ID: 1187836321

View in Genome Browser
Species Human (GRCh38)
Location X:23435644-23435666
Sequence TGTGCTGAGCTGCCTGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1280
Summary {0: 6, 1: 70, 2: 181, 3: 302, 4: 721}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187836321_1187836323 -4 Left 1187836321 X:23435644-23435666 CCAACTCCAGGCAGCTCAGCACA 0: 6
1: 70
2: 181
3: 302
4: 721
Right 1187836323 X:23435663-23435685 CACAGAGAAAGAGACTGTTTAGG No data
1187836321_1187836324 11 Left 1187836321 X:23435644-23435666 CCAACTCCAGGCAGCTCAGCACA 0: 6
1: 70
2: 181
3: 302
4: 721
Right 1187836324 X:23435678-23435700 TGTTTAGGAATAACTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187836321 Original CRISPR TGTGCTGAGCTGCCTGGAGT TGG (reversed) Intergenic
900138587 1:1129152-1129174 TGAGCGGAGATGCCTGGAGGGGG + Intergenic
900297296 1:1958214-1958236 TCTGCTGATCTTCCTGGGGTGGG + Intronic
902143882 1:14380003-14380025 TGTTCTGAGCTGTCTGGAGCTGG - Intergenic
903531541 1:24034174-24034196 TGTCCTGAGCTGGATGGAGCAGG - Intergenic
903949099 1:26983990-26984012 TTTGCTGTGCAGCCTGGAATTGG - Intergenic
904095448 1:27973313-27973335 TGGCCAGAGCTGCCTGGAGGTGG + Exonic
904422493 1:30403208-30403230 TCTGCAGAGAGGCCTGGAGTAGG + Intergenic
904836733 1:33342523-33342545 TGTCCTGAACTGCATGGGGTGGG - Intronic
906225315 1:44117246-44117268 TATGGTGAGCTCCCAGGAGTGGG - Intergenic
906352786 1:45078540-45078562 TGTTCTGAGCTACCTGGAGCTGG + Intronic
907004139 1:50893557-50893579 TGTACTGAGTTGCTTGGAGCTGG + Intronic
907023879 1:51095623-51095645 TGTGCTGAGGTGCCTATAGCTGG - Intergenic
907261577 1:53222273-53222295 TGAGCTGTGCTGCCTGGGGTTGG - Intergenic
907261710 1:53223030-53223052 CATGCTGAGCTGCCTGGAGTTGG - Intergenic
907565490 1:55430070-55430092 TATGCTCAGCAGCCTGGAGTTGG + Intergenic
908021998 1:59907715-59907737 TGGGATGTGCTGCCTGAAGTCGG - Intronic
908024809 1:59939452-59939474 TGTTCCAAGCTGCCTAGAGTTGG + Intergenic
908175459 1:61551732-61551754 TGTGCTGAGCTGTCTGGAGCTGG + Intergenic
908302190 1:62773417-62773439 TGTGCTGAGATGCCTGGAGCTGG + Intergenic
908769362 1:67582436-67582458 GGTTATGAGGTGCCTGGAGTGGG - Intergenic
909084391 1:71154543-71154565 TGTGCTAAGCTGCCTTAAGCTGG + Intergenic
909231185 1:73092916-73092938 CATGCTGAGCTGCCTGGAGTTGG + Intergenic
909245655 1:73279310-73279332 TGGGTTGTGCTGCCTGGGGTTGG - Intergenic
909271419 1:73627769-73627791 TGTGCTGAGCTGCCTGGAGCTGG - Intergenic
909582572 1:77254230-77254252 CATGCTGGGCTGCCTGGAGTTGG - Intergenic
909615814 1:77606614-77606636 TGTGCTGAGCTGCTTGGGGCTGG - Intronic
909782035 1:79559251-79559273 TGTTCTGAACCACCTGGAGTTGG - Intergenic
909848714 1:80433534-80433556 TGTGCTGAGCCACCTGGAAATGG + Intergenic
910102426 1:83593416-83593438 TGTGCTGAGCTGCCTGGAGCTGG + Intergenic
910349179 1:86276895-86276917 TGTTCTGAGCCACCTGGAGCTGG + Intergenic
910470306 1:87546325-87546347 TGTGCTGAGCTTCCTGGAGCTGG + Intergenic
910515266 1:88053792-88053814 TCCGCTGAGCTGTCTGGAGCTGG + Intergenic
910560332 1:88582787-88582809 TGTGCTGAGTCACCTGGAGCTGG - Intergenic
910639824 1:89447289-89447311 TGAGCTGAGCTTCCTGGGGATGG + Intergenic
910716459 1:90236390-90236412 TGAGCTGCACTGCCTGGGGTTGG + Intergenic
910725030 1:90328865-90328887 TGTGCTGAGCTGCCTGGAGGGGG - Intergenic
910818997 1:91325432-91325454 TGTGCTGAGCCACTTGGAATTGG - Intronic
911012536 1:93296697-93296719 TGAGCTGTGCTAACTGGAGTTGG + Intergenic
911019981 1:93376083-93376105 TATGCTGAGCTGCGTGGAGCTGG - Intergenic
911062986 1:93763900-93763922 TGAGCTGAGCTGGCAGGAGCTGG + Intronic
911181192 1:94862283-94862305 TGTGCTGAGGCTCCTGGACTAGG - Intronic
911343877 1:96673701-96673723 TGTGCTCAGCTGCCTAGAGCAGG + Intergenic
