GTGCTAAACTACCTGGAGCTAGG + Intergenic
1113217726 13:108061618-108061640 GTGCTGAGCTCCCTGAACCTGGG - Intergenic
1113244126 13:108376329-108376351 TTGCTGAGCTGCCTGGAGCTGGG + Intergenic
1113312130 13:109141265-109141287 CTGCTGAGAGGCCTGGAGCTGGG - Exonic
1113427790 13:110223872-110223894 GTACTGACCTGCCAAGAGTTGGG + Intronic
1114248007 14:20933025-20933047 GAGCTGTGCTGCCTGGGGTTGGG - Intergenic
1114250841 14:20959124-20959146 GAGCTGTGCTGCCTGGGGTTGGG - Intergenic
1114783633 14:25569610-25569632 GTGCTGAGCCACCTGGAACTTGG + Intergenic
1114820307 14:26010037-26010059 GAGCTGCCCTGCCTGGGGTTGGG - Intergenic
1114820365 14:26010449-26010471 ATGCTGAACTGCCTGGATTTGGG - Intergenic
1114985034 14:28216764-28216786 TTGCTGAGCTGCCTTGAACTGGG + Intergenic
1115661125 14:35495046-35495068 GTGCTGAGCTTCCTGGAGCTGGG - Intergenic
1115918301 14:38342402-38342424 GAGCTTCACTGCCTGGAGTTGGG - Intergenic
1115925202 14:38425448-38425470 GGGCTGCACTGCCTGGGGTTGGG + Intergenic
1115930136 14:38482181-38482203 GAGCTGCACTGCCTGGAGTCGGG - Intergenic
1116086940 14:40253164-40253186 TTGCTGAGCTGTCTGGAGTTGGG + Intergenic
1116106550 14:40514680-40514702 GTGCTGAGCAGCCTGGAGCTGGG - Intergenic
1116115647 14:40646523-40646545 GAGCAGAGCTGCCTTGGGTTAGG + Intergenic
1116192529 14:41679306-41679328 TAGCTGTGCTGCCTGGTGTTAGG - Intronic
1116269397 14:42741998-42742020 GAGCTGTGCAGCCTGGAGTTAGG - Intergenic
1116392807 14:44413750-44413772 GTGCTGAGCTTCCTGGAGCTGGG - Intergenic
1116413326 14:44650387-44650409 GTGCTGAGCTGCCTGGAACTTGG - Intergenic
1116422083 14:44744688-44744710 GAGCTGTGCAGCCTGGGGTTAGG - Intergenic
1116434178 14:44877862-44877884 GTGCTGAGCCGCCTGGAGCTGGG - Intergenic
1116497677 14:45582608-45582630 GTGCTGAGCTGCCTGGAGCTAGG + Intergenic
1116542029 14:46110749-46110771 ATGCTGAGCTGCCTGGAGCACGG - Intergenic
1116584596 14:46686844-46686866 ATGCTGAGCTGCCTACACTTGGG + Intergenic
1116669339 14:47821269-47821291 GTGCTGAGCTGCCTGGGGCTGGG + Intergenic
1116834988 14:49761909-49761931 GTTCTGAGCTACCTGGAACTGGG + Intergenic
1117013971 14:51499582-51499604 GAGCTGGGCTGCCTGGGGTCAGG - Intronic
1117384322 14:55195463-55195485 GAGCTGCACTGCCTGGGGTTTGG + Intergenic
1117504370 14:56388049-56388071 ACGCTGAGCTGCCTGGAGCTGGG + Intergenic
1117504492 14:56388750-56388772 GAGCTGTACTGCCTGGGGTTGGG + Intergenic
1117795311 14:59387947-59387969 GTGCTGAGCTGCCTGGAACTGGG + Intergenic
1117842905 14:59880062-59880084 GTGATGAGATGCCTGGAGCTGGG + Intergenic
1117870891 14:60198867-60198889 GTGCTGAGCTTCCTGGAGCTAGG - Intergenic
1117893391 14:60450775-60450797 GTGCTGAGCTGCCTGGAGTGGGG - Intronic
1118034234 14:61849259-61849281 GAGCTGCACTGCCTGGAGTTGGG + Intergenic
1118241050 14:64059535-64059557 GTGTTGAGCTGCCTAGAGCTGGG + Intronic
1118549312 14:66932239-66932261 ATGCTGAACTGCCTGGAGTTGGG + Intronic
1118843141 14:69527476-69527498 GTGCTGAGATGCCTGCAGGCAGG - Intronic
1119083728 14:71721306-71721328 GTGCTGGGTTGCCTAGAGTTGGG + Intronic
1119096747 14:71840115-71840137 GTTCTGAGCTGCCTGGAGCTGGG + Intergenic
1119096878 14:71840859-71840881 GAGCTGAGTTGCCTGGGTTTGGG + Intergenic
1119295093 14:73526492-73526514 GAGCTGCCCTGTCTGGAGTTGGG - Intronic
1120100225 14:80435900-80435922 ATGCTGAGCTGCCTGCATCTGGG - Intergenic
1120275891 14:82371486-82371508 GTGCTGAGCTGCTTGGACCTAGG - Intergenic
1120468081 14:84886261-84886283 GTGCTGAGCTGCCTGAAGTTGGG - Intergenic
1120917522 14:89722869-89722891 GCTCTGGGGTGCCTGGAGTTGGG + Intergenic
1121114591 14:91334857-91334879 GAGCTGAGCTGCTTTGAGATGGG - Intronic
1121153075 14:91654881-91654903 GTGCTAAGCTGCCTGGAGCTAGG - Intronic
1121448107 14:93990977-93990999 GTCATGAGCTGCCTGGCCTTGGG - Intergenic
1122118449 14:99539031-99539053 CTGCATAGCTGCCTGGGGTTTGG - Intronic
1122472014 14:101975095-101975117 GTGGTGAGGAGCCTGGACTTCGG + Intronic
1123111968 14:105876199-105876221 GTTCTGAGCCTCCTGGAGATGGG + Intergenic
1123998828 15:25737707-25737729 GTTCTGAGCTACGTGGGGTTAGG - Intronic
1124081264 15:26500669-26500691 GTTCTGAGCCACCTGGAGCTGGG + Intergenic
1125272229 15:37952275-37952297 GAGCTGTGCTGCCTGGGATTAGG - Intronic
1125770507 15:42162371-42162393 CTGCAGAGCGGCCTGGAGGTTGG + Exonic
1126053199 15:44706623-44706645 GTGATCAGCTGCCTGGAGTTGGG + Intronic
1126053392 15:44707675-44707697 GAGCTGCCCTGCCTGGGGTTGGG + Intronic
1126285692 15:47008579-47008601 CTACTGAGCTTCCTGGAGCTGGG + Intergenic
1126440478 15:48683199-48683221 GAGCTGCCCTGCCTGGGGTTGGG - Intergenic
1126440666 15:48684251-48684273 ATGCTGAGCTGCCTGGAGCTGGG - Intergenic
1126706985 15:51414926-51414948 ATGCTGTGCTGCCTGGAGCTGGG - Intergenic
1126944007 15:53797786-53797808 GAGTTGTGCAGCCTGGAGTTAGG - Intergenic
1126979903 15:54228803-54228825 GAGCTGTGCTGCCTGGGGTTGGG + Intronic
1127132719 15:55883660-55883682 GTGTTGAGATGCCTGGAACTAGG - Intronic
1127142554 15:55993138-55993160 GTGCGGAGCTCCCAGGCGTTGGG - Intronic
1127170839 15:56299585-56299607 GAGCTGAGCTACCTGGGTTTAGG - Intronic
1127173598 15:56329057-56329079 GTGCTGAGCTGTGTGGAGCTGGG - Intronic
1127177905 15:56381723-56381745 GTGCTGAGCTGTCTGAAACTAGG + Intronic
1127477010 15:59344385-59344407 GTGCTGAGATGTGTGGAGCTAGG + Intronic
1127493347 15:59485389-59485411 GTGCTGAGCTACCTGGAGCTGGG - Intronic
1127837697 15:62804134-62804156 GTGCTGAGCCTCCTGAAGCTAGG + Intronic
1127971387 15:63965325-63965347 GTACTGACCTGCCTGGGGCTAGG + Intronic
1128900930 15:71422556-71422578 GTGATAAGCTGCCTGGAATCAGG + Intronic
1128966358 15:72061968-72061990 TTGCTGAGCTGCCTGGAATTGGG - Intronic
1129665183 15:77575661-77575683 GTGCTGAGCTTGTTGGAGGTGGG - Intergenic
1130441030 15:83954865-83954887 CTGCTGAGCCACCTGGAGCTGGG + Intronic
1130511741 15:84595186-84595208 AAGCTGTGCTGCCTGGGGTTGGG - Intergenic
1130653104 15:85773493-85773515 CCGCTGAGCTGCCTGGAGGCAGG - Intronic
1130961820 15:88664435-88664457 GTGCCACGCTGCCTGGAGCTGGG - Intergenic
1131095021 15:89649301-89649323 GTGCTGAGCCTCCTGGAGATGGG - Exonic
1131945025 15:97609835-97609857 GTGCTGAGCTACCTAGAGCAGGG - Intergenic
1133098814 16:3466779-3466801 GATGTGAGCTGCCTGGAGTTTGG + Intronic
1133834047 16:9350900-9350922 CTGCTGAGCTGTCTGGAGCTGGG + Intergenic
1136289089 16:29260798-29260820 GTGCCGAGGTGCCTGGAGGCAGG + Intergenic
1136389051 16:29950847-29950869 TTGCTGAGCTTCCTGGAGCTAGG + Intronic
1136531132 16:30870171-30870193 GGGCTGAGGGGCTTGGAGTTTGG - Intronic
1136610433 16:31362383-31362405 GGGCTGTGCTGCCTGGGGTGGGG + Intronic
1136610486 16:31362530-31362552 GTGCTGTGCTGCCCGGGGTGGGG + Intronic
1136618061 16:31410655-31410677 GGGCTGCGCTGCCTGGGGTGGGG + Intronic
1136676489 16:31913323-31913345 ATGCTGAGCTACCTGGAGCTGGG + Intronic
1137036729 16:35574856-35574878 GCGCTGAGCTGTCTGAAGTGAGG - Intergenic
1137703642 16:50518131-50518153 GTGCTGTGCTGCCCAGATTTAGG + Intergenic
1141485275 16:84334604-84334626 GTGCTGAGCCACCTGGAACTGGG - Intergenic
1141631523 16:85290578-85290600 GTGCTGTGTGGCCTGGATTTTGG - Intergenic
1141655415 16:85413361-85413383 GGGAGGAGCTGCCTGAAGTTGGG + Intergenic
1142260635 16:89041049-89041071 GTGCTGGGCTCCCTGGACTCCGG + Intergenic
1142277728 16:89131850-89131872 GCTCTGAGCAGCCAGGAGTTAGG + Intronic
1142281358 16:89149681-89149703 GTGCTGAACCGCCCAGAGTTGGG + Intronic
1142794437 17:2296529-2296551 CTGCTGATCTGACAGGAGTTAGG - Intronic
1143413812 17:6729861-6729883 TTGCTGATCTGCCTGCAGCTGGG - Intergenic
1143490574 17:7283305-7283327 GTGCTTGGCTCCCTGCAGTTTGG + Exonic
1145007360 17:19345102-19345124 CTGCTTAGCTGGCTGGGGTTGGG + Intronic
1145069133 17:19788266-19788288 GAGCTGCGCTGCCTGGGTTTGGG - Intronic
1145069303 17:19789214-19789236 ATGCTGAGCTACTTGGAGGTGGG - Intronic
1145117519 17:20225210-20225232 GAGCTGTGCTGCCTGGGGTTGGG + Intronic
1145200895 17:20943992-20944014 ATCCTGAGCTGCCTGGAGTTGGG + Intergenic
1146098905 17:29959775-29959797 GAGCTGCACTGTCTGGAGTTGGG + Intronic
1146242433 17:31243210-31243232 GTGTTGAGCTGCCTGGAGCTGGG + Intronic
1146242623 17:31244264-31244286 GAGCTGAGCTGCCTGGGTTTGGG + Intronic
1146322542 17:31858475-31858497 GTGCTGAGCGGCTTGAAGGTAGG - Intronic
1146949378 17:36895009-36895031 GTGCGGAGCTGGCTGGGGCTGGG - Intergenic
1148693565 17:49546280-49546302 GTGGTGAGCTGGGTGGAGGTGGG + Intergenic
1148958315 17:51371967-51371989 CTGCCGGACTGCCTGGAGTTTGG - Intergenic
1149075560 17:52593895-52593917 GTGCTGAACTTCCAGGAGCTAGG + Intergenic
1149111197 17:53033097-53033119 GTGCTGAGCTGCCTGGAGGTGGG + Intergenic
1149180539 17:53931563-53931585 GTGCTGAGCCACCTGGAGCTGGG + Intergenic
1149234837 17:54577862-54577884 GAGCTGTGCAGCCTGTAGTTAGG - Intergenic
1149239891 17:54636334-54636356 GTGCTGAGCTGCTTGGAACTGGG - Intergenic
1149674545 17:58447504-58447526 ATGCTGCACTTCCTGGAGTTTGG - Intronic
1149906385 17:60529775-60529797 GTGCTGAGCTGCCTGGAGCTGGG - Intergenic
1150550471 17:66204856-66204878 ATGCTGAACTGCTTGGAGCTGGG - Intergenic
1150816459 17:68395965-68395987 GTGCTGAGCCCTCTGGAGCTGGG - Intronic
1150964262 17:69949649-69949671 ATCCTGATCTGCCTGCAGTTTGG - Intergenic
1152348300 17:79768388-79768410 TTTCTGAGCTGCTGGGAGTTAGG - Intergenic
1152520841 17:80855739-80855761 CTGCAGTGCTGCCTGGCGTTTGG + Intronic
1153088552 18:1318023-1318045 GAGCTGTGCTGCCTAGGGTTGGG - Intergenic
1153129177 18:1834857-1834879 GAGCTGTACTGCCTGGGGTTGGG - Intergenic
1153183166 18:2458969-2458991 GTGCTGAGCTTCCTGGAGCTGGG + Intergenic
1153356477 18:4142982-4143004 GTGCTGAGCTGCCTGGAGCTGGG + Intronic
1153425698 18:4960886-4960908 GAGCTGTGCAGCCTGGGGTTAGG - Intergenic
1153429597 18:5000845-5000867 GTGCTGAGATACCTGGAGCTGGG - Intergenic
1153437327 18:5081552-5081574 GTGCTCAGCTGTCTGGGGCTGGG + Intergenic
1154405357 18:14085650-14085672 GTGCTGCACTGCCTGGAGTTGGG - Intronic
1154465232 18:14637664-14637686 GCACTGCACTGCCTGGAGTTGGG - Intergenic
1155282017 18:24249959-24249981 CTGCTGTGCTGCCTGGGGTTGGG - Intronic
1155533915 18:26795617-26795639 GTTCTGAGCCACCTGGAGATGGG - Intergenic
1155597413 18:27503283-27503305 GTTCTGAGCTACCTTGAGCTGGG - Intergenic
1156912280 18:42425374-42425396 GTGCTGAGATGCCTGGAGCTGGG + Intergenic
1156977148 18:43237218-43237240 GTGCTGAGCAACCTGGAACTAGG + Intergenic
1156994202 18:43447099-43447121 ATGGAGAGCTGCCTGGAGTCTGG + Intergenic
1157136140 18:45057648-45057670 AGGCTGAACTGCCTGGAGTTGGG - Intronic
1157585785 18:48800420-48800442 GTGATGGGCTGGCTGGAGATGGG - Intronic
1157879427 18:51305592-51305614 GTGCTGAGCTGCCTGTAGCTGGG - Intergenic
1157937089 18:51884662-51884684 GTCCTGAGCTGCCTGGAGCTGGG - Intergenic
1158116973 18:54006114-54006136 GTGCTGAGCTGCCTTGTGCTGGG - Intergenic
1158246340 18:55436673-55436695 GTGCTGAGCAGCCTGAGGTCAGG + Intronic
1158440086 18:57467799-57467821 GTTCCGAGCTGCCCGGAGTCCGG - Intronic
1158481158 18:57823269-57823291 GTGCTGAGCTGCTTGGAGCTAGG + Intergenic
1158503169 18:58021960-58021982 GTGAGGAGCTGCCTGGACTTTGG + Intergenic
1158720398 18:59919462-59919484 TTCCCGAGCTACCTGGAGTTTGG + Intergenic
1158948898 18:62474075-62474097 GTGATGAGCTGCCTGGAGCTGGG + Intergenic
1159091914 18:63859868-63859890 GTGCTGAGCTGCCTGGAGCTGGG + Intergenic
1159446430 18:68546003-68546025 GTGCTGAGTTGCCTGGAGCTGGG - Intergenic
1159648182 18:70943901-70943923 GTGCTGAGCTGCCTGGAGCTGGG - Intergenic
1160011228 18:75108305-75108327 GTGCTGGGCTGGCGGGAGTGAGG - Intergenic
1160138360 18:76295577-76295599 GTTTTGAGCTGCCTGGAGCTGGG + Intergenic
1160806044 19:992592-992614 GTGCTGAGCTGCAGGGAGTGAGG - Intronic
1161659615 19:5537960-5537982 ATGCTGAGAGCCCTGGAGTTGGG + Intergenic
1162692901 19:12448827-12448849 GTTCTGAGCCACCTGGAGCTGGG + Intronic
1162693089 19:12449880-12449902 GAGCTGTGCTGCCTGGGATTGGG + Intronic
1163185363 19:15635468-15635490 GTGCTGATCTGTCTGGAGCTAGG + Intronic
1163400978 19:17092229-17092251 TGGCTGAGCTGCCTGGATGTAGG - Intronic
1164083913 19:21884395-21884417 GAGCTGAGCTGCTTGCTGTTAGG - Intergenic
1164130294 19:22355545-22355567 GTGCTGGGCTGCCTGCCTTTGGG + Intergenic
1164966587 19:32490027-32490049 CTGCTGAGGTGGCTGGGGTTTGG + Intergenic
1165645543 19:37432303-37432325 GTGCTGAGTTGCCTGGAGCTAGG - Intronic
1165983988 19:39751574-39751596 GAGCTGTGCAGCTTGGAGTTGGG - Intergenic
1166755957 19:45191792-45191814 GTGCTGAGCTGCCTGGAGCTGGG + Intronic
1167083262 19:47291543-47291565 GTGCTGAGATGCCTGGAGTTGGG - Intronic
1167304067 19:48696781-48696803 GTGCTGAGCTGCCCGGGGCACGG + Intronic
1167468345 19:49662118-49662140 GTGCTGAGCTGCCTGGGTGGGGG - Exonic
1167582040 19:50350737-50350759 GAGCTGAGCCACCTGGAGGTGGG + Intronic
1167584697 19:50367600-50367622 CTGCTGAGCTACCTGGAGCTGGG + Intronic
1167959097 19:53091501-53091523 GTGCAGAGAGGCCAGGAGTTGGG + Exonic
1168449011 19:56448545-56448567 CAGCTGTGCTGCCTGGAGTTGGG - Intronic
1168449077 19:56448937-56448959 GTGCTGAGCTGCCTAGAGTTGGG - Intronic
1168605658 19:57758250-57758272 AAGCTGTGCGGCCTGGAGTTGGG - Intergenic
925295009 2:2770378-2770400 GTGCAGAGCTGCATGGAGCAGGG - Intergenic
925484723 2:4315789-4315811 CTGCTGAGCTGCCTGTAGCTGGG + Intergenic
925684849 2:6459565-6459587 GTGCAGAGCTCCGTGGAGTATGG - Intergenic
925698835 2:6612928-6612950 ATGCTGAGCTGCCTGGAGCTTGG + Intergenic
925992989 2:9268939-9268961 GTGCTGTGCTGCCTGCAGTGTGG + Intronic
926060545 2:9802045-9802067 GACCTGAGCTGCCTTGAGGTTGG - Intergenic
926143346 2:10381745-10381767 GTGCTGAGTGTCCTGGATTTGGG - Intronic
926518926 2:13884603-13884625 TTGCTGAGCTCCCTGGAGTTGGG - Intergenic
926601028 2:14845181-14845203 GTTCTGAGCCGCCTGGAACTGGG - Intergenic
926834047 2:16998471-16998493 CTTCTGAGCTGCCTGGAGCTGGG + Intergenic
927570163 2:24152644-24152666 GTGCTGAGCCACCTGGAGCTGGG + Intronic
927870588 2:26620379-26620401 GTGCTGAGCAGCCTGTAGGTTGG - Intronic
928293669 2:30061906-30061928 GTACTGAGCTTCCTGGAGCTGGG - Intergenic
928383937 2:30847667-30847689 GTGCTTAGCTGCCTGAAGCTGGG - Intergenic
928458815 2:31450539-31450561 GAGCTGTGCAGCCTGGGGTTAGG - Intergenic
928484050 2:31711637-31711659 GAACTGTGCTGCCTAGAGTTGGG - Intergenic
928484225 2:31712713-31712735 GTGCTGAGTTGCCTGAAGCTGGG - Intergenic
928485684 2:31728876-31728898 GCACTGCACTGCCTGGAGTTAGG - Intergenic
928649235 2:33387467-33387489 GTGCTGGGACGCCTGGAGTCTGG + Intronic
928715420 2:34055264-34055286 GTGCTGAGCTGCCTGGAGCTTGG + Intergenic
928768031 2:34671133-34671155 GTGCTGAGCTTCCTGGAGTTGGG - Intergenic
929100052 2:38302591-38302613 GTGCTGAGCTGCCTGGAGCTGGG - Intronic
929215305 2:39405199-39405221 GTTCTGAGCTGCCTGGAGCTGGG - Intronic
929281601 2:40086773-40086795 GTGCTAAGCTGCCTGGATCTGGG + Intergenic
929838005 2:45426062-45426084 TTGCTGAGCTCCATGGGGTTGGG - Intronic
930230574 2:48840428-48840450 GTGCTATGCTGCCTGGAGTTGGG + Intergenic
930288747 2:49467360-49467382 GTGCTGAACTGCCTGGATCTGGG + Intergenic
930294429 2:49536594-49536616 GTTCTGAGCCACCTGGAGCTGGG - Intergenic
930620435 2:53637802-53637824 GGGCTGAGATGCCATGAGTTGGG - Intronic
931085856 2:58830299-58830321 TTTCTGAGCTGCCTGCAGCTGGG + Intergenic
931572205 2:63680740-63680762 GAGCTTTGCTGCCTGGGGTTGGG - Intronic
931736663 2:65200174-65200196 GTGCTGAGCTGCCTGGAGCTGGG - Intergenic
931849411 2:66237458-66237480 GTGCTGTCCTGCCTGGGTTTAGG - Intergenic
932858847 2:75267332-75267354 GAGCTGTGCAGCCTGGGGTTTGG + Intergenic
932889606 2:75580419-75580441 ATGATGAGCTGCCAGGAGCTTGG - Intergenic
933316973 2:80727175-80727197 GAGCTGTACAGCCTGGAGTTAGG - Intergenic
933489701 2:82970132-82970154 ATGCTGGGCTGCCTGGAGCTGGG + Intergenic
934870690 2:97862004-97862026 GTGCTGAGCCACCTGGATCTGGG - Intronic
934929108 2:98405499-98405521 GTGCTGAGCTGCCTGGGGCTGGG - Intergenic
935018890 2:99211772-99211794 GAGCTGCACTGCCTGGAATTTGG + Intronic
935019376 2:99215359-99215381 GGGCTGAGCTGGATGGAGCTGGG - Intronic
935078494 2:99769865-99769887 GTGCTGAGCAGCCTGGGGCTGGG + Intronic
935478496 2:103556363-103556385 GTGCTGAGCTTCCTGGAGCTGGG + Intergenic
935561961 2:104568646-104568668 GTGCAGACCTGCCAGGAGTCAGG + Intergenic
935576464 2:104716794-104716816 GTGCTGAGCCACCTGAAGCTGGG + Intergenic
935576639 2:104717866-104717888 GAGCTGTGCAGCCTGGGGTTAGG + Intergenic
935812883 2:106817269-106817291 AGCCTGTGCTGCCTGGAGTTGGG - Intronic
935813069 2:106818346-106818368 GTGCTGAGCTGCCTAGAGTGGGG - Intronic
936778108 2:115998623-115998645 CTGCTGAGCTGCCTGGGGCAGGG + Intergenic
936831493 2:116653487-116653509 GAGCTGTGCAGCCTGGAGTTAGG - Intergenic
936885152 2:117300803-117300825 GCTCTGAGCTGCCTGGAGCTGGG - Intergenic
936901404 2:117485433-117485455 AAGCTGTGCTGCCTGGGGTTAGG + Intergenic
936940279 2:117877846-117877868 GTGCTGAACTACCTGGAGCTAGG + Intergenic
937560670 2:123219736-123219758 GTTCTAAGCTACCTGGAGCTAGG - Intergenic
937628439 2:124069619-124069641 GTGATGAGCTGCCTGGAGCTAGG - Intronic
937738493 2:125319578-125319600 ATGCTGTGCTGCCTGGGGTTAGG + Intergenic
937793878 2:125994288-125994310 GTGTTGAGCTTACTGGAGCTAGG + Intergenic
939404954 2:141745057-141745079 GTGCTAAGCTGCCTGGAGCCAGG + Intronic
939707785 2:145477303-145477325 GTGCTGAGCTGCCTGGAACTAGG + Intergenic
939707970 2:145478821-145478843 GAGCTGCACTGCCTGTAGTTGGG + Intergenic
940468771 2:154065492-154065514 GTGCTAAGCTGCCTGGAGCTGGG - Intronic
940546975 2:155100942-155100964 GTGCTGAGCCACCTGGAACTGGG - Intergenic
940559871 2:155281600-155281622 GAGCTGTACTGCCAGGAGTTGGG + Intergenic
940565395 2:155353813-155353835 GTTTAGAGCTGGCTGGAGTTGGG - Intergenic
940786238 2:157984612-157984634 GTTCTGAGCCACCTGGAGCTGGG + Intronic
940802933 2:158153487-158153509 GAGCTGTGCTGCCTGGAGCTAGG - Intergenic
941256814 2:163241801-163241823 GTGCTGTGTTGCCTGGAGATAGG + Intergenic
941671537 2:168299067-168299089 GTCCTGTGCTGCCTGCAGTCCGG + Intergenic
942001466 2:171652501-171652523 GTCCTGAGCTGTCTGGAGCCAGG + Intergenic
942778381 2:179612602-179612624 GTGCTGAGTTATCTGGAGCTGGG + Intronic
942814358 2:180034301-180034323 GAGCTGTACTGCCTGGGGTTGGG + Intergenic
942834400 2:180276838-180276860 GTGCTGAGCCACCTGGAACTGGG + Intergenic
942862908 2:180636827-180636849 GTGCTAAGCTGCTTGGAGCTGGG - Intergenic
942881845 2:180871011-180871033 GAGCTATGCTGCCTGGGGTTGGG - Intergenic
942882013 2:180872076-180872098 CTGCTGACCTGGCTGGAGTTGGG - Intergenic
942972325 2:181971514-181971536 AAGCTGTGCTGCCTGGGGTTGGG + Intronic
943099589 2:183471862-183471884 GAGCTGTACTGCCTGGGGTTGGG + Intergenic
943117396 2:183691110-183691132 ATCCTGAGCTGCCTGGGGCTGGG + Intergenic
943147697 2:184066085-184066107 TTGCTGAGCTCCGTGGAATTGGG + Intergenic
943208088 2:184927366-184927388 GTTCTGAGCTGGCTGGAGCTAGG + Intronic
943226536 2:185185578-185185600 GCGATGAACTGCCTGGAGATAGG + Intergenic
943255028 2:185583737-185583759 ATTCTGTGCTGCCTGGAGTTGGG - Intergenic
943331240 2:186561730-186561752 GGGCTGAACTTCCTGGAGTCGGG - Intergenic
943913210 2:193594073-193594095 GTGCTGAGACACCTGGAGCTGGG - Intergenic
943941812 2:194008343-194008365 ATGTTGCACTGCCTGGAGTTGGG - Intergenic
943967422 2:194354434-194354456 GTGCTGAGCTGCCTGGAACTAGG - Intergenic
944046098 2:195413767-195413789 GAGCTGCACTGCGTGGAGTTGGG - Intergenic
944096636 2:195975615-195975637 GAGCTGTGCTGCCTGGGGTTGGG - Intronic
944096820 2:195976701-195976723 CTGCTAAGCTGCCTGGAACTGGG - Intronic
944133324 2:196370469-196370491 GAGCTGTGCTGCCTGGGGGTGGG + Intronic
944616268 2:201464458-201464480 ATGCTGAGCTGCCTGGAGCTGGG + Intronic