911666351 1:100557386-100557408 TGAGCTGTACTGCTTGGAGTTGG + Intergenic
911666415 1:100557793-100557815 TGGGCTGCACTGCCTGCAGTTGG + Intergenic
912015448 1:105028128-105028150 TGTGCTGAGCTCCCTGAATCTGG - Intergenic
912102761 1:106232521-106232543 TGAGCTGTGCTGCCTGGGGTAGG + Intergenic
912127429 1:106555945-106555967 TGTGTTAAGCTACCTGGAGCTGG - Intergenic
912152871 1:106880858-106880880 TGTGCTGAGCCACCTGGAACTGG - Intergenic
912242777 1:107928044-107928066 TGTTCTGAGCCACCTGGAGCTGG - Intronic
912616832 1:111110357-111110379 TGTGCTGCACTTCCTGGAGTTGG + Intergenic
912871463 1:113310830-113310852 TGAGCTGAGCTGCCTGGGGTTGG - Intergenic
913042473 1:115040878-115040900 TGTGCTGCACTGCCTGGGGTTGG - Intergenic
913042531 1:115041277-115041299 CTTGCTGCACTGCCTGGAGTTGG - Intergenic
914676479 1:149910542-149910564 GGGGCTGAGCTGCATGGGGTGGG - Intronic
914980710 1:152412067-152412089 TGTGCTGAGCCGGGTGGAGAGGG - Intronic
915193674 1:154173116-154173138 TGTGCTTAGCTTCTTTGAGTTGG + Exonic
915693519 1:157715725-157715747 TGTGCTGTGCCGCCTGGATCTGG + Intergenic
915777494 1:158506720-158506742 TGCACTGGGTTGCCTGGAGTTGG + Intergenic
915799741 1:158777467-158777489 TGTGCAGAGCTGCATCCAGTCGG + Exonic
916011967 1:160714330-160714352 TTTGCTGAGCTGCAGGCAGTGGG - Intergenic
916011992 1:160714528-160714550 TTTGCTGAGCTGCAGGCAGTGGG - Intergenic
916221086 1:162445771-162445793 GTTGCTGAGCTGCGGGGAGTAGG - Intergenic
916341719 1:163744589-163744611 TGTGCTGAGCTGCCTGATTTTGG + Intergenic
916769032 1:167890424-167890446 TGTGCTGAGCTGCTTGGAGCTGG + Intronic
917226302 1:172787845-172787867 TGTTCTGAGCCACCTGGAGCTGG + Intergenic
917306382 1:173628911-173628933 TGTGCTGAGCTGCCTAGAACTGG - Intronic
917396990 1:174603993-174604015 TGAGCTGTGCTGCCTTGTGTTGG + Intronic
918384030 1:183986901-183986923 TGTGGTGGGGAGCCTGGAGTGGG - Intronic
918476128 1:184927519-184927541 TGTGTTGAGCTGCCTGGAGCTGG + Intronic
918915651 1:190633846-190633868 TGTGCCAACCTGCCTGGAGCTGG + Intergenic
918989829 1:191684529-191684551 TGTGCTGAGCAACCTGGACTGGG + Intergenic
919283771 1:195526409-195526431 TGAGCTTTGCTGCTTGGAGTTGG - Intergenic
919283831 1:195526824-195526846 TGTGCTAGGCTGTTTGGAGTTGG - Intergenic
919336745 1:196244979-196245001 TGTGCTGACCTGCCTGGAGCTGG - Intronic
919463118 1:197902401-197902423 TCTGATGAGCTGCCTGGACGGGG - Intergenic
919511623 1:198472411-198472433 TGTGCTGAGCTGCCTGGAGCTGG - Intergenic
919514975 1:198511359-198511381 TGGTCTGTGCTGCCTGGGGTTGG + Intergenic
920594826 1:207258862-207258884 CATGCTGAGCTGTCTGGAGCTGG + Intergenic
920596769 1:207279835-207279857 TGAGCTGCACTGCCTGGAGTTGG + Intergenic
920846203 1:209595102-209595124 TGGGCTGGGCTGCCTGCAGTGGG + Intronic
920953534 1:210597194-210597216 TGTGCTAAACTGCCTAGAGCTGG + Intronic
920953712 1:210598276-210598298 TGAGCTATGCTGCCTGGGGTTGG + Intronic
921147077 1:212368007-212368029 TGCTCTGAGTTGCCTGGAGTTGG - Intronic
921769860 1:219022910-219022932 TGTGATGAGCTGCCTGGATCTGG - Intergenic
921823238 1:219641215-219641237 TGTGCTGAGCTGCCTAGAGCTGG - Intergenic
921929243 1:220741884-220741906 TGTGCTGAGCTGCTTGGAGTTGG + Intergenic
922110043 1:222547667-222547689 GGTGCTGGGCTGCATGGTGTGGG - Intronic
922320372 1:224481618-224481640 TGTGCTGAGATACCTGGAGCTGG + Intronic
922388437 1:225113348-225113370 TGTGCTGAGCTGCCTGGAACTGG + Intronic
922388614 1:225114433-225114455 GGAGCTGTGCTGCCTGGGGTTGG + Intronic
922388699 1:225115174-225115196 TGTGCTAAGCTGCCTAGAGCTGG + Intronic
922685422 1:227634997-227635019 TGGGCTGAGCTGCCTGGAGCTGG - Intronic
923325419 1:232876179-232876201 GGGGCTGTGCTGACTGGAGTTGG - Intergenic
923471150 1:234292162-234292184 TGTGCTGGGCTGCCAGAACTTGG - Intronic