944751880 2:202717674-202717696 GTTCTGAGCCCCCTGGAGCTGGG + Intronic
944854967 2:203759068-203759090 ATGCTGAGCTTCCTGGAATTGGG + Intergenic
944963252 2:204900988-204901010 CTGCTGAGCTTCCTGGAGCTGGG + Intronic
944990587 2:205230578-205230600 GAGCTGCACTGCCTGGGGTTGGG + Intronic
945162371 2:206905874-206905896 ATGCTGAGATGTCTGGAGCTGGG + Intergenic
945210346 2:207375861-207375883 GTGCTGAGCCACCTGGAGCTGGG - Intergenic
945461671 2:210116517-210116539 GTACTGAGCTGCTTGGAGCTAGG - Intronic
945484376 2:210377768-210377790 GTGCTGTGCTGCCTGGAATTGGG - Intergenic
945575771 2:211526224-211526246 GTGTTGAGCTGCCTGGGGCTGGG - Intronic
946142661 2:217704816-217704838 GTGCTAAGTTGCTTCGAGTTGGG + Intronic
946177775 2:217932097-217932119 GTGCACAGCTGTCTGGAGTCAGG - Intronic
946186106 2:217981263-217981285 GGGCTGATCTGCCTGGAGAAAGG - Intronic
946578758 2:221104241-221104263 ATGCTGAGCTTCATGGAGTGTGG - Intergenic
946697261 2:222372261-222372283 GAGCTGTGCAGCCTGGGGTTGGG - Intergenic
946984634 2:225257936-225257958 GAGCTGTGCAGCCTGGGGTTGGG - Intergenic
947439624 2:230108361-230108383 TTGCTGAGCAGCCTGGAACTGGG + Intergenic
947476834 2:230457608-230457630 ATGCTGTGCTTCCTGGAGTTGGG + Intronic
947505220 2:230703600-230703622 GTGCTAAGCTGCTTGGAACTGGG + Intergenic
947687036 2:232097282-232097304 GTGCTGAGCCACCTGGAGCTGGG + Intronic
948360406 2:237416072-237416094 TTGCTGAGCTGCTTGGAGCATGG - Intergenic
948429962 2:237912765-237912787 GTGATGGGCTGCCTGGGGTCTGG - Intergenic
948475380 2:238215726-238215748 GTGTTGAGATGCCTGGAGCTGGG + Intergenic
948475566 2:238216775-238216797 GAGTTGTGCTGCCTGGGGTTGGG + Intergenic
948579356 2:238973467-238973489 TTGCCGAGCTGCCTGGAGACAGG - Intergenic
948774604 2:240277416-240277438 GAGCTGCACTGCCTGGAGTTGGG - Intergenic
948924054 2:241082556-241082578 CTCCTGAGCTGCATGGACTTGGG - Intronic
1168743912 20:219547-219569 GTGCCAGGCTGCTTGGAGTTGGG - Intergenic
1168899990 20:1355203-1355225 AAGCTGTGCTGCCTGGAGTTGGG + Intronic
1168917360 20:1501040-1501062 GAGCTGTGCAGCCTGGGGTTAGG + Intergenic
1170087016 20:12544905-12544927 GAGCTGTGCAGCCTGGGGTTTGG + Intergenic
1170311594 20:14997874-14997896 ATGCTGAACTGCCTGGAATTGGG - Intronic
1170401044 20:15983590-15983612 GTGCTGATCTGCAGGGACTTTGG + Intronic
1170709143 20:18774739-18774761 GTGCTGAGCTGCCTGGAGCTGGG + Intergenic
1171943039 20:31349361-31349383 GTGGTGAACTGCCTGGAGCTGGG - Intergenic
1172177424 20:32980719-32980741 GGGCTGAGCTGCATGCAGTGGGG + Intergenic
1172418873 20:34797175-34797197 GAGCTGTGCTGCCTGGGCTTTGG - Intronic
1172419116 20:34798600-34798622 ATGCTGAGCTACCTGGAGCTAGG - Intronic
1172791766 20:37510759-37510781 GTGGAGGGCTGCCTGCAGTTAGG - Intronic
1172825937 20:37786126-37786148 GTGCTGAGCTGCCTGGTGCTGGG + Intronic
1173098863 20:40065055-40065077 GAGCTGTGCAGCCTGGAGTTAGG - Intergenic
1173204103 20:40979304-40979326 GTGCTGTGCTGCCTAGAGCTGGG + Intergenic
1173204285 20:40980389-40980411 AAGCTGTGCTACCTGGAGTTGGG + Intergenic
1173518905 20:43684710-43684732 GTGGTGGGGTGCCTGTAGTTGGG + Intronic
1173748507 20:45457015-45457037 GTGCTATGCTGCCTGAACTTGGG + Intergenic
1174420245 20:50394684-50394706 GGGCTAAGCTGCCTGAAGCTGGG - Intergenic
1174690981 20:52504168-52504190 GAGCTGTGCTGCCTGGGGTTGGG - Intergenic
1174723819 20:52840535-52840557 GAGCTGAGCTGCCAGGTGTCAGG - Intergenic
1174938668 20:54899158-54899180 GTGCTGAGCTGCTTGGAACTGGG - Intergenic
1175472122 20:59237803-59237825 GTGCTGTAGTGCCTGGAGCTGGG + Intronic
1175632060 20:60549772-60549794 GTGCCAAGCTGCCTGGAGCTGGG + Intergenic
1175761703 20:61565870-61565892 TTGCTCAGCTGCCTGGGGTGAGG + Intronic
1175794289 20:61761904-61761926 GTGCGGAGCTGCCTGCTGTGCGG - Intronic
1175794294 20:61761938-61761960 GTGCGGAGCTGCCTGCCGTGCGG - Intronic
1176809308 21:13520722-13520744 GCACTGCACTGCCTGGAGTTGGG + Intergenic
1177023738 21:15895982-15896004 AAGCTGTGCTGCCTGGGGTTTGG - Intergenic
1177137267 21:17318604-17318626 GTGCTGTGCTGCCTGGAGTTGGG - Intergenic
1177740512 21:25148045-25148067 GTGCTGAGCTGCATGGAGATGGG + Intergenic
1177760765 21:25400008-25400030 AAGCTGCGCTGCCTGGAGTTGGG - Intergenic
1177760828 21:25400421-25400443 GTGCTGGGCTGACTGGAGCTGGG - Intergenic
1177771428 21:25519989-25520011 ATGCTGAACTGCCTGGAGTTGGG - Intergenic
1178386471 21:32154956-32154978 GTGTTGAGCTGCTGTGAGTTTGG + Intergenic
1178425901 21:32478149-32478171 GTTCTGAGGTACCGGGAGTTAGG - Intronic
1178885618 21:36482610-36482632 ATGCAGAGATGCCTGGGGTTTGG + Intronic
1179558871 21:42200037-42200059 TTGGTGAGCTGCCTGGATTTGGG + Intronic
1179959696 21:44761155-44761177 GTGCTGAGCTGCACGGAGCAGGG + Intergenic
1180581624 22:16844532-16844554 CAGCTGAGCTCCCTGGAGTTTGG + Intergenic
1180626804 22:17199140-17199162 GTGCTGGGCTGCTAGGATTTGGG - Intronic
1181120435 22:20664334-20664356 GCACTGCACTGCCTGGAGTTGGG + Intergenic
1181717053 22:24738525-24738547 GTGCTGAACCGCCTGGAGCTGGG - Intronic
1182063916 22:27417052-27417074 ATGCTGAGCTGGCTGGAGAATGG - Intergenic
1182178447 22:28318237-28318259 CTGCTGACTTGCCTGGAGTGTGG + Intronic
1182195964 22:28518217-28518239 GTGTTGAGCTGCATGGGGTTTGG + Intronic
1182273772 22:29171931-29171953 GTGCTCGTCTGCCTGGAGCTTGG + Intergenic
1182437755 22:30341532-30341554 GCTCTGTGCTGCCTGGACTTGGG + Intronic
1183315479 22:37134806-37134828 GCCGTGAGCTGCCTGGAGCTGGG + Intronic
1183497328 22:38154378-38154400 GTGCTGGGCCGCCTGGAGCTAGG - Intronic
1184983922 22:48116281-48116303 TTGATGAGCTGCCTGGAGGCTGG + Intergenic
1184986285 22:48137790-48137812 CTGCTGGGCTGCATGGAATTTGG + Intergenic
1185038497 22:48491507-48491529 CTGCTGAGCTGCTGGGGGTTGGG - Intronic
1185070597 22:48653796-48653818 GAGCTGTGCTCCCTGGAGCTGGG - Intronic
1185131412 22:49041236-49041258 GGGCTGATCTGCCTGGAGTCGGG - Intergenic
1185198846 22:49490090-49490112 AGGCTGAGCTACCTGGAGTGGGG - Intronic
949235589 3:1805456-1805478 TCTCTGAGCTGCCTGGAGCTGGG + Intergenic
949345443 3:3072175-3072197 GTGCAGAGCTGCCTACAGCTGGG - Intronic
949448416 3:4161194-4161216 GTGCTGTGCTGCCTGGAGCTAGG + Intronic
949452792 3:4205793-4205815 ACGCTGACCTACCTGGAGTTGGG + Intronic
949622985 3:5837236-5837258 GTGTTGAGCTGCCTAGAATTGGG + Intergenic
949829137 3:8196197-8196219 GTGCTGAGCTGCCTGGAGCTGGG + Intergenic
949947537 3:9202435-9202457 GTTTTCAGCTCCCTGGAGTTGGG - Intronic
950428255 3:12936200-12936222 GTGCAGGGCTGTCTGGGGTTCGG + Exonic
950542161 3:13619087-13619109 GTGGTGAGCTGTCTGGTGCTGGG + Intronic
950695518 3:14698639-14698661 GTGCTGAGCCACCTGGAGCTGGG + Intronic
950713291 3:14829202-14829224 GAGCTTAGGTGCATGGAGTTGGG + Intronic
951029171 3:17862703-17862725 GTGCTGAGCTTCTTGGAGCTAGG + Intronic
951129991 3:19030463-19030485 ATACTGAGCTGCTTGTAGTTGGG - Intergenic
951177856 3:19622891-19622913 AAGCTGTGCAGCCTGGAGTTAGG + Intergenic
951259968 3:20495862-20495884 GAGCTGCACTGCCTGGGGTTGGG + Intergenic
951398804 3:22204114-22204136 CTGCTGAGCTGTCTGGAGCTGGG - Intronic
951436864 3:22675771-22675793 ATGATGACCTGCCTGGAGCTGGG + Intergenic
951495117 3:23317052-23317074 GAGCTGTGCTGCCTGGAGTTGGG + Intronic
952008781 3:28875368-28875390 GTGCTGAGATGCCTGGAGCTGGG + Intergenic
952673110 3:35994527-35994549 GTGCTTAGCTGTCTGGAACTGGG - Intergenic
952721843 3:36541788-36541810 GTGCTGGGCTGGCTAGAGATGGG + Intronic
952811773 3:37410919-37410941 CTGCTGAGCTGCCTGGAGCTGGG + Intronic
952912591 3:38203703-38203725 GGGCGGAGCTGTCTGGAGCTGGG + Intronic
953191342 3:40690859-40690881 TGGCTGAGCTGCCTGGTGCTTGG + Intergenic
953362307 3:42308954-42308976 GTGCTGAGCTACCTGTAACTGGG + Intergenic
953722509 3:45368801-45368823 GAGCTGTGCAGCCTGGGGTTAGG - Intergenic
953853158 3:46481120-46481142 GTACTGAGCTTCCTGGAGGGGGG - Intronic
953919565 3:46942703-46942725 GAGATGAGCTGCCCTGAGTTGGG - Intronic
955175119 3:56606199-56606221 TTGCTGAGCTCCCTGGGGATAGG + Intronic
956257937 3:67304389-67304411 GTGCTGCCCAGCCTGGAGTGTGG + Intergenic
956393155 3:68796072-68796094 GTGCTGAGCTGCTTGGAGCTAGG + Intronic
956782519 3:72615323-72615345 CTGCTGAGCTTCCTGGAGTCTGG + Intergenic
957409802 3:79824661-79824683 ATGATGTGCTGCCTGGGGTTGGG + Intergenic
957672538 3:83324171-83324193 GAGCTGCACTGCCTGGAGTTAGG + Intergenic
957745721 3:84339794-84339816 GTGCTGAGCTGCCTGGACTAGGG + Intergenic
957810331 3:85214304-85214326 TTGCTGAGCTGCCTAGAGCTGGG + Intronic
957925556 3:86805794-86805816 GTTCTGAACTACCTGGAGCTGGG - Intergenic
957965949 3:87322395-87322417 GTGCTGAGCTGCTTGGTGCTGGG - Intergenic
957966203 3:87324454-87324476 ATGGAGAGCTGGCTGGAGTTGGG + Intergenic
957976074 3:87447197-87447219 GTGCTGAGCTGCCTAGAATTGGG + Intergenic
958052206 3:88362888-88362910 GCGCTGCACTACCTGGAGTTGGG + Intergenic
958083405 3:88775243-88775265 GTGCTGAGCTGCCTGAAGTTAGG - Intergenic
958670475 3:97197618-97197640 GAGTTGTGCTGCCTGGGGTTGGG + Intronic
958682949 3:97353903-97353925 GAGCTGAACTGCCTGGATCTGGG - Intronic
958760258 3:98297653-98297675 CTGCTGAGCTGCCTGAAGCTGGG - Intergenic
958765943 3:98367990-98368012 GAACTGCACTGCCTGGAGTTGGG + Intergenic
958837604 3:99163560-99163582 GGGCTGAGCTGCCTGGAGCTGGG - Intergenic
958839617 3:99187355-99187377 ATGCTAAGCTGCCTACAGTTGGG - Intergenic
958840090 3:99192527-99192549 GTTCTGAGCCACCTGGAGCTGGG - Intergenic
958950276 3:100408797-100408819 GGGCTGTGCTGCCTGGTCTTGGG + Intronic
959189915 3:103097820-103097842 GAGCTGCACTGCCTGGGGTTGGG + Intergenic
959191247 3:103113759-103113781 GTGCTGAGCCACCTGGAACTGGG - Intergenic
959285002 3:104397542-104397564 GAGCTCTGCTGCCTGGGGTTAGG - Intergenic
959285057 3:104397958-104397980 GTGCTGAGCTGCTTGGATTTGGG - Intergenic
959408953 3:105997131-105997153 GTACTGAGCTGCATGTAGCTGGG + Intergenic