924193726 1:241583160-241583182 CATGCTAGGCTGCCTGGAGTTGG + Intronic
924451379 1:244182022-244182044 GGTGCCGAGCATCCTGGAGTTGG - Intergenic
924490695 1:244535130-244535152 AGTGCTGAGCTGCCTGGAGCTGG + Intronic
924490872 1:244536204-244536226 TGAGCTGTGCTGCCTAGTGTTGG + Intronic
924516067 1:244767586-244767608 TGTGCTGAGCTGCCTGGAGCTGG + Intergenic
924629192 1:245721220-245721242 AGAGCTGTGCTGCCTGGGGTTGG - Intergenic
924629320 1:245721930-245721952 TGTGCTGAGCTACCTGGAGTTGG - Intergenic
1062805477 10:416480-416502 TGGGCTGAGCTGCGTGGGTTTGG - Intronic
1062806054 10:420306-420328 GGTGCCGAGCTGCCTGGACACGG + Intronic
1062813846 10:485026-485048 TGTGCTGTCCTGCATGGGGTCGG - Intronic
1064065070 10:12174694-12174716 TGTGCAGAGCAGCGTGGAGATGG - Intronic
1064601025 10:16992985-16993007 TGAGCGGTGCTCCCTGGAGTTGG - Intronic
1064987393 10:21225251-21225273 TGTGCTTAGCTCCATGGAGCTGG + Intergenic
1066649599 10:37642225-37642247 TGTGCTGAGACACCTGGAGTTGG + Intergenic
1066659775 10:37728116-37728138 AGTGCTGCACTGCCTGCAGTGGG + Intergenic
1067343802 10:45423921-45423943 TCTGCAGAGCTGCCTGGAGGGGG + Intronic
1067581738 10:47450698-47450720 TGTGCTGAGCTCCCAGGCCTGGG - Intergenic
1067682870 10:48451308-48451330 CCTGCTGTCCTGCCTGGAGTTGG - Intronic
1068713022 10:60155219-60155241 TATGCTGTGCTGCCTGGGGCTGG - Intronic
1068713155 10:60156164-60156186 TGAGCTGCACTGCCTGGAATTGG - Intronic
1068881407 10:62053283-62053305 TGTGTGGAGCTGCATGAAGTTGG - Intronic
1069343605 10:67440611-67440633 TGTGCTGAGCTGCCTGCATCTGG - Intronic
1069391845 10:67944232-67944254 TATGCTGAGCTCTCTGGAGCTGG - Intronic
1070059263 10:72966941-72966963 TGTGCTGGGCTGCCTGGAACTGG + Intergenic
1070895405 10:79979850-79979872 TGAGCTGCACTGCCTGGAGTTGG - Intronic
1071046587 10:81386938-81386960 TGTTCTGAGCAACCTGGAGCTGG + Intergenic
1071464316 10:85925654-85925676 GGTGCTGTGGTCCCTGGAGTTGG - Intronic
1071601717 10:86961772-86961794 AGTGCTGTGCTGGCGGGAGTCGG - Intronic
1071896626 10:90075377-90075399 TGTACTGAGCTGCCTGAGGTTGG + Intergenic
1071935411 10:90525642-90525664 TGTGCTGAGCTGTCTGGAGCTGG + Intergenic
1071963111 10:90825098-90825120 TGTGTTGAGTTGCCTGGAGCTGG - Intronic
1072058906 10:91788805-91788827 TGTGCTGAGCTGCCTGGAGCTGG - Intergenic
1072492206 10:95919507-95919529 CATGCTGAGCTGCCTGGAGTTGG + Intronic
1072492436 10:95920959-95920981 TGAGCTGTACTGCCTGAAGTTGG + Intronic
1072651247 10:97297407-97297429 TGTGGTGACCTCCCAGGAGTGGG + Intergenic
1073329137 10:102659558-102659580 TGTCCTGGGCTTCCTGGGGTGGG - Intergenic
1073708083 10:106010068-106010090 TGTTCTGAGCCGCCTTGAGCTGG + Intergenic
1074302039 10:112241837-112241859 TGTGCTGAGCTGCCTGGAGCCGG + Intergenic
1074338251 10:112599918-112599940 TTTACTGAGTTGCCCGGAGTTGG - Intronic
1074383023 10:112995567-112995589 TGTTCTGAGCTGCCTGATGTGGG - Intronic
1074408591 10:113202426-113202448 TGTGCTGAACTGACTGGAGCTGG - Intergenic
1074803675 10:117027010-117027032 TGTTCTGAGCCACCTGGAGCTGG - Intronic
1075291721 10:121236696-121236718 CATGCTGAGGAGCCTGGAGTTGG - Intergenic
1075496323 10:122922518-122922540 TGAGCTGTGCTGCCTGGGGTTGG - Intergenic
1075496489 10:122923565-122923587 TCTGCTGAGCTGTCTGGAGTTGG - Intergenic
1075741179 10:124697491-124697513 TGTGCAGAGGTCCCTGGATTGGG - Intronic
1075830473 10:125406940-125406962 TGTGCTGAGCTTCCTGGAGCTGG + Intergenic
1076560786 10:131361961-131361983 TGTGCTAAAATGTCTGGAGTTGG - Intergenic
1077393240 11:2309340-2309362 GATGCTGACCTGCCTGGAGGAGG + Intronic
1077496844 11:2890694-2890716 TGTGCTGAGCCGCCTGTTGCGGG - Intronic
1077564736 11:3290413-3290435 TCCTCAGAGCTGCCTGGAGTTGG + Intergenic