959448166 3:106466596-106466618 GTGCTGCACTGCCTAGAGCTGGG + Intergenic
959547328 3:107612612-107612634 ATGCTGAGCTGTCTAGAGCTGGG + Intronic
959640092 3:108622896-108622918 GTATGGAGCTGCCTGGAGCTGGG + Intronic
959717143 3:109444936-109444958 GTGCTGAGCTGCCTGAGGCTGGG - Intergenic
959806508 3:110561474-110561496 GTGCTGAGCTACCTGGAGCTTGG + Intergenic
959913787 3:111793955-111793977 GAGCCGTGCTGCCTGGAGTTGGG + Intronic
960067246 3:113387240-113387262 GAGCTGTGCTGCCTGGGGTTGGG - Intronic
960095379 3:113685221-113685243 ATGCTGAGCTGCCCGGAGTTGGG + Intronic
960153433 3:114274375-114274397 GTGCTGAGCTTCTTGGAGCTGGG + Intergenic
960153586 3:114275426-114275448 GTGCCGTGCTGCCTGGGGTTGGG + Intergenic
960207211 3:114917741-114917763 GTGCTTAGCTGCCTGGTGCTGGG + Intronic
960298132 3:115968641-115968663 GAGCTGCACTGCCTGGGGTTTGG + Intronic
960353956 3:116628503-116628525 ATGCTGGGCTACCTGGAGTTGGG + Intronic
960404269 3:117239476-117239498 GCGCTGAGCTTCCTGAAGCTGGG - Intergenic
960471739 3:118074945-118074967 GTACTGAGCTGCCTAGAGCTTGG + Intergenic
960499017 3:118412572-118412594 GTGCTGAGCTTCCTGGAGCTGGG - Intergenic
960565021 3:119123636-119123658 GTGCTGAGCTTCCTGGAGCTGGG - Intronic
961053625 3:123768018-123768040 CTGCTGAGAGGCCAGGAGTTCGG - Intronic
961556947 3:127702301-127702323 GTGGTGAGCTGCCTGCAGGGTGG + Intronic
961964485 3:130888266-130888288 AAGCTGTGCTGCCTGGGGTTGGG + Intronic
962078627 3:132113898-132113920 GTGCTGAGCTGCCTGGAGCTGGG + Intronic
962767520 3:138579414-138579436 AAGCTGTGCTGCCTGGGGTTGGG - Intronic
962767678 3:138580297-138580319 GTGCTGAGCTGCCTGGAATTGGG - Intronic
962862705 3:139419283-139419305 GTGCTGAACTGGGTGGACTTGGG - Intergenic
962870795 3:139491363-139491385 CTGCTGAGCTGCCTGGAGCTGGG + Intergenic
962870911 3:139492131-139492153 AAGCTGTGCTGCCTGGAGTTGGG + Intergenic
963020350 3:140868018-140868040 GTGCTGGGCTGCCTGGAGCTGGG + Intergenic
963154241 3:142078412-142078434 GTGCTGAGCTGCCTGGAGATAGG - Intronic
963246097 3:143064683-143064705 GTGATCAGCTGCCTGGTCTTGGG + Intergenic
963310206 3:143700932-143700954 GTTCTAAGCTGCCTGGACCTGGG - Intronic
963411449 3:144932235-144932257 GTTCTGAGCCACCTGGAGCTGGG - Intergenic
963430679 3:145197736-145197758 ATGCTGAGCTACCTGGAGTTGGG - Intergenic
963515236 3:146300871-146300893 GAGCTGTGCAGCCTGGGGTTAGG - Intergenic
963528625 3:146446523-146446545 GTGCTGAGCTGCCTAGATCTGGG + Intronic
963528799 3:146447634-146447656 AAGCTGTGCTGCCTGGAGTTGGG + Intronic
963571850 3:147008186-147008208 ATGGTGAGCTACCTGGAGCTGGG + Intergenic
963763235 3:149307211-149307233 GTACTGAGCTTCCTAGAGCTAGG + Intergenic
963802342 3:149688409-149688431 ATTCTGAGCTGCCTGGAGTTGGG - Intronic
963980383 3:151529935-151529957 GTTCTTAGCTTCCTTGAGTTGGG - Intergenic
963996052 3:151709696-151709718 GTGCTGAGCCTCCTGGAGCTAGG - Intergenic
964021718 3:152021410-152021432 GAGCTGTGCAGCCTGGAGTTTGG - Intergenic
964140717 3:153396356-153396378 GTGTTGAGGTGCCTGGAGTTGGG + Intergenic
964140835 3:153397104-153397126 GAGCTGTGCTACCTGGGGTTAGG + Intergenic
964239438 3:154574421-154574443 GAGCTGTGCAGCCTGGGGTTAGG - Intergenic
964253640 3:154749802-154749824 GAGCTGTGCTGCCTGGGGTTGGG - Intergenic
964258809 3:154810943-154810965 GTGCTGAGCTGCCTGGAGCTGGG + Intergenic
964582794 3:158259445-158259467 GTGCTGAACTGCCTGGAACTGGG + Intronic
964992793 3:162835161-162835183 GTGCTGAGCTGCCTGGATTTGGG + Intergenic
965000010 3:162941203-162941225 GTGCTGAACTGCCTGGAATTGGG - Intergenic
965027016 3:163315545-163315567 GTGCTAAGCTGCCTGAAGTTGGG + Intergenic
965034623 3:163422899-163422921 GAGCTGAGCTGCCTTGGATTGGG - Intergenic
965059898 3:163772558-163772580 GTGCTGAGTTGCCTGGAGCTGGG + Intergenic
965099507 3:164278169-164278191 GAGCTGTGCTGCCTGGGGTTTGG - Intergenic
965144886 3:164889232-164889254 ATGGTGATCTGCCTGGAGCTAGG + Intergenic
965181152 3:165404999-165405021 ATCCTGAGCTGACTGGAATTGGG - Intergenic
965358804 3:167710824-167710846 GTGCTGAACTTCCTGAAGCTGGG - Intronic
965799434 3:172476380-172476402 GTGATGAGCTTCCTGGAGCTTGG + Intergenic
965867084 3:173217243-173217265 GAGCTGTGCTGCCTGGGGTTGGG + Intergenic
965975238 3:174613157-174613179 GTTCTGAGCTGCCTGGAGCTGGG + Intronic
965980418 3:174682531-174682553 GTGCTGAGATGCCTGGAGTTGGG - Intronic
965996695 3:174891853-174891875 GAGCTGTGCTGTCTGGGGTTAGG - Intronic
966142049 3:176767705-176767727 GTGCTGAGCTGTCTGGTGCTGGG - Intergenic
966401058 3:179547096-179547118 GTGCAGACCTGCCTGGAGCTGGG - Intergenic
966453823 3:180093274-180093296 GTGCTGAGCTTTCTGGAGCTGGG + Intergenic
966463601 3:180204078-180204100 GTGCTGAGCTGCCTGGAGCTGGG - Intergenic
967636716 3:191809590-191809612 GAACTGAGCTTCCTGGAGCTGGG - Intergenic
967758131 3:193193449-193193471 GTGCTGAGCCAGCTGGGGTTTGG - Intergenic
968004870 3:195235967-195235989 TGGCTGGGCTGCCTGGAGATTGG + Intronic
968005068 3:195237035-195237057 GAGCTGCGCTGCCTGGGTTTGGG + Intronic
968096379 3:195933558-195933580 ATGCTGAGCTGTCTGGAGTTAGG - Intergenic
968183126 3:196611965-196611987 GTTCTGCTCTGCCTGGAGCTAGG + Intergenic
968205050 3:196792071-196792093 GTGCTGACCTGGCTTGAGTTAGG + Intronic
968890104 4:3364334-3364356 GTGCTGAGCTTCCTGGCACTGGG + Intronic
969762631 4:9200381-9200403 AAGCTGTGCTGCCTGGGGTTGGG - Intergenic
970651992 4:18188990-18189012 GTGCTGAAGAGCCTAGAGTTTGG - Intergenic
970892921 4:21067741-21067763 GTGCTGAGCTTCCTGGAGCTGGG - Intronic
970915427 4:21328437-21328459 GTGCTGAGGTGCCTGGAGCTGGG + Intronic
970963288 4:21898339-21898361 GAGCTGTGCTGCCTGGGGTTGGG - Intronic
971165964 4:24184092-24184114 CTGCTAAGCTACCTGGAATTGGG + Intergenic
971690444 4:29827420-29827442 GTGCTGAGCTGCCTGAAGCTGGG - Intergenic
972007441 4:34128285-34128307 ATGCTGAGCTGCCTGGAGTTGGG - Intergenic
972253735 4:37332235-37332257 GAGCTGCACTGCCTGGGGTTGGG - Intronic
972253929 4:37333364-37333386 GTGCTGAGCTTCCTGGAGCTGGG - Intronic
972278510 4:37581690-37581712 GAGCTGTGCTGCCTGGGTTTTGG + Intronic
972579373 4:40380923-40380945 GTGCTGAGTTGCCTGGAGACGGG - Intergenic
973053857 4:45630043-45630065 GAGCTGTGTTGCCTGGGGTTTGG - Intergenic
973054020 4:45631242-45631264 GTACTGAGCTGCCTGGGGCTGGG - Intergenic
973327501 4:48878245-48878267 TAGCTGTGCTGCCTGGGGTTGGG + Intergenic
973685488 4:53365694-53365716 GTGCTGAGCTGCCTGCTGAAAGG - Exonic
973919695 4:55672876-55672898 GTGCTGAGCTTCCTGGAACTGGG + Intergenic
974224316 4:59018869-59018891 GAGCTGTGCTGCCTGTGGTTGGG + Intergenic
974266947 4:59598061-59598083 GAGTTGAGCTGCCTGGGGTTAGG - Intergenic
974267059 4:59598826-59598848 TTGCTGTGCTGCCTGGAGCTGGG - Intergenic
974333253 4:60506367-60506389 GTTCTGAGCTCCCTGGACATGGG - Intergenic
974469592 4:62301965-62301987 GAGCTGTGCTGCCTGGGGTTTGG - Intergenic
974559321 4:63496010-63496032 GTGCTGAGCAGCCTGGTTGTGGG - Intergenic
974589033 4:63919603-63919625 ATGCTGAGCTGCCTGGAATTGGG + Intergenic
974769971 4:66400305-66400327 GGGCTGAGCTGCCTGAAGCTAGG + Intergenic
974867828 4:67602745-67602767 GTGCTGAGCTGCCTGGAGCTGGG + Intronic
975104106 4:70548810-70548832 TTGCTGAGCTCCATGGAGGTGGG - Intergenic
975180114 4:71334454-71334476 GAGCTGCACTGCTTGGAGTTGGG + Intronic
975335399 4:73170130-73170152 AAGCTGTGCTGCCTGAAGTTGGG - Intronic
975365643 4:73524538-73524560 GAGCTGTGCAGCCTGGGGTTGGG + Intergenic
975592664 4:76016436-76016458 GTGCTGAGCTGCTTGGGGTTGGG + Intronic
975592848 4:76017519-76017541 GAGCTGTGTTGCCTGGAGTTGGG + Intronic
976161241 4:82201612-82201634 CAGCTGCACTGCCTGGAGTTGGG - Intergenic
976161318 4:82202056-82202078 GTGCTGGGCTGCCTGGAGTTGGG - Intergenic
976171606 4:82310600-82310622 GTGCTGAACTGCCTGGAGCTTGG + Intergenic
976254267 4:83083940-83083962 GGGCTGTGCAGCCTGGAGTTAGG + Intergenic
976444048 4:85110106-85110128 GAGCTGTGCTACCTGGGGTTAGG - Intergenic
976722170 4:88179172-88179194 GTGCTCAGCCGCCTGGAGCTAGG - Intronic
976728384 4:88239250-88239272 GTGATGAGCTGTCTGGAGCTGGG + Intergenic
976908352 4:90267615-90267637 GTGCTCAGCTGCCTGCAGCTGGG - Intronic
976943820 4:90739410-90739432 AAGCTGTGCTACCTGGAGTTGGG + Intronic
977037668 4:91975773-91975795 AAGCTGCACTGCCTGGAGTTGGG + Intergenic
977074102 4:92432111-92432133 ATGCTGATTTGCCTGGAGCTAGG + Intronic
977487375 4:97665814-97665836 GGGCTGAGGTGCCAGGGGTTTGG + Intronic
977873578 4:102123299-102123321 ATGCTAAGCTGCCTGGAGCTGGG + Intergenic
977985730 4:103380358-103380380 CTGCTAAGCTGCCTGGAGGCAGG - Intergenic
978008525 4:103650202-103650224 GTTCTGAGCCACCTGGAGCTGGG + Intronic
978520337 4:109609083-109609105 GTGCTGAGCTGCCTGGAGCTGGG + Intronic
979073352 4:116240373-116240395 GGTCTGAGCTGCCTGAAGCTGGG + Intergenic
979142863 4:117200850-117200872 GAACTGTGCTGCCTGGGGTTGGG - Intergenic
979184732 4:117773466-117773488 GTGCTGAGCTGCCTCAAGCTGGG - Intergenic
979213175 4:118131924-118131946 GTGCTGAGCTGCCTGGAACTGGG + Intronic
979395153 4:120178550-120178572 GTGCTGAGCTGCCTGGAGCTGGG - Intergenic
979892687 4:126119579-126119601 GTGCTGAGCCACTTGGAGCTGGG + Intergenic
980146134 4:128986524-128986546 GAGCAGTACTGCCTGGAGTTTGG - Intronic
980227027 4:129999428-129999450 GTGCTGAGCTGCCTGCAGTTGGG - Intergenic
980229611 4:130032353-130032375 GAACTGAGCTGCCTGGTGTCAGG - Intergenic
980621999 4:135320038-135320060 ATGCTAGGCTGCTTGGAGTTTGG + Intergenic
980646927 4:135653824-135653846 GTGCTGAGCTGCCTGGAGCTGGG - Intergenic
980657802 4:135812130-135812152 TTGTTGAGCTGCCTGGATTTGGG - Intergenic
980683021 4:136187974-136187996 CTTCTGAGCTGGCTGGAGCTAGG - Intergenic
980799996 4:137735273-137735295 CTGTTAGGCTGCCTGGAGTTGGG + Intergenic
980850896 4:138380119-138380141 GTCCTGAGTTGCCTGAAGTGGGG - Intergenic
980960629 4:139470990-139471012 GAGCTGTGCAGCCTGGGGTTAGG + Intronic
981329146 4:143488253-143488275 GAGCTGTGCAGCCTGGACTTAGG - Intergenic
981394640 4:144233605-144233627 GAGCTGCACTGCCTGGGGTTGGG - Intergenic
981530694 4:145751503-145751525 GTTCTGAGCTGCCTGGAACTGGG + Intronic
981880583 4:149606217-149606239 GTACTGGGCTGCCTGGAGCTGGG - Intergenic
981996263 4:150978164-150978186 GTGCTGAACCACCTGGAGCTGGG - Intronic
982068190 4:151672963-151672985 GTGCTGTGCTGTGTGGAGCTGGG + Intronic
982339780 4:154284927-154284949 AAGCTGTGCTGCCTGGGGTTAGG - Intronic
982629441 4:157812982-157813004 ATGCTGTACTGCCTGAAGTTTGG - Intergenic
982797992 4:159668526-159668548 GTACTGCGCTGCCTGGAATCAGG + Intergenic
982911503 4:161148416-161148438 GAGCTGCACTGCCTGGGGTTGGG - Intergenic
982911676 4:161149507-161149529 GTGCTGAGCTTCGTGGAGCTGGG - Intergenic
983017345 4:162629122-162629144 GTGCAGAACTGCCTGGAGCTGGG - Intergenic
983050207 4:163037766-163037788 GTGCTGTGCTTCCAGGAGATGGG - Intergenic
983130346 4:164011863-164011885 CATCTGTGCTGCCTGGAGTTAGG - Intronic
983389026 4:167103868-167103890 GTGATGACCTGCCTGGAGTTGGG - Intronic
983493216 4:168412803-168412825 GTGTTGAGCTGCCTGGAGCTGGG - Intronic
983908194 4:173206248-173206270 AAGCTGTGCTGCCTGGGGTTGGG + Intronic
984310503 4:178052505-178052527 GTGTTGAGTTGCCTGGAGTTAGG + Intergenic
984358829 4:178701346-178701368 GAGCTGAGCTGCCAGGAGTTGGG - Intergenic
984396720 4:179211333-179211355 GTTCTGAGCTGCCTAGAGATGGG + Intergenic
984529600 4:180900999-180901021 GTGCTGAGCAACCTGGAGCTGGG + Intergenic
985229405 4:187798937-187798959 AAGCTGTGCTGCCTGGGGTTGGG - Intergenic
986544331 5:8879479-8879501 GTTCAGAGCTGCCTGAAGCTGGG + Intergenic
986631054 5:9774799-9774821 GTGCTGAGCTGCCTGAAGCTGGG + Intergenic
986631239 5:9775894-9775916 GAGCTGAGCTGCCTGGAGTTGGG + Intergenic
986639545 5:9858403-9858425 ATGCCGTGCTGCCTGAAGTTGGG + Intergenic
986756433 5:10840493-10840515 GTGCTGAACTGCCTGGGGCTGGG - Intergenic
987458000 5:18170390-18170412 GTGCTAAGCTTCCTGGAGCTGGG - Intergenic
987485838 5:18525120-18525142 GTTCATAGCTGACTGGAGTTAGG - Intergenic
987551139 5:19383602-19383624 TTGCTGAGGTTCTTGGAGTTAGG - Intergenic
987616218 5:20277281-20277303 GTGCTGAGTTGCCTTGAGTTGGG - Intronic
987769986 5:22289712-22289734 GTGCTGTGCTGCCTGGGGTCAGG - Intronic
988039736 5:25874156-25874178 GTACTGAGATGCCTAGAGCTGGG + Intergenic
988117956 5:26920616-26920638 GCGCTGAGCTGCCTGCAGCTGGG - Intronic
988265217 5:28941223-28941245 TTGCTGAGCTGCAAAGAGTTAGG + Intergenic
988376343 5:30440056-30440078 ATGCTGAGATACCTGGAGGTGGG - Intergenic
988608305 5:32701893-32701915 GTGCTGAGCTGCCTGAAGCCAGG + Intronic
988931639 5:36040851-36040873 GAGCTGCCCTGCCTGGAGTTGGG - Intronic
988931744 5:36041512-36041534 GTGCTAAGCTGCCTGGAGTTGGG - Intronic
988939461 5:36128031-36128053 GTCCTGAGCTGCCTGGAGGTGGG - Intronic
988956267 5:36323628-36323650 GTTCTGAGCCACCTGGAGCTGGG + Intergenic
989472143 5:41832311-41832333 GTGCTGAACCGCCTGGAACTGGG - Intronic
989489466 5:42033163-42033185 GAGCTGTGCAGCCTGGGGTTGGG + Intergenic
989690900 5:44142942-44142964 GAGCTGTGCTGTCTGGGGTTGGG + Intergenic
989970821 5:50521825-50521847 GAGCTGTGCAGCCTGGGGTTAGG + Intergenic
990578870 5:57149773-57149795 GTGTTGAGCTGTCTGGATCTGGG + Intergenic
990579694 5:57156153-57156175 TTGCTGAGCTGCCTGGAGCTGGG - Intergenic
990734195 5:58841742-58841764 GATCAGATCTGCCTGGAGTTAGG - Intronic
990828044 5:59923486-59923508 GTCTTGAGCTACCTGGAGCTTGG - Intronic
990900071 5:60739944-60739966 GTGCTGAGCTGCCTGTAGCTGGG - Intergenic
990922233 5:60979943-60979965 GTGCAGAGCTGCCTGGAGCTGGG - Intronic
991209030 5:64083777-64083799 GTGCTGAGCTGCCTGAAGCTGGG + Intergenic
991237872 5:64419669-64419691 GTTCTGAGCTGCCTGAAGCTGGG - Intergenic
991395181 5:66197890-66197912 GTGCTGAGCTGCCTAGAGCTAGG + Intergenic
991395362 5:66198957-66198979 GAGCTGCACTGCCTGGGGTTGGG + Intergenic
991682011 5:69149428-69149450 CTGCTGAGCTGCCTGGAGTTGGG + Intergenic
992309676 5:75482660-75482682 GCGTTGAGCTGCCTGGAGCTGGG - Intronic
992531665 5:77658678-77658700 GTTCTGAGCTGCCTGGAGCTGGG + Intergenic
993011482 5:82488353-82488375 GCTCTGAGCTGACTGGAGGTGGG + Intergenic
993138408 5:83998911-83998933 GTGCTGAGCTGCCCAGAACTGGG - Intronic
993155711 5:84219133-84219155 GCTCTGAGCTGCCTGGAGCTGGG - Intronic
993580307 5:89652909-89652931 GAGCTGTGCAGCCTGGAGTTAGG - Intergenic
993711255 5:91227808-91227830 GTGTTGAGCTGCCGGAAGTTTGG - Intergenic
993981204 5:94545409-94545431 GAGCTGTGCTGCCTGGGGTTGGG - Intronic
993981383 5:94546495-94546517 GTGCTGAGCCACCTGGAGCTGGG - Intronic
994217741 5:97158499-97158521 GTGCTGAGCTGCCTGGAACTGGG + Intronic
994229468 5:97297432-97297454 GTGCTGAACTGCCTGGGGTTGGG + Intergenic
994310792 5:98268065-98268087 GAGCTGTGCTGCCTGAAGTTTGG - Intergenic
994310895 5:98268730-98268752 GTGCTGTGATGCCTGGAGTTGGG - Intergenic
994320282 5:98386953-98386975 GAGCTGTGCCGCCTGGGGTTGGG + Intergenic
994344021 5:98663879-98663901 GTTCTGAGCTGCCTGGAACTAGG - Intergenic
994533752 5:101000453-101000475 ATACTGGGCTGCCTGGAGTTAGG - Intergenic
995019482 5:107351445-107351467 GTGTTGAGCTGCCTGGAGCTAGG + Intergenic
995185448 5:109266837-109266859 ATGTTGTGCTGCCTGGGGTTGGG - Intergenic
995265453 5:110153491-110153513 CTGCTGAGCTGCCTGGAACTAGG - Intergenic
995268534 5:110194308-110194330 GTTCTGAGCTGCCTGAACTTGGG + Intergenic
995290319 5:110444029-110444051 GAGATGTGCTGCCTGGGGTTGGG + Intronic
995557708 5:113346126-113346148 GTGCTGAGCCACCTGGAGCTTGG + Intronic
995778037 5:115746335-115746357 GAGCTGTGCAGCCTGGGGTTAGG + Intergenic
996666671 5:126067346-126067368 GTGCTGAGCTGCCTGGAACTGGG - Intergenic
996906643 5:128608616-128608638 AAGCTGTGCTGCCTGGGGTTGGG + Intronic
997002980 5:129784435-129784457 GAGCTGTGCTTCCTGGATTTAGG - Intergenic
997003162 5:129785520-129785542 GTGCTGAGCTACCTGGATCTGGG - Intergenic
997059953 5:130488850-130488872 GTGCTGAGCTGCCTAGAGCTGGG - Intergenic
997255772 5:132426934-132426956 GTGTTGGGCTGCCTGGAGCCCGG + Intronic
997359502 5:133285765-133285787 GTGCTGAGCTGGGTGCAGCTGGG - Intronic
997624782 5:135324331-135324353 CTGCTGGGCCGCCTGGCGTTTGG + Intronic
997902203 5:137777386-137777408 GTGCAGAGCTAGCTTGAGTTTGG - Intergenic
998041507 5:138953571-138953593 CTGCAGAGCAGCCTGGAGATGGG + Intronic
998961431 5:147491119-147491141 AGGCTGAGCTCGCTGGAGTTGGG - Intronic
999306916 5:150525502-150525524 GTCGTGAGCAGCCTGGAGTTGGG + Intronic
999763179 5:154718535-154718557 GTGGTGACCTCCCTGGAGTGGGG - Intronic
999919399 5:156302836-156302858 ATGATGAGCTTCCTGGAGCTGGG + Intronic
1000270146 5:159676674-159676696 GAGCTGTGCAGCCTGGGGTTAGG - Intergenic
1000399587 5:160811972-160811994 GTTCAGAGCTGTCTGGAGCTGGG - Intronic
1000517946 5:162262705-162262727 CTGCTGAGCTACCTGGAGCTGGG - Intergenic
1000539231 5:162519774-162519796 GTACTGAGCTACCCGGAGCTGGG + Intergenic
1001177771 5:169487537-169487559 GTTCTGAGCCACCTGGAGCTGGG - Intergenic
1001364118 5:171120182-171120204 GTGCTGAGCCACCTGGAACTGGG + Intronic
1001535023 5:172492189-172492211 CTGCTGTGCAGCCTGGGGTTGGG + Intergenic
1001609640 5:172989791-172989813 GTGCTGGGATGACAGGAGTTGGG + Intronic
1002009936 5:176271028-176271050 GAGTTGTGCTGCCTGAAGTTGGG - Intronic
1002216791 5:177641280-177641302 GAGTTGTGCTGCCTGAAGTTGGG + Intergenic
1002302836 5:178267201-178267223 GTGATGAGCTGCGGGGAGCTGGG + Intronic
1002854183 6:1022955-1022977 GGCCTGAGCTGCAGGGAGTTTGG - Intergenic
1003952211 6:11127002-11127024 GTGCTGAGCTGCCTGGAGCTGGG + Intronic
1003984181 6:11419181-11419203 ATGCTGTGTTGCCTGGTGTTGGG - Intergenic
1006018477 6:31102507-31102529 TTGCTGAGCCACCTGGAGCTGGG + Intergenic
1006386295 6:33732895-33732917 GTGCTCAGATGCCTGGGGTAGGG - Intronic
1006554119 6:34851495-34851517 ATGCTAAGCTGCCTGGAATGAGG + Intronic
1007001712 6:38319737-38319759 GAGCTGTGCTGCCTGGGGTTGGG + Intronic
1007022253 6:38532483-38532505 GAGCTGAGCAGCCTGTGGTTGGG - Intronic
1007190416 6:40011811-40011833 GAGCTGTGCTGTCTGGGGTTGGG + Intergenic
1007376291 6:41459122-41459144 GACCTGAGGTGCCTGGATTTTGG + Intergenic
1008100987 6:47391411-47391433 ATGCTATGCTGCCTGGAGTTGGG + Intergenic
1008101090 6:47392134-47392156 GAGCTGTGCTGCCTGGAACTGGG + Intergenic
1008192474 6:48476265-48476287 GTGCTGAGCTGTCTGGGGCTGGG - Intergenic
1008238836 6:49084051-49084073 GAACTGTGCTGCCTGAAGTTGGG - Intergenic
1008304492 6:49885525-49885547 GGGCTGAGCTCCCAGGAGCTGGG + Intergenic
1008503154 6:52203044-52203066 ATGCTGTGCTGTCTGGTGTTTGG + Intergenic
1008707472 6:54181050-54181072 GTACTGAGCTGCCTGGAACTGGG + Intronic
1008731669 6:54490887-54490909 ATGCAGAGCTGCCTGGAGCTGGG + Intergenic
1008848410 6:55995852-55995874 GTGCTGAGCTGCCTAGAGCTGGG + Intergenic
1008881846 6:56387971-56387993 GAGCTGAACTGCCTGGAGCTGGG - Intronic
1009608727 6:65908329-65908351 GTGCTGAGCTGCCTGGAACCAGG - Intergenic
1009687873 6:66986926-66986948 GAGCTGTGCAGCCTGGGGTTAGG + Intergenic
1010139988 6:72602727-72602749 GAGCTGTGCAGCCTGGGGTTAGG + Intergenic
1010182032 6:73097639-73097661 GTGCTGAGGTGCCTGGAGCTTGG - Intronic
1010280639 6:74018977-74018999 GAGCTGTACTGCCTGGAGTTGGG - Intergenic
1010313827 6:74421150-74421172 GTGCTGAGCCACCTGGAACTGGG - Intergenic
1010676763 6:78754317-78754339 GTTTTGAGCTGCCTGGAACTGGG - Intergenic
1010838925 6:80624038-80624060 ATGCTGAGTTGCCTGGAACTGGG - Intergenic
1010975744 6:82312026-82312048 TCTCTGAGCTGCCTGGAGCTGGG + Intergenic
1011019069 6:82790034-82790056 GTGCTGAGCTGTCTGGAGGTGGG - Intergenic
1011236125 6:85218890-85218912 GTGCTGGGCTGCCTGGAGCTTGG - Intergenic
1011271202 6:85581117-85581139 GTGCTGAGCTTCCTGGAGCTGGG - Intronic