1077570626 11:3336230-3336252 TCCTCAGAGCTGCCTGGAGTTGG + Intergenic
1077858809 11:6157166-6157188 TGAGCTGTGCTGCCTGGGGTTGG - Intergenic
1077912121 11:6581025-6581047 TGTGCTGAGCTGCTTGGAGCTGG - Intronic
1078244591 11:9562832-9562854 TGTGCTGAGCTGCCTGGAGATGG + Intergenic
1078520700 11:12060754-12060776 TGTGCAGAGCTGCCTGCTGAGGG + Intergenic
1078929693 11:15903624-15903646 TCTGCTGAGCTGCCTGCAGCTGG - Intergenic
1078992761 11:16665819-16665841 TGTGATGAGCTGCTTGGATTTGG - Intronic
1079069140 11:17328257-17328279 TGTGCTGAGCCACCTGGAACTGG + Intronic
1079473948 11:20808458-20808480 TGAGCTGCACTGCCTGGGGTTGG + Intronic
1079532966 11:21477312-21477334 TGTGCTAAGCTCCCAGGAGCTGG - Intronic
1079565792 11:21880361-21880383 CATGCTGAGCTGCCTTGAGCTGG - Intergenic
1079961308 11:26927673-26927695 TGTTCTGAGCCACCTGGAGCTGG + Intergenic
1080096950 11:28419272-28419294 TATGCTGAGCTGCCTGGAGCTGG - Intergenic
1080189135 11:29524295-29524317 TTTACTGAGCTGCCTCGAGCAGG + Intergenic
1080351241 11:31387379-31387401 TGTGCTAAGCTGCCTGGAGCTGG - Intronic
1080489715 11:32750209-32750231 TGTGCTGAGCTTCCTGGAGTTGG + Intronic
1081049275 11:38316645-38316667 TGTGCTGAATTGCTTGGAGCTGG - Intergenic
1081555469 11:44157097-44157119 TGTGATGAGCTGCCTAGAACTGG + Intronic
1081807339 11:45897696-45897718 TGAGAAGAGCAGCCTGGAGTAGG - Intronic
1081860834 11:46332716-46332738 GCTGCCGAGCTGCCTGGACTAGG + Intergenic
1081915185 11:46726170-46726192 TGTGGTGAGCTGCCTGGGTAGGG + Exonic
1082225516 11:49702461-49702483 CGTACTGAGCTGCCTGAAGTTGG + Intergenic
1082721239 11:56679569-56679591 TGAGCTGTGCTGCCCGGAGTTGG - Intergenic
1082823754 11:57562606-57562628 CGTGCTGAGCTCCCTGGAGCTGG - Intronic
1083174317 11:60939672-60939694 TGGGCTAAGCTGCCTGGGGTGGG - Intronic
1083528711 11:63397245-63397267 TATACTGAGCTGCCTCGAGCTGG + Intronic
1084761218 11:71272374-71272396 TGTGCTAAGCCACCTGGAGTGGG - Intergenic
1084763729 11:71294030-71294052 TGTGCTGAACTGCCTGGAGCTGG + Intergenic
1085025769 11:73235687-73235709 GGAGCTGAGCTACCTGGGGTGGG + Exonic
1085147443 11:74213610-74213632 TGTGCTGAGCTTCCTGGAGCTGG - Intronic
1085194613 11:74661555-74661577 TGTGCTGAGCCGCCTGGAGCTGG + Intronic
1085562895 11:77488051-77488073 TATGCTGAGCCACCTGGAGCTGG - Intergenic
1085572004 11:77568174-77568196 TGTACTGAACTTCCTGGAGCTGG + Intronic
1085686860 11:78631361-78631383 TGTGTTTCACTGCCTGGAGTTGG + Intergenic
1086028685 11:82326810-82326832 CATGCTGGGCTGCCTGGGGTTGG - Intergenic
1086249642 11:84798039-84798061 TGCGCTGAGCCACCTGGAGCTGG + Intronic
1086277248 11:85146261-85146283 TCTCCTGAGCTTCCTGGAGTTGG + Intronic
1086285935 11:85251156-85251178 TGTGCTATGATGCCTGGAGCAGG + Intronic
1086623562 11:88917116-88917138 CGTACTGAGCTGCCTGAAGTTGG - Intronic
1087030375 11:93697897-93697919 TATGCTGAGCTACCTGAAATGGG - Exonic
1087031899 11:93714862-93714884 TGTGCTGAGCTGCCTGGAGCTGG + Intronic
1087313261 11:96576512-96576534 TGTGCTGAGCTACCTGGAGCTGG + Intergenic
1087345430 11:96965288-96965310 TGTGCTTAGCTGCCTGGTATTGG - Intergenic
1087350196 11:97020978-97021000 TGTGCTGTGCTACCTGGACCTGG - Intergenic
1087472868 11:98600226-98600248 TTTGCTGAGCTGCCTAGAGCTGG + Intergenic
1087598274 11:100282450-100282472 TGTTCTGAGCCACCTGGAGCTGG + Intronic
1087871317 11:103296057-103296079 TGTGCTGTGCTGCCTGTGGTTGG + Intronic
1087874429 11:103339188-103339210 TATGCTTGGCTGCCTTGAGTTGG + Intronic
1087874498 11:103339612-103339634 TGCACTGCGTTGCCTGGAGTTGG + Intronic
1087950701 11:104218108-104218130 TGTTCTGAGCCACGTGGAGTAGG + Intergenic
1088181937 11:107122165-107122187 TATGCTTAGCTGCTTGGAGCTGG - Intergenic
1088938105 11:114425312-114425334 TGTGCTGAGCCACCTGGAGCTGG + Intronic