1011291066 6:85778304-85778326 CTGCTGAGCCACCTGGAGCTGGG + Intergenic
1011341076 6:86314499-86314521 GTGCTGAGCTTCCTGGAGCTAGG - Intergenic
1011386351 6:86802355-86802377 AAGCTGTGCTGCCTGGTGTTAGG + Intergenic
1011446914 6:87451246-87451268 AAGCTGCACTGCCTGGAGTTGGG - Intronic
1011598326 6:89037455-89037477 GAGCTGCACTGCCTGGGGTTGGG - Intergenic
1011791737 6:90906601-90906623 GTGCTGAGCCACCTGGAATAGGG + Intergenic
1012057029 6:94426419-94426441 ATGCTGTGCTACTTGGAGTTGGG + Intergenic
1012224613 6:96689432-96689454 ATGCTGAGCTGCCTGGGGCTGGG - Intergenic
1012483031 6:99689448-99689470 GAGCTGTGCTGCCTGTTGTTGGG - Intergenic
1012483205 6:99690484-99690506 GTGCTAAGCTGCCTGGTGCTGGG - Intergenic
1012620689 6:101340157-101340179 GAGCTGTGCAGCCTGGGGTTAGG + Intergenic
1012892056 6:104907935-104907957 GAGCTGTGCTGCCTGAGGTTTGG - Intergenic
1013390389 6:109680179-109680201 GTTCTTAGCTTCCTTGAGTTGGG - Intronic
1013673325 6:112429564-112429586 GTGCTGAGCTTCCTGGAGATGGG + Intergenic
1013908660 6:115247361-115247383 GTACCGAGCTGCCTGGAGCTGGG - Intergenic
1014073815 6:117214727-117214749 GTGCTGAGCTGCCTAGAGCTGGG + Intergenic
1014692543 6:124578835-124578857 GCGCTGAGCTGCCTGGAGCTGGG - Intronic
1014794655 6:125710666-125710688 AAGCTGCACTGCCTGGAGTTGGG - Intergenic
1014840689 6:126217610-126217632 GTGCTGAGCTGCCTGGAGCTGGG + Intergenic
1014862382 6:126485293-126485315 GTGCTGAGCTACCTGGTGCTGGG - Intergenic
1015460823 6:133488526-133488548 GTGTTGAGCTGCCTGGAGCTGGG - Intronic
1015578877 6:134702113-134702135 AAGCTGTGCTGCCTGGGGTTAGG + Intergenic
1016021972 6:139245555-139245577 GTGCCAAGCTGCCTGAAGCTGGG + Intronic
1016135152 6:140532103-140532125 GAGCTGTGCAGCCTGGGGTTAGG - Intergenic
1016228377 6:141771354-141771376 ATGCTGAGCTTCCTGGAGCTGGG + Intergenic
1016228539 6:141772423-141772445 GAACTGTGCTGCCTGGGGTTGGG + Intergenic
1016229734 6:141788621-141788643 GAGCTGCGCTGCCTGGGTTTGGG - Intergenic
1016294876 6:142563705-142563727 CTGTTGAGCTGCCTTGGGTTTGG + Intergenic
1016925161 6:149337933-149337955 GAGCTGAGATGCATGGAGTCAGG + Intronic
1017491491 6:154949714-154949736 ATGCTGAGCTGTCTAGATTTGGG + Intronic
1017491551 6:154950093-154950115 GAGCTGTGCTGCCTGGGGTTGGG + Intronic
1018372902 6:163185145-163185167 GTGCAGAGGTGCCTGGAGTGTGG - Intronic
1018606823 6:165606433-165606455 GTGCTGTTCTGCATGGTGTTTGG - Intronic
1018917496 6:168145777-168145799 GTGCTGAGGCACCTGGAGCTGGG + Intergenic
1019044333 6:169131647-169131669 GAGCTGTGCTGCCTGGGTTTGGG - Intergenic
1019443066 7:1057037-1057059 GTCCTGAGCTGCCGGGAGGGAGG + Intronic
1020077656 7:5269105-5269127 GTGCTGAGCTGCCAGGAGATGGG - Intergenic
1020391424 7:7662237-7662259 TTGCTGAGCTCCATGGGGTTGGG + Intronic
1020485271 7:8713832-8713854 GTTCTGAGCTGCCTGGAGCTTGG + Intronic
1020485454 7:8714889-8714911 GAGCTGCCCTGCCTGGGGTTGGG + Intronic
1020514942 7:9106557-9106579 GAGCTGTGCAGCCTGGGGTTAGG - Intergenic
1020574709 7:9912544-9912566 GTGCTGAGTTGCCTGAAGCTTGG + Intergenic
1020607287 7:10355705-10355727 GTGCTGAGCTGCCTGGAACTGGG + Intergenic
1020852246 7:13369293-13369315 GTGCTCAGATGCGTGGAGCTTGG + Intergenic
1021203647 7:17753652-17753674 GAGCTGTGCAGCCTGCAGTTAGG + Intergenic
1021658136 7:22892100-22892122 GGGCTGATCTGCCTGGAGCCAGG - Intergenic
1021728245 7:23570950-23570972 GCACTGAGCTGCCTGAAGTTGGG + Intergenic
1021842607 7:24732973-24732995 ATGTTGTGCTGCTTGGAGTTGGG - Intronic
1021884765 7:25128070-25128092 GCACTGAGCTGTCTGGAGCTAGG + Intergenic
1022080142 7:27012346-27012368 GAGCTGTGCAGCCTGGGGTTAGG - Intergenic
1022348173 7:29538765-29538787 GTGCTCTGCAGCCTGGGGTTAGG - Intergenic
1022366853 7:29730067-29730089 GTGCTAAGCTGCCTGGAGCTGGG + Intergenic
1022542036 7:31146471-31146493 GAGCTGTGCTGCCTGGGGTTGGG + Intergenic
1022749761 7:33212879-33212901 GTGCTGAGCCACCTGGAACTAGG + Intronic
1022970935 7:35516593-35516615 CTGCTGGACTGCCTGGAGCTGGG - Intergenic
1023208853 7:37781782-37781804 GTGATGAGCTGCCTGGAGTTGGG + Intronic
1023208957 7:37782455-37782477 GTGCTGTGATGCCTGGAGTTGGG + Intronic
1023583270 7:41704288-41704310 GTGCTGAGCTGCATGGGGGTGGG + Intergenic
1023716369 7:43047744-43047766 GTGCTGAGCTGCCTGGAGCTAGG - Intergenic
1024081686 7:45861954-45861976 TTGCTGAGATGCCTGTACTTGGG + Intergenic
1024170394 7:46778768-46778790 GTTCTGAGCTGCCTGGAGCTAGG - Intergenic
1024410790 7:49038927-49038949 GAGCTGTGCAGCCTGCAGTTAGG - Intergenic
1024662308 7:51510388-51510410 GTGCTGAGCCACCTGGAGCTTGG + Intergenic
1024704220 7:51939268-51939290 GTGCTGTGCTGCCTTTGGTTGGG + Intergenic
1024855216 7:53770815-53770837 GAGCTGAGCTGCCAGGAGAATGG - Intergenic
1025061635 7:55813515-55813537 GGGCTGCACTGCCTGGAGTTGGG - Intronic
1025201477 7:56964579-56964601 GTACTGAGCTGCCAGGAGACGGG + Intergenic
1025670468 7:63612353-63612375 GTACTGAGCTGCCAGGAGACGGG - Intergenic
1025718310 7:63984037-63984059 ATGCTGAGCTGCCCAGAGCTGGG - Intergenic
1026127907 7:67595673-67595695 GTGCAGTGCTGCCTGGCATTTGG + Intergenic
1026148789 7:67770979-67771001 GAGCTGAGCTGCCTGAGGTTGGG + Intergenic
1027405276 7:77854316-77854338 CTGCTGAGCTGCCTGGAGCTGGG + Intronic
1027524189 7:79245903-79245925 GTGCTGGGCTGCCTGGTGCTGGG - Intronic
1027674822 7:81143962-81143984 GTGCTGAGCAGCCTGGAACTGGG - Intergenic
1027921400 7:84399904-84399926 ATGCTAAGATGCCTGGAGTTGGG - Intronic
1028160864 7:87483480-87483502 GAGCTATGCTGCCTGGGGTTGGG - Intergenic
1028181596 7:87730840-87730862 GTGCTGAGCTGCCTGGACCTGGG - Intronic
1028299445 7:89180019-89180041 ATGCTATCCTGCCTGGAGTTTGG + Intronic
1028354225 7:89886963-89886985 GTGCTGAGCTGTCTGGAACTAGG + Intergenic
1028521892 7:91741653-91741675 GTTCTGAGCCACCTGGAGCTGGG + Intronic
1028667814 7:93366944-93366966 GTGCTGGGCTGCCCTGAGTGTGG - Intergenic
1029174645 7:98655983-98656005 GTGCACATCAGCCTGGAGTTGGG + Intergenic
1029825411 7:103187392-103187414 GTGCTAAGCTACCTGGAGCTGGG - Intergenic
1030391348 7:108931864-108931886 GAGCCGTGCTGCCTGGGGTTGGG + Intergenic
1030431493 7:109454915-109454937 GTGATGAGCCACCTGGAGCTGGG + Intergenic
1030476707 7:110043475-110043497 ATGCTGTGTTGCCTGGGGTTAGG + Intergenic
1030662816 7:112239507-112239529 ATGCTGAGCTGTCTGGAATTGGG - Intronic
1030966410 7:115997212-115997234 GTGCTGAGCTACCTGGATCTTGG - Intronic
1031033988 7:116767054-116767076 CTGCTGATCTCCCTGGACTTTGG + Intronic
1031098424 7:117448553-117448575 GAGCTGTGCGGCCTGGGGTTGGG - Intergenic
1031098593 7:117449527-117449549 GTGCTGAGCCACCTGGAACTGGG - Intergenic
1031260183 7:119507887-119507909 GTGCTGAGCTGCCTGGACCTGGG - Intergenic
1031412397 7:121456200-121456222 ATGCTGAGCTTCCTGGAGTTGGG + Intergenic
1031546059 7:123052873-123052895 CTGCTGAGCTGCCTGGAGCTAGG + Intergenic
1031649487 7:124269631-124269653 CTGCTGAAGTGCCTGGATTTGGG + Intergenic
1031657945 7:124380890-124380912 GTGTTGAGCTGCCTGAAGGTGGG - Intergenic
1031753929 7:125613355-125613377 GTGCTGAGCTTCATGGAGCTAGG - Intergenic
1031862401 7:126995021-126995043 GTGCTGAACCACCTGGAGCTGGG - Intronic
1031905938 7:127459353-127459375 GTGCTGAGCTGCCTGGAACTGGG - Intergenic
1032138672 7:129306969-129306991 GTGCTGAACTGCCTGGACCTAGG + Intronic
1032942552 7:136811252-136811274 GTGCTAAGCTGCCTGGGACTGGG - Intergenic
1033542423 7:142369248-142369270 GGGCTGTGCTGCCTGAGGTTGGG + Intergenic
1033813957 7:145050557-145050579 GTGCTGAGCTACCTGGACTTGGG + Intergenic
1033877728 7:145842859-145842881 GAGCTGTGCTGCCTGCAGTTGGG + Intergenic
1033947620 7:146741110-146741132 ATACTGTGCTGCCTGGGGTTGGG + Intronic
1034031312 7:147767973-147767995 GTGATAAGCTGCCTGGAACTAGG - Intronic
1034398060 7:150842438-150842460 GTGCTGTGCTGCCTGGGGTTGGG - Intronic
1034398186 7:150843141-150843163 GTGTTGAGCTGTCTGGAGCCAGG - Intronic
1034581666 7:152049495-152049517 CTGCTGAGCTTCCTGGAGCTGGG + Intronic
1035753939 8:2017295-2017317 ATGCAGAGCTGCCTGTAGCTTGG + Intergenic
1036272721 8:7322118-7322140 AAGCTGTGCTGCCTGGGGTTGGG - Intergenic
1036348627 8:7988230-7988252 AAGCTGTGCTGCCTGGGGTTGGG + Intergenic
1036446892 8:8829288-8829310 GTGCTGAGCTGCACGGAGAAGGG - Intronic
1036557997 8:9876801-9876823 TTGCTGGGCTCCATGGAGTTGGG - Intergenic
1036652801 8:10655789-10655811 GTGCAGGGCTGCCTGGAGGCAGG + Intronic
1036843897 8:12148699-12148721 AAGCTGTGCTGCCTGGGGTTGGG + Intergenic
1036865267 8:12391019-12391041 AAGCTGTGCTGCCTGGGGTTGGG + Intergenic
1037119561 8:15266850-15266872 ATGCTATGCTGCCTGGACTTGGG - Intergenic
1037616570 8:20524489-20524511 GTGCTTGGCTGCTTGGAATTTGG + Intergenic
1038437037 8:27543500-27543522 GTGCTGAGCTGCATGTAACTGGG - Intronic
1039282208 8:35997961-35997983 GAGCTGTGCAGCCTGGGGTTAGG + Intergenic
1039410976 8:37354903-37354925 GTGCTGAGGTACCAGGAGATAGG + Intergenic
1039656355 8:39412179-39412201 GTAGTGGGCTGCCTGGAATTGGG - Intergenic
1039886990 8:41660448-41660470 GTACTGAGCTGCCCCGAGCTGGG + Intronic
1040628082 8:49175303-49175325 GAGCTGTGCAGCCTGGGGTTGGG - Intergenic
1041141092 8:54820229-54820251 GAGCTGTGCTGCCTGGGGCTGGG + Intergenic
1041415943 8:57609097-57609119 GTGCTGTGGTGGCTGGGGTTGGG - Intergenic
1041606865 8:59792398-59792420 GAGCTGTGCTTCCTGGAATTGGG - Intergenic
1041615975 8:59907211-59907233 GAGCTGTGTTGCCTTGAGTTGGG - Intergenic
1041616151 8:59908274-59908296 GTGGTGAGCTGCCTGGAGCTGGG - Intergenic
1041883243 8:62778068-62778090 ATGCTGAGCTGCCTGGAGCTGGG + Intronic
1041947321 8:63460505-63460527 ATGCTGTGCTGCCTGGAGTTGGG + Intergenic
1042081687 8:65060774-65060796 GTGCTTAGCAGGCTGTAGTTTGG + Intergenic
1042428292 8:68673909-68673931 GTGTTGAGCTGCCTGGAGCTGGG - Intronic
1042980363 8:74519448-74519470 GTGTTGAGCTGCCTGGAGCTGGG - Intergenic