1088944380 11:114495080-114495102 TATGCTGAGTTGCCTGGAGCTGG + Intergenic
1088989222 11:114937395-114937417 TGAGGTGAGGGGCCTGGAGTCGG - Intergenic
1089462799 11:118662608-118662630 AGTGCTGGGCAGCCTGGAGGTGG + Intronic
1089678597 11:120107045-120107067 GGTGTGGACCTGCCTGGAGTGGG - Intergenic
1089762079 11:120735406-120735428 TGTGCTTAGCCACCTGGAGCTGG + Intronic
1090210253 11:124916090-124916112 TGTGCTGAGCTGCCTGGAGCTGG + Intergenic
1090676782 11:129006600-129006622 TGTGATAAGCTACCTGGAGCTGG + Intronic
1091372898 11:135075870-135075892 TGTCCTTAGCTGCCAGGAGGTGG + Intergenic
1091587327 12:1823599-1823621 TGTGCTGAGGTGAGGGGAGTAGG - Intronic
1091610510 12:2004075-2004097 TCTGTGGAGCTACCTGGAGTTGG - Intronic
1091904587 12:4174213-4174235 TGTGCAGATCTGCTTGGAGAGGG - Intergenic
1092332143 12:7594424-7594446 TTTGCTGGGCTCCATGGAGTGGG - Intergenic
1092828938 12:12425151-12425173 AGTGCGTAGCTGCCTGCAGTGGG + Intronic
1093182820 12:15987156-15987178 TTTTCTGAGCTGCTTGGATTTGG + Intronic
1093259559 12:16918330-16918352 TGAGCTCCGCTGCCTGGGGTTGG + Intergenic
1093321217 12:17717983-17718005 CATGCTGAGCTGCCAGGACTTGG + Intergenic
1093419920 12:18963971-18963993 TGTGCTGAGCTGCCTGGAGCTGG + Intergenic
1093538308 12:20248679-20248701 TGTGCTGAGCCTCCTGGACTTGG - Intergenic
1093581688 12:20790829-20790851 TGAGCTGCACTGCCTGCAGTTGG + Intergenic
1093588502 12:20871740-20871762 TGTGCTGAGCTGCCAGAAACTGG + Intronic
1093608001 12:21118043-21118065 TGTGCTAAGCTGCTTGGAGCTGG + Intronic
1093903184 12:24660467-24660489 TGTGCTGAGCTGCCTAGAACTGG + Intergenic
1093931920 12:24962115-24962137 TGTGCTGAGCCGCCTGGAGCTGG - Intergenic
1094419731 12:30257840-30257862 TGAGCTGTGCTGCCTGAGGTTGG - Intergenic
1094448412 12:30558710-30558732 AGAGCTGAGCTGCCAGGTGTTGG - Intergenic
1094618868 12:32060866-32060888 TGGTCTGGGCTGCCTGGGGTTGG + Intergenic
1094628511 12:32149137-32149159 TGTGCTGAACTGCATGGGATAGG + Intronic
1095163437 12:38942471-38942493 TGTTCTGAGCTGCCTGAATCTGG - Intergenic
1095181600 12:39153420-39153442 TCTGATGAGCTCCCTGGAGCTGG + Intergenic
1095860353 12:46909186-46909208 TGTGCTGGGCTGCATGGAGCTGG - Intergenic
1096959004 12:55558968-55558990 TGTGGTGTGCTGCCTGGGGTTGG - Intergenic
1096977265 12:55706726-55706748 GCTGCTGAGATTCCTGGAGTTGG + Intronic
1097425932 12:59445280-59445302 TGTGTTGAGCTGCCTGGAACTGG + Intergenic
1097466368 12:59929362-59929384 CATGCTGAGCTGCCTGGAGTTGG - Intergenic
1097770047 12:63572706-63572728 TGTGCTAAGCTGCCTGGAGCTGG - Intronic
1097899331 12:64857535-64857557 TGAGCTGCACTGCCTGGGGTTGG + Intronic
1098060439 12:66555179-66555201 TGTGCTGAGCCACCTGGAGATGG - Intronic
1098648961 12:72940768-72940790 TGTGCTAAACTGCCTGGAGCTGG + Intergenic
1098975309 12:76896111-76896133 AGAGCTGCGCTGCCTGGAATTGG - Intergenic
1098975378 12:76896527-76896549 CATGCTGAGCTGCCTGGAGTTGG - Intergenic
1099024448 12:77447945-77447967 TGAGCTGTGCTGCCTGAGGTTGG - Intergenic
1099024606 12:77448968-77448990 TGTGCTGAGCTGCCTGGAGCTGG - Intergenic
1099764212 12:86961270-86961292 TGAGCTGATCTGCCTGAAGAGGG + Intergenic
1099992335 12:89737348-89737370 TCTGCTGAGCTGCCTGGGGCTGG - Intergenic
1100619362 12:96256470-96256492 GGTGCTGAGCTTCATGAAGTTGG + Intronic
1100904848 12:99286106-99286128 CAAGCTGTGCTGCCTGGAGTTGG - Intronic
1101167321 12:102052228-102052250 CATGCTGTGCTGCCTGGAGTTGG - Intronic
1101251856 12:102945135-102945157 TGTGCTGAGCTGTCTGGAGCTGG + Intronic
1101607582 12:106259188-106259210 TGTGCTGAGCTGCCTGGAGCTGG - Intronic
1102144625 12:110645509-110645531 TGTCATGAGATGCCTGGAGAGGG - Intronic
1102266620 12:111491473-111491495 TGAGCTGTGGTACCTGGAGTTGG - Intronic
1102487677 12:113269149-113269171 GCTGCTGAGCTGCCTGCATTTGG - Intronic