1043307728 8:78817983-78818005 ATGCTGTGCTGCCTGGGTTTGGG + Intergenic
1043312302 8:78876024-78876046 GTGCTGAGCCACCCAGAGTTGGG + Intergenic
1043340323 8:79229944-79229966 AAGCTGTGCAGCCTGGAGTTAGG + Intergenic
1043763087 8:84094586-84094608 AAGCTGGGCTGCCTGGAGTTGGG + Intergenic
1043998119 8:86843830-86843852 GTGCTGAGCTGCCTGGAGCTTGG - Intergenic
1044193130 8:89342977-89342999 GAGCTGTGCAGCCTGGGGTTAGG + Intergenic
1044635377 8:94319118-94319140 CTGCTGAGCTACCTGGAGGTGGG + Intergenic
1044878074 8:96692462-96692484 ATGCTGAGCTGCCTGGAGCTGGG - Intronic
1045041188 8:98226624-98226646 GTCCTGAATTGCCTGGAGTTGGG + Intronic
1045172070 8:99682621-99682643 GTACTGAGCTGCCTGGAGATGGG + Intronic
1045172411 8:99686225-99686247 GTACTGAGCTGCCTGGAGCTGGG + Intronic
1045592380 8:103612922-103612944 GTGCTGAGCCACCTGGAACTGGG + Intronic
1045600290 8:103707622-103707644 GCACTGTGTTGCCTGGAGTTGGG + Intronic
1045621334 8:103981209-103981231 CTGCTGAGCTGCCTGGAACTGGG - Intronic
1045800787 8:106097836-106097858 ATACTGAGCTGCATGGAGCTAGG - Intergenic
1046114042 8:109764595-109764617 GTGCTGAGTTACCTGGAACTGGG + Intergenic
1046224757 8:111263242-111263264 GTGCTGTGCTCAGTGGAGTTAGG - Intergenic
1046317972 8:112531483-112531505 ATACTCAGCTGCCTGGAGTTTGG - Intronic
1046335461 8:112781016-112781038 GAGCTGCATTGCCTGGAGTTAGG - Intronic
1046399985 8:113692131-113692153 GTGCTGTGCTGCCTGGGGTTGGG + Intergenic
1046463175 8:114569385-114569407 GTGCTGAGCTGCCTGAAGCTGGG + Intergenic
1046557237 8:115790291-115790313 AAGCTGTGCTGCCTGGGGTTGGG - Intronic
1047138241 8:122106421-122106443 ATGCTGAGCTGCCTGGGTCTGGG + Intergenic
1047342660 8:123998426-123998448 GTACTGAGTTGCCTGGAGCTGGG + Intronic
1047352310 8:124087949-124087971 GTGCTCAGCTTCCTGGAGCTGGG + Intronic
1047910063 8:129518256-129518278 GAGCTGTGCTGCCTGGGTTTAGG - Intergenic
1048646608 8:136427995-136428017 GAGCTGTGCTGCCTAGGGTTGGG - Intergenic
1048646765 8:136429062-136429084 GTGCTGAGCCACCTGGAACTGGG - Intergenic
1048706117 8:137155574-137155596 GTGCTGAACTGGCTGGAGCTAGG + Intergenic
1049392994 8:142381600-142381622 GTGCTGAGGGGTCTGGAGTGAGG + Intronic
1049452171 8:142668022-142668044 CAGCTGAGCTGCCCGGTGTTTGG - Intronic
1049479981 8:142818000-142818022 GTGCTGAGGTGCCTGGCTCTGGG + Intergenic
1049675437 8:143886937-143886959 CAGCTGAGCTGCCAGGAGCTGGG - Intergenic
1050061225 9:1711789-1711811 GAGCTGAGCTGGATGGAGATGGG + Intergenic
1050145313 9:2560789-2560811 GTGCAGAGCTGCCTGGAGCTGGG - Intergenic
1050248117 9:3713355-3713377 GAGCTGTGCTGCCTGGGGTTGGG - Intergenic
1050290458 9:4148806-4148828 TTGCTGAGAAGCCTGGAGTGGGG + Intronic
1050301404 9:4262354-4262376 GTGCTGAGTGGCATGGATTTGGG + Intronic
1050508347 9:6369859-6369881 GTGCTGAGCTGCCTAGAGCTAGG - Intergenic
1050618499 9:7428653-7428675 GTCCTGAGCTGCCTGGAGTTGGG - Intergenic
1050618680 9:7429835-7429857 GAGCTGTGCTGCCTGGGTTTGGG + Intergenic
1050644194 9:7701882-7701904 ATGTTGAGCTGCCTGGAACTGGG + Intergenic
1050807203 9:9695386-9695408 GAGCTGGGTTGCCTGAAGTTGGG + Intronic
1050913894 9:11107625-11107647 GAGCTGTGCAGCCTGGAGTTAGG - Intergenic
1050930077 9:11311884-11311906 ATGCTGAACTGCCTGCTGTTGGG + Intergenic
1051207521 9:14704107-14704129 GTGCTATGCTGCTTGGAGTTGGG - Intergenic
1051354058 9:16224559-16224581 GTTCTTAGCTTCCTTGAGTTGGG - Intronic
1051469610 9:17423087-17423109 ATGCTGGGTTGCCTGGAGTTGGG + Intronic
1052094079 9:24363028-24363050 TTGCTGGGCCGCCTGGAGTTGGG - Intergenic
1052459348 9:28742202-28742224 ATGCTGTCCTGCCTGGAGTTGGG + Intergenic
1052531583 9:29691800-29691822 GTGCTGTGCTGCCTGGGGTTGGG - Intergenic
1052573685 9:30264270-30264292 ATGCTGGGCTGCTTGGATTTGGG + Intergenic
1052607552 9:30723756-30723778 GTGCTGAGCTACCTGGAGCTGGG - Intergenic
1052625626 9:30973289-30973311 GAGCTGAGCTGCCAGGTGTTGGG + Intergenic
1053204588 9:36175081-36175103 GTGTTGAGCCGCCTGGAGCTGGG - Intergenic
1055073927 9:72194558-72194580 GAGCTGTGTGGCCTGGAGTTAGG + Intronic
1055283543 9:74702763-74702785 GTGCTGCCCTGGCTGGGGTTGGG - Intergenic
1055302167 9:74892814-74892836 GTGCTGAGCTACCTGGAGCTGGG - Intergenic
1055387378 9:75776584-75776606 GTGCTGAGTCACCTGGAGCTGGG - Intergenic
1055579848 9:77697585-77697607 GTGCTGTGCTGCTTGGAGCTGGG + Intergenic
1055826961 9:80338862-80338884 GAGCTGTGCTGCCTAGTGTTGGG - Intergenic
1055827122 9:80339927-80339949 TTGCTGAGCTGCCTGGAACTGGG - Intergenic
1056338941 9:85604246-85604268 GTGCTGAGTTGCCTGGAGCTAGG - Intronic
1056516864 9:87360206-87360228 GTGCTGAGCTCCCTGGAGCTGGG - Intergenic
1056531016 9:87487758-87487780 GTGCTGGCCTTCCTAGAGTTTGG - Intergenic
1057644554 9:96860399-96860421 GTGCTAGGCTGCCTGGAGTTGGG - Intronic
1057896595 9:98913869-98913891 GTGCTGGGATGCCTGGCATTTGG + Intergenic
1058013598 9:100004637-100004659 ATACTGTGCTGCCTGGGGTTGGG + Intronic
1058249137 9:102669339-102669361 GCACTGTGCTGCCTGGGGTTGGG + Intergenic
1058551811 9:106122939-106122961 GTGTTGAGGTTCCTGGAGGTTGG + Intergenic
1059041889 9:110823397-110823419 GTGCTGAGCTGCCTGGAGCTGGG - Intergenic
1059455150 9:114395663-114395685 CTGCTTGGCAGCCTGGAGTTGGG - Intergenic
1059555542 9:115276759-115276781 GAGCTGAGTTGCCTGGGGTTAGG + Intronic
1059839207 9:118192641-118192663 ATGCTGAGCTGCCTGGAGTTGGG - Intergenic
1060166583 9:121422408-121422430 ATGCTAAGCTGCCTAGAGCTGGG + Intergenic
1060304610 9:122399176-122399198 GTGCTGAGCTGCCTACAACTGGG - Intergenic
1060318936 9:122537375-122537397 GTGCCGAGCTGCCTGTCTTTGGG + Intergenic
1060787598 9:126462970-126462992 GTGCTGAGCTGCCTTCTGTCTGG - Intronic
1061617516 9:131790112-131790134 GTGCTGGGCAGTCTGGAGGTGGG + Intergenic
1061809803 9:133155659-133155681 GTGCCTAGCTCACTGGAGTTTGG - Intronic
1062017113 9:134296547-134296569 AGGCAGAGCTGCCTGGAGGTGGG - Intergenic
1062115328 9:134805435-134805457 GTGCTGGGCAGCCTGGAGGGCGG + Intronic
1062374590 9:136256183-136256205 GGGCTGAGCTCCCTGGAGCAGGG - Intergenic
1062614769 9:137391369-137391391 CTGCTGAGGTGCCTGGGGCTGGG - Intronic
1186691898 X:11986172-11986194 GTGCTGAGCCTCCTGGAGCTGGG - Intergenic
1186911761 X:14174643-14174665 GGGCTGTGCTGCCTCGGGTTGGG + Intergenic
1187132640 X:16517524-16517546 GAGCTGTGCTGCCTGAGGTTGGG - Intergenic
1187132889 X:16519073-16519095 TTGCTGAGCTGCCTGGAGCTGGG - Intergenic
1187314939 X:18184138-18184160 ATGGTGAGCTGCATGGAGCTGGG - Intronic
1187588377 X:20689428-20689450 GTGCTGAGCTACCTTGAACTGGG + Intergenic
1187618042 X:21020070-21020092 GAGCTGTGCTGCCTGAGGTTGGG - Intergenic
1187636735 X:21237782-21237804 TTGCTGAGCCACCTGGAGCTAGG - Intergenic
1187836320 X:23435643-23435665 GTGCTGAGCTGCCTGGAGTTGGG - Intergenic
1187889380 X:23920024-23920046 GTACTGAGCAGCCTGGAGCTGGG + Intronic
1188210572 X:27419095-27419117 GAGCTGTGCAGCCTGGAGTTAGG - Intergenic
1188421009 X:29991222-29991244 GTGCTAAACTGCCTGGGGCTAGG + Intergenic
1188425058 X:30036812-30036834 GAGCTGCGCTGCCTGGGGTTGGG + Intergenic
1188651371 X:32634787-32634809 GAGCTGTGCTGCCTGGGGTTGGG + Intronic
1188725850 X:33580723-33580745 GTGCTGTTCTTCCTGGAGTTTGG + Intergenic
1188743025 X:33809493-33809515 GAGCTGTGCTTCCTGGGGTTAGG + Intergenic
1188917932 X:35935009-35935031 GAGCTATGCAGCCTGGAGTTGGG + Intronic
1188973208 X:36642192-36642214 GAGCTGTGCTGTCTGGAGCTGGG + Intergenic
1188996205 X:36888478-36888500 CTGCTGAGCTGCCTGGAACGTGG - Intergenic
1188998983 X:36922875-36922897 GTGCTGAGCTGCTTGGAGCTGGG + Intergenic
1189019538 X:37320045-37320067 GAGCTGTGAAGCCTGGAGTTAGG - Intergenic
1189405852 X:40721780-40721802 GTGCTGAGCCACCTGGAACTGGG - Intronic
1189411767 X:40779180-40779202 GTGCTGAGCTGCCTGGAACTGGG + Intergenic
1189593785 X:42543160-42543182 GAGCTGTGCTGCCTAGGGTTTGG - Intergenic
1189628301 X:42922181-42922203 ATGATGAGTTGCCTGGAGCTGGG - Intergenic
1189874233 X:45419724-45419746 ATGCTGAGCTGCCTGGAACTAGG + Intergenic
1189875569 X:45433128-45433150 GTACTGAGCTGCCTGGAGCTGGG + Intergenic
1189884986 X:45533300-45533322 GTGCTGAGCCACCTAGAATTGGG - Intergenic
1190015248 X:46820647-46820669 GTTCTGAGCTGCTTGGAGCTGGG - Intergenic
1190122220 X:47671816-47671838 GTGCTGAGCTGCCTGTAGCTGGG + Intergenic
1190368052 X:49716249-49716271 GTGCTGAGCTGTCTGGAGCTGGG + Intergenic
1190374223 X:49773997-49774019 GTGCTGAGCCGCCTGGTACTGGG + Intergenic
1190392041 X:49941675-49941697 ATGAGGAGCTGCCTGGAGTTTGG - Intronic
1190507818 X:51145159-51145181 ATGCTGGGCTCCCTGGAGTAGGG + Intergenic
1190507875 X:51145575-51145597 AAGCTGCACTGCCTGGAGTTTGG + Intergenic
1190538030 X:51448353-51448375 ATGCTGTGCTGCCTAGGGTTGGG + Intergenic
1190602593 X:52108045-52108067 GTGCTGAGCTGCCTGGAGCTGGG + Intergenic
1190605482 X:52138692-52138714 ATGCTGTGCTGTCTGCAGTTGGG - Intergenic
1190808220 X:53860235-53860257 GTGCTGAGCTGCCTGAAGCTGGG + Intergenic
1190968373 X:55323869-55323891 ATGCTGTGCTGCCTGTGGTTGGG + Intergenic
1191145034 X:57156758-57156780 GTGCTGGGCTGCCTGGAGTTGGG + Intergenic
1191179255 X:57541495-57541517 CTACTGAGCTGCCTGAAGGTGGG - Intergenic
1191760484 X:64642849-64642871 GGGCAGAGCTGGGTGGAGTTAGG + Intergenic
1191807333 X:65148667-65148689 GCGCTATGCTGCCTGGGGTTTGG + Intergenic
1191812292 X:65202612-65202634 GTTCTGAGCTTCCTGGCGCTTGG + Intergenic
1191813470 X:65217077-65217099 GTGCTGAGCTGCCTGGAGTTGGG - Intergenic
1191827025 X:65376550-65376572 TTGCTGAGCTGCTTGGAGCTAGG - Intronic
1191831334 X:65419568-65419590 ATGCTGTGCTCCCTGGACTTTGG - Intronic
1191872950 X:65765307-65765329 TTGCTGGGCTCCATGGAGTTAGG + Intergenic
1191991124 X:67038344-67038366 GTGCTGAGGTGCCTGGAGCTGGG + Intergenic
1192020509 X:67385920-67385942 GTGATGAGCTGCCTGGAGCTAGG - Intergenic
1192251740 X:69418944-69418966 GCACTGTGCTGCCTGGGGTTAGG + Intergenic