1102519892 12:113471665-113471687 GGCGCTGGGCTGCCCGGAGTGGG + Exonic
1102529725 12:113537228-113537250 TTGGCGGAGCTGCCTTGAGTGGG + Intergenic
1103232185 12:119340604-119340626 CCAGCTGGGCTGCCTGGAGTCGG + Intronic
1105273476 13:18900100-18900122 TGCACTGCACTGCCTGGAGTTGG - Intergenic
1105558913 13:21472643-21472665 TGTGCTGAGCTCCCTGGAGCTGG + Intergenic
1106074894 13:26449354-26449376 TGTACTGAGCTGCCTGGATCTGG - Intergenic
1107178222 13:37423874-37423896 TATGCTGAGCTGCCTGAGCTAGG - Intergenic
1107524090 13:41213402-41213424 TGTGCTGAGCCGCCTGGAACTGG + Intergenic
1107524264 13:41214366-41214388 TGAGCTGCACTGCCTGGGGTTGG + Intergenic
1107582252 13:41802940-41802962 CATGCTCAGCTGTCTGGAGTTGG - Intronic
1107754003 13:43599726-43599748 TGAGCTGTGCTGCCTGGGGTTGG - Intronic
1107754165 13:43600803-43600825 AATGCTGAGCTGCCTGGAGCTGG - Intronic
1107980756 13:45732211-45732233 TGTGGTGACCTCCCAGGAGTGGG - Intergenic
1108138118 13:47386772-47386794 TGTGCTAAGCTGCCTGGAGCTGG - Intergenic
1108816703 13:54301433-54301455 TGTGCTGCATTGCCTGGAGTTGG + Intergenic
1108858134 13:54820688-54820710 TGTGTTGAGCTTCCTGGAGCTGG - Intergenic
1109100603 13:58180240-58180262 TGTATTGAGCTGCTTGGAGCTGG + Intergenic
1109554585 13:63955462-63955484 TGAGCTGCATTGCCTGGAGTTGG + Intergenic
1109583658 13:64371456-64371478 GGAGCTGTGCTGCCTGGGGTTGG + Intergenic
1109685941 13:65819559-65819581 TGTGCTGAGCTGCCTGGAATTGG - Intergenic
1109747760 13:66648336-66648358 TGTGCTGAGCTGCCTGGTGCTGG - Intronic
1110079002 13:71287115-71287137 TGAGCTGTGCTGCCTGGGGTTGG + Intergenic
1110376837 13:74803355-74803377 TGTGCTGAGCTGCCTGTAACTGG - Intergenic
1110448659 13:75617265-75617287 TGTTTTGAGCTGCCTGGAGCTGG + Intergenic
1110885976 13:80636423-80636445 TGTGCTGAGCTTCCTGGAGCTGG + Intergenic
1110901598 13:80831792-80831814 TGTGGTGAGCTTCCTGGAGCTGG - Intergenic
1111085716 13:83373246-83373268 TGTGCTGAGCTGCCCAGAGATGG + Intergenic
1111292048 13:86183348-86183370 TGTGCTGAGCTGCCTGCAGCTGG - Intergenic
1111303342 13:86373524-86373546 CATGCTGAGCTGTCTGGAGCTGG + Intergenic
1111542820 13:89690236-89690258 TGTGCTGAGCCACCTGGAACTGG - Intergenic
1111568684 13:90049060-90049082 TCTGCTATGCTGCCTGGAGTTGG + Intergenic
1111572122 13:90103214-90103236 TGAGCTGTGCTGCCTGGTATTGG + Intergenic
1111583334 13:90252971-90252993 TGTGCTGGAGTGCCTGGAATTGG + Intergenic
1111639243 13:90946985-90947007 TGAGATGCGCTGCCTGGGGTTGG - Intergenic
1111639432 13:90948071-90948093 TATGCTGAGCTGCCTGGAACCGG - Intergenic
1111728387 13:92041619-92041641 TGAACTGAGCTGCCAGGTGTTGG + Intronic
1112861028 13:103829942-103829964 TTTGCTGAGCTCCCTGGGGGTGG + Intergenic
1112901383 13:104362414-104362436 TGTTCTGAGCCACCTGGAGCTGG + Intergenic
1113217727 13:108061619-108061641 TGTGCTGAGCTCCCTGAACCTGG - Intergenic
1113244125 13:108376328-108376350 CTTGCTGAGCTGCCTGGAGCTGG + Intergenic
1113704166 13:112415188-112415210 CACACTGAGCTGCCTGGAGTTGG + Intronic
1114245000 14:20904854-20904876 TGAGCTGTGCTGCCTGGGGTTGG - Intergenic
1114248008 14:20933026-20933048 TGAGCTGTGCTGCCTGGGGTTGG - Intergenic
1114250842 14:20959125-20959147 TGAGCTGTGCTGCCTGGGGTTGG - Intergenic
1114251012 14:20960188-20960210 TGTGTTGAGCTGCCTGGAGCTGG - Intergenic
1114761493 14:25321598-25321620 TGTTCTGAGCTGCCTGGAGCTGG + Intergenic
1114820308 14:26010038-26010060 TGAGCTGCCCTGCCTGGGGTTGG - Intergenic
1114820366 14:26010450-26010472 CATGCTGAACTGCCTGGATTTGG - Intergenic
1114985033 14:28216763-28216785 TTTGCTGAGCTGCCTTGAACTGG + Intergenic
1114994259 14:28328248-28328270 TGTGCTGGACTGCCTGGAGTTGG + Intergenic
1115655411 14:35438977-35438999 TTTCCTGAGCTGCCTATAGTGGG + Intergenic
1115661126 14:35495047-35495069 TGTGCTGAGCTTCCTGGAGCTGG - Intergenic
1115925201 14:38425447-38425469 TGGGCTGCACTGCCTGGGGTTGG + Intergenic
1115930137 14:38482182-38482204 TGAGCTGCACTGCCTGGAGTCGG - Intergenic
1115930239 14:38482913-38482935 CATGCTAAGCTGCCTGAAGTTGG - Intergenic
1116045662 14:39740057-39740079 AGAGCTGTGCTGCCTGAAGTTGG - Intergenic
1116086939 14:40253163-40253185 TTTGCTGAGCTGTCTGGAGTTGG + Intergenic
1116106551 14:40514681-40514703 TGTGCTGAGCAGCCTGGAGCTGG - Intergenic
1116392808 14:44413751-44413773 TGTGCTGAGCTTCCTGGAGCTGG - Intergenic
1116434179 14:44877863-44877885 TGTGCTGAGCCGCCTGGAGCTGG - Intergenic
1116669338 14:47821268-47821290 TGTGCTGAGCTGCCTGGGGCTGG + Intergenic
1117504369 14:56388048-56388070 TACGCTGAGCTGCCTGGAGCTGG + Intergenic
1117504491 14:56388749-56388771 TGAGCTGTACTGCCTGGGGTTGG + Intergenic
1117606883 14:57439548-57439570 TGTGCTGAACTGCCTGGAACTGG + Intergenic
1117795310 14:59387946-59387968 TGTGCTGAGCTGCCTGGAACTGG + Intergenic
1117842904 14:59880061-59880083 TGTGATGAGATGCCTGGAGCTGG + Intergenic
1117893392 14:60450776-60450798 TGTGCTGAGCTGCCTGGAGTGGG - Intronic
1118034108 14:61848441-61848463 TGTGCTGAGCAGTCTGGAAGTGG + Intergenic
1118034233 14:61849258-61849280 TGAGCTGCACTGCCTGGAGTTGG + Intergenic
1118241049 14:64059534-64059556 TGTGTTGAGCTGCCTAGAGCTGG + Intronic
1118549311 14:66932238-66932260 CATGCTGAACTGCCTGGAGTTGG + Intronic
1118763404 14:68894378-68894400 TGTGCTTAGCTGTCTGGAAGAGG - Intronic
1118861192 14:69665015-69665037 TGTGCCTGGCTGCCTGGACTGGG + Intronic
1119083727 14:71721305-71721327 TGTGCTGGGTTGCCTAGAGTTGG + Intronic
1119096746 14:71840114-71840136 TGTTCTGAGCTGCCTGGAGCTGG + Intergenic
1119172331 14:72544832-72544854 TCTGCAGAGCTGCCTGGAGGGGG - Intronic
1119295094 14:73526493-73526515 TGAGCTGCCCTGTCTGGAGTTGG - Intronic
1119426101 14:74535577-74535599 TGAGCTGGTCTCCCTGGAGTGGG - Intronic
1120126416 14:80749112-80749134 AGTGCTGAACTGCCTGGAGGTGG - Intronic
1120275658 14:82369965-82369987 TGAGCTGTGTTGCCTGGGGTTGG - Intergenic
1120444655 14:84579222-84579244 TTTGCTGAGCTGCCAGTGGTGGG + Intergenic
1120468082 14:84886262-84886284 TGTGCTGAGCTGCCTGAAGTTGG - Intergenic
1121324482 14:93012049-93012071 TCTGCTGGGCTGCTTGGAGCGGG - Intronic
1121376065 14:93411566-93411588 TGTTCTCAGCTGCCTGGGGCTGG - Intronic
1123111967 14:105876198-105876220 TGTTCTGAGCCTCCTGGAGATGG + Intergenic
1123448574 15:20346292-20346314 TGTGCTTACCTGCCTGCTGTGGG + Intergenic
1124081263 15:26500668-26500690 TGTTCTGAGCCACCTGGAGCTGG + Intergenic
1125249039 15:37678267-37678289 TGTGCTGATCTGACAGGAGGTGG + Intergenic
1125471519 15:40008877-40008899 TGTGCCGAGCTGGCTGCAATGGG - Intronic
1125722444 15:41851739-41851761 AGTGGGGAGCTGCCTGGAGAAGG + Intronic
1126053198 15:44706622-44706644 TGTGATCAGCTGCCTGGAGTTGG + Intronic
1126053391 15:44707674-44707696 TGAGCTGCCCTGCCTGGGGTTGG + Intronic
1126285691 15:47008578-47008600 TCTACTGAGCTTCCTGGAGCTGG + Intergenic
1126440479 15:48683200-48683222 TGAGCTGCCCTGCCTGGGGTTGG - Intergenic
1126440667 15:48684252-48684274 TATGCTGAGCTGCCTGGAGCTGG - Intergenic
1126706986 15:51414927-51414949 TATGCTGTGCTGCCTGGAGCTGG - Intergenic
1126865564 15:52933406-52933428 GGTGCTGAGCTGTCTGGTGGTGG + Intergenic
1126979902 15:54228802-54228824 TGAGCTGTGCTGCCTGGGGTTGG + Intronic
1127140498 15:55970540-55970562 TGTTCTGAGCTGCCTGGAGTTGG - Intronic
1127142555 15:55993139-55993161 TGTGCGGAGCTCCCAGGCGTTGG - Intronic
1127173599 15:56329058-56329080 TGTGCTGAGCTGTGTGGAGCTGG - Intronic
1127493348 15:59485390-59485412 TGTGCTGAGCTACCTGGAGCTGG - Intronic
1128215199 15:65929941-65929963 TGTGCAGAGCTGGGGGGAGTGGG - Intronic