1192393278 X:70753289-70753311 GAGCTGTGCAGCCTGGGGTTAGG - Intronic
1192640425 X:72857055-72857077 CAGCTGTGCTGCCTGGGGTTGGG - Intergenic
1192641286 X:72863721-72863743 CAGCTGTGCTGCCTGGGGTTGGG + Intergenic
1192700718 X:73468635-73468657 ATGCTAGGCTGCCTGTAGTTGGG + Intergenic
1192822300 X:74658000-74658022 GTGCTGAGCCACCTGAAGCTAGG + Intergenic
1192836240 X:74802337-74802359 GTTCTGAGCCACCTGGAGCTGGG - Intronic
1192839069 X:74835632-74835654 GAGCTGAGCTGTCTGGAGGTGGG + Intronic
1192841287 X:74858293-74858315 GTGCTGAGCTGCCTGGAGCTTGG - Intronic
1192855080 X:75000419-75000441 ATGCTGTGCCACCTGGAGTTTGG + Intergenic
1192858391 X:75039273-75039295 GTGCTGAACTGCCTGGAGCTGGG + Intergenic
1192875132 X:75222199-75222221 GTGCTAAGCTGCCTAGAGCTAGG + Intergenic
1192891036 X:75390481-75390503 GTGCTGAGCTGCCTGGAGCTAGG - Intronic
1192927201 X:75767489-75767511 TTGCAGAGCTGCCTGGAGCTTGG - Intergenic
1192940985 X:75911729-75911751 GTGCTGAGCTGCCTGGAGTTTGG + Intergenic
1192941141 X:75912800-75912822 GAGCTGTGCTGCCTGGGGTTGGG + Intergenic
1192958680 X:76103541-76103563 ATGTTGAGCTGCCTGGAGCTGGG + Intergenic
1192959391 X:76111042-76111064 CTGCTGAGCTATTTGGAGTTGGG - Intergenic
1193052300 X:77114663-77114685 GTGCTGAGCTTCCTGGAGCTGGG + Intergenic
1193052460 X:77115722-77115744 AAGCTGTGCTGCCTGGGGTTGGG + Intergenic
1193098445 X:77579426-77579448 GTGCTGAGTTGCCTGGAGCTGGG - Intronic
1193161945 X:78238305-78238327 GAGCTGTGCAGCCTGGGGTTAGG + Intergenic
1193163602 X:78257274-78257296 GAGCTGTGCAGCCTGGGGTTAGG + Intergenic
1193191033 X:78571899-78571921 TTGCTGAGCTGCCTGGAGCTGGG + Intergenic
1193193055 X:78596212-78596234 GTGCTGAGATCCCTGGAGCTTGG + Intergenic
1193214012 X:78840763-78840785 GTGCTGAGCTGCCTGGAGCTGGG - Intergenic
1193247332 X:79244348-79244370 GAGCTGTGCTACCTGGAGTTGGG - Intergenic
1193252657 X:79309823-79309845 GTTCTGAGCTGCCTGGAGCTTGG - Intergenic
1193264445 X:79452310-79452332 GTGCTGTGCTGTCTGAGGTTGGG - Intergenic
1193280247 X:79640797-79640819 TTGCTGAGCTGCCTGGAGCTGGG + Intergenic
1193280401 X:79641866-79641888 GAGCTGCACTGCCTGGGGTTGGG + Intergenic
1193329846 X:80223678-80223700 ATGCTGGGCTGTCTGGAGTTGGG + Intergenic
1193329963 X:80224508-80224530 GTGCTGTGCTACCTTGGGTTGGG + Intergenic
1193344280 X:80387610-80387632 GTGCTGAGCTGTCTGCAGCTGGG + Intronic
1193366153 X:80636793-80636815 GTGCTACGCTGTCTGGAGCTGGG + Intergenic
1193463554 X:81818542-81818564 AAGCTGTGCTGCCTGGGGTTTGG + Intergenic
1193469173 X:81878428-81878450 CTGCTGGCCAGCCTGGAGTTGGG + Intergenic
1193563294 X:83047026-83047048 GTGCTGAGCTGCCTGGAGATAGG + Intergenic
1193569212 X:83121502-83121524 CTGCTAAGCTGCCTGAAGTGTGG - Intergenic
1193650253 X:84122899-84122921 TTGCTGTGCTGTCTGGGGTTGGG - Intronic
1193650419 X:84123966-84123988 GTGCTGAGCCACCTGGAATGGGG - Intronic
1193664528 X:84299718-84299740 GAGCTGTGCAGCCTGGGGTTAGG - Intergenic
1193676180 X:84454847-84454869 GTGCTGAGCCGCCTGGAACTGGG - Intronic
1193738111 X:85185199-85185221 GTGTGGAACTGCCTGGAGCTAGG + Intergenic
1193738301 X:85186289-85186311 GCACTGAGCTGCCTGGTGTTGGG + Intergenic
1193765726 X:85527485-85527507 GTACTGAGCTGCCTGTAGCTAGG + Intergenic
1193846699 X:86480339-86480361 GTTCTGAGCTTACTGGAGGTGGG + Intronic
1193905770 X:87242843-87242865 TTTCTGAGCTGCCTTGAGCTGGG + Intergenic
1194033106 X:88839914-88839936 GAGCTGTGCAGCCTGGAGTTAGG - Intergenic
1194110322 X:89825210-89825232 GTGCTGAGTTGCTTGGAGCTTGG - Intergenic
1194257402 X:91652050-91652072 GTGCTACGCTGCTTGGAGCTGGG + Intergenic
1194257574 X:91653139-91653161 AAGCTGTGCTGCCTGGGGTTGGG + Intergenic
1194307041 X:92260038-92260060 GAGCTGTGCAGCCTGGGGTTAGG + Intronic
1194387890 X:93278949-93278971 GTGCTGAGCTTCCTGGAGATGGG - Intergenic
1194466452 X:94239989-94240011 ATGCTGCGTTGCCTAGAGTTGGG + Intergenic
1194492333 X:94567687-94567709 GTGCTGGGCTGACTGAAATTGGG + Intergenic
1194507575 X:94751897-94751919 GTATTGGGCTGCCTGGAGTTGGG + Intergenic
1194526602 X:94984315-94984337 GTGCTGAGTCACCTGGAATTGGG - Intergenic
1194530681 X:95044946-95044968 GAGCTGTGCAGCCTGGGGTTAGG - Intergenic
1194626264 X:96229871-96229893 GAGCTGTGCAGCCTGGGGTTGGG - Intergenic
1194692803 X:97008792-97008814 GTGCTGAGCTACCTGGAGCTGGG + Intronic
1194787515 X:98105674-98105696 GATCTGAGCTACCTGGAGCTGGG + Intergenic
1194795998 X:98211354-98211376 GTGCTGAGCCACCTGGAACTGGG - Intergenic
1194892433 X:99397505-99397527 GTGCTGAGCCACGTGGAGCTTGG + Intergenic
1194892600 X:99398589-99398611 GAGCTGTGCTGTCTGGGGTTGGG + Intergenic
1194916601 X:99716725-99716747 ATGATGTGCTGCCTGGGGTTGGG - Intergenic
1194925138 X:99815673-99815695 GAGCTGAGCAGACTGGGGTTAGG - Intergenic
1195037018 X:100979965-100979987 GTGCTGAGCTGCCTGGAGTTGGG + Intronic
1195115880 X:101697136-101697158 ATTCTGAGCTGCCTGGAGCTGGG - Intergenic
1195199463 X:102533475-102533497 GTGCTGAGCTACCTAGACCTGGG - Intergenic
1195455405 X:105063912-105063934 GTGCTGAGCCACCTGGAGGTGGG + Intronic
1195601277 X:106751596-106751618 GAGCTGTACTGCCTGGAGTTGGG - Intronic
1195662694 X:107396671-107396693 GAGCTGTGCTCTCTGGAGTTCGG + Intergenic
1195828430 X:109028985-109029007 ATGCTATGCTGCCTGAAGTTGGG - Intergenic
1195917339 X:109948514-109948536 ATGCTGAGCTGCCTAGAACTCGG - Intergenic
1196096626 X:111807996-111808018 GCGCTGAGCTGCATGGAGTTGGG + Intronic
1196154138 X:112407781-112407803 GTTCTGAGCTTCCTGGAGCTGGG - Intergenic
1196182019 X:112703229-112703251 GTGCTGAGCTACCTGGAACTGGG + Intergenic
1196234547 X:113262967-113262989 GAGCTGGGCTGCCTGGGTTTGGG + Intergenic
1196248538 X:113429396-113429418 GTGCTGAGCTGCCTGGAGGTGGG - Intergenic
1196269964 X:113699004-113699026 CTGCTGAGTTGCCTGGAGCTAGG + Intergenic
1196368848 X:114952732-114952754 GTGTTGGGCTGCCTGGAATTGGG - Intergenic
1196508471 X:116477043-116477065 AAGCTGTGCAGCCTGGAGTTAGG + Intergenic
1196511990 X:116523177-116523199 TTGCTGAGATGTCTGGAGCTCGG + Intergenic
1196552461 X:117045381-117045403 GAGCTGTGCTGCCCGCAGTTGGG - Intergenic
1196564592 X:117189773-117189795 GTTCTGAGCTACCTGAAGCTGGG - Intergenic
1196576545 X:117325392-117325414 CTGCTGAGCTGCCTGTATTAGGG + Intergenic
1197054014 X:122094903-122094925 GTGCTTAGCTAACTGTAGTTGGG - Intergenic
1197099459 X:122635980-122636002 GTGCTGAGCTGCCTGGATCTGGG + Intergenic
1197105088 X:122703808-122703830 CTGCTGGGCTGCTTGGAGTCGGG - Intergenic
1197348207 X:125350222-125350244 GAGCTGTGCAGCCTGGGGTTAGG - Intergenic
1197361190 X:125505232-125505254 TAGCTGCACTGCCTGGAGTTGGG + Intergenic
1197399915 X:125977709-125977731 AAGCTGACCTGCCTGAAGTTGGG - Intergenic
1197400005 X:125978483-125978505 ATGCTGAGCTGCCTGGAGTTGGG - Intergenic
1197439269 X:126470628-126470650 GAGCTGTGCTGCCTGGGTTTGGG - Intergenic
1197439434 X:126471665-126471687 CTGCTGAGCTTCCTGGAGCTGGG - Intergenic
1197458081 X:126702300-126702322 GTGCTGAGCTACCTGGAACTGGG - Intergenic
1197476652 X:126933443-126933465 GAGCTGTGCAGCCTGGGGTTAGG + Intergenic
1197487593 X:127073719-127073741 GTGCTGAGCTGCCTGAATTTGGG + Intergenic
1197514561 X:127410436-127410458 GTACTGAGCTGCCTGGAGCTGGG + Intergenic
1197537611 X:127709094-127709116 TTGCTGAGCTGCCTGGAGCTGGG - Intergenic
1197623437 X:128778411-128778433 GTGCTGAGTTGCCTGGAACTGGG + Intergenic
1197670525 X:129272699-129272721 ATGCTGAGCTGCCTGTAGCTGGG + Intergenic
1197953087 X:131918740-131918762 GATCTGTGCTGCCTGGGGTTAGG - Intergenic
1197997259 X:132390877-132390899 ATGATGAGCTGCCTTGAGTCTGG + Exonic
1198515094 X:137399606-137399628 GTTCTGAGCCACCTGGAGCTGGG + Intergenic
1198697115 X:139354312-139354334 CTGCTGAGATGCCTGGAGCTGGG + Intergenic
1198770462 X:140125467-140125489 GTGCTGAGCCTCCTGGAGCTGGG + Intergenic
1198773492 X:140155527-140155549 GAGCTGCACTGCCCGGAGTTAGG - Intergenic
1198841129 X:140859190-140859212 GTGCTGAGCCACCTTGAGCTGGG - Intergenic
1198964525 X:142214050-142214072 GTGTGGAGCTGCCTGGAGCTGGG + Intergenic
1199094460 X:143723689-143723711 TTGCTGAGCTCCATGGAGGTGGG - Intergenic
1199189070 X:144949618-144949640 GTGATGAGCTGCCTGGAGTTTGG - Intergenic
1199189559 X:144953694-144953716 GTGCTGAGCAACGTGGAGCTTGG - Intergenic
1199246016 X:145604821-145604843 GAGCTGTGCAGCCTGGGGTTAGG - Intergenic
1199304040 X:146245794-146245816 CTGCTGAGTTCCCTAGAGTTTGG - Intergenic
1199334226 X:146599953-146599975 GTTCTGAGCCACCTGGAGCTGGG + Intergenic
1199442951 X:147889436-147889458 GTTCTAAGCTACCTGGAGCTAGG + Intergenic
1199568852 X:149246900-149246922 GAACTGAACTGCCTGGGGTTAGG + Intergenic
1199645868 X:149909989-149910011 CTGCTGAGCTGCCTAGGGCTGGG - Intergenic
1199845384 X:151688991-151689013 GTGCTGAGCTGCCTGGAACTGGG - Intergenic
1199868191 X:151873161-151873183 ATGCTGGGATGCCAGGAGTTAGG - Intergenic
1199921181 X:152405528-152405550 GAGATGCACTGCCTGGAGTTGGG - Intronic
1199983378 X:152933426-152933448 GAGCAGAGCTGCCTGGGGTAGGG - Intronic
1200182566 X:154159633-154159655 GTGCTCCGCTGCCTCCAGTTGGG + Intergenic
1200188220 X:154196747-154196769 GTGCTCCGCTGCCTCCAGTTGGG + Intergenic
1200193870 X:154233887-154233909 GTGCTCCGCTGCCTCCAGTTGGG + Intergenic
1200199625 X:154271691-154271713 GTGCTCCGCTGCCTCCAGTTGGG + Exonic
1200379473 X:155819761-155819783 GAGTTGCACTGCCTGGAGTTGGG - Intergenic
1200379539 X:155820163-155820185 ATGCTGGTATGCCTGGAGTTGGG - Intergenic
1200462984 Y:3479951-3479973 GTGCTGAGTTGCTTGGAGCTTGG - Intergenic
1200576059 Y:4890996-4891018 GTGCTATGCTGCTTGGAGCTGGG + Intergenic
1200576231 Y:4892085-4892107 AAGCTGTGCTGCCTGGGGTTGGG + Intergenic
1200608485 Y:5296366-5296388 GTGCTGAGCTGTCTGCAACTGGG + Intronic
1201980284 Y:19899752-19899774 GTGCTAAGCTGCCAGCAGCTGGG - Intergenic