1128966359 15:72061969-72061991 CTTGCTGAGCTGCCTGGAATTGG - Intronic
1129561875 15:76578482-76578504 TGTGCTGAGCTGCTTGCAGCTGG - Intronic
1129642513 15:77394406-77394428 TGTGCTGAGCTGCCTGGAAGTGG - Intronic
1129875775 15:78974277-78974299 TGTGCTGAGCTGAGAGGAGGCGG - Intronic
1130441029 15:83954864-83954886 TCTGCTGAGCCACCTGGAGCTGG + Intronic
1130961821 15:88664436-88664458 TGTGCCACGCTGCCTGGAGCTGG - Intergenic
1131095022 15:89649302-89649324 GGTGCTGAGCCTCCTGGAGATGG - Exonic
1131945026 15:97609836-97609858 TGTGCTGAGCTACCTAGAGCAGG - Intergenic
1131945124 15:97610994-97611016 TCTCCTGAGCTACCTGGAGCCGG - Intergenic
1131963576 15:97814134-97814156 AGGTATGAGCTGCCTGGAGTTGG + Intergenic
1132208541 15:100003195-100003217 TGCCCTGAGCTGCCTGGTGTGGG - Intronic
1133279883 16:4659312-4659334 TGTGCTGAGCTCTGGGGAGTGGG + Intronic
1133830014 16:9312607-9312629 TGAGCTGAGCTGACTCAAGTTGG - Intergenic
1133834046 16:9350899-9350921 TCTGCTGAGCTGTCTGGAGCTGG + Intergenic
1134107532 16:11494648-11494670 TGCGGCCAGCTGCCTGGAGTCGG - Exonic
1134358577 16:13507839-13507861 TGAGCTGGGCTACCTGGAGCAGG - Intergenic
1134394865 16:13853510-13853532 TGGCCTGAACTGGCTGGAGTTGG - Intergenic
1134434862 16:14247203-14247225 TGGGATGGGCTGCCTGGAGCTGG - Exonic
1134505053 16:14798414-14798436 TGTGCTGAGGAGTCTGGAGTGGG + Intronic
1134575522 16:15330495-15330517 TGTGCTGAGGAGTCTGGAGTGGG - Intergenic
1134726923 16:16426005-16426027 TGTGCTGAGGAGTCTGGAGTGGG + Intergenic
1134940514 16:18285858-18285880 TGTGCTGAGGAGTCTGGAGTGGG - Intergenic
1136610432 16:31362382-31362404 GGGGCTGTGCTGCCTGGGGTGGG + Intronic
1136610451 16:31362432-31362454 GGCGCTGTGCTGCCTGGGGTGGG + Intronic
1136610485 16:31362529-31362551 GGTGCTGTGCTGCCCGGGGTGGG + Intronic
1136618041 16:31410605-31410627 GGCGCTGTGCTGCCTGGGGTGGG + Intronic
1136618060 16:31410654-31410676 GGGGCTGCGCTGCCTGGGGTGGG + Intronic
1136676488 16:31913322-31913344 TATGCTGAGCTACCTGGAGCTGG + Intronic
1137286275 16:47018372-47018394 TGTGCCGCTCTGCCTGGAGCAGG + Intergenic
1137938183 16:52655633-52655655 TGTGCTTAGCTTCTTTGAGTTGG - Intergenic
1138845071 16:60555029-60555051 TGCACTGAGCTGCCAGGAGATGG + Intergenic
1139481126 16:67231316-67231338 TGAGCTGAGCTACCTGGAGAAGG - Exonic
1140057160 16:71535599-71535621 TGCACTGAGCTGCCTTGAGTAGG + Intronic
1140299418 16:73741546-73741568 TGCCCAGAGCTGCTTGGAGTTGG - Intergenic
1141205740 16:81932036-81932058 TGAGCTCACCTGCCTGGAGCTGG + Intronic
1141485276 16:84334605-84334627 TGTGCTGAGCCACCTGGAACTGG - Intergenic
1141953819 16:87356598-87356620 GGTGCGGAGGTGCCTGGATTTGG - Intronic
1143413637 17:6728787-6728809 TGAGCTGCACTGCCTGGGGTTGG - Intergenic
1143413813 17:6729862-6729884 TTTGCTGATCTGCCTGCAGCTGG - Intergenic
1144357268 17:14458159-14458181 TTTGCTGGGTTGCATGGAGTGGG + Intergenic
1145007359 17:19345101-19345123 TCTGCTTAGCTGGCTGGGGTTGG + Intronic
1145069134 17:19788267-19788289 TGAGCTGCGCTGCCTGGGTTTGG - Intronic
1145069304 17:19789215-19789237 TATGCTGAGCTACTTGGAGGTGG - Intronic
1145117349 17:20224214-20224236 CATGCTGAGCTGCCTGGAGTTGG + Intronic
1145117518 17:20225209-20225231 TGAGCTGTGCTGCCTGGGGTTGG + Intronic
1145200894 17:20943991-20944013 CATCCTGAGCTGCCTGGAGTTGG + Intergenic
1145812159 17:27770975-27770997 CAGGCTGAGCTGCCTGGAGGAGG - Exonic
1146216651 17:30981910-30981932 TGTGCTGAGCTGCCTGGAGCTGG + Intronic
1146242432 17:31243209-31243231 TGTGTTGAGCTGCCTGGAGCTGG + Intronic
1146242622 17:31244263-31244285 TGAGCTGAGCTGCCTGGGTTTGG + Intronic
1146373979 17:32281919-32281941 AGTGCTCAGCTGTCTGGAGGTGG + Intronic
1146615268 17:34351263-34351285 TGTGCTGAGATGCCTGGAGCTGG - Intergenic
1146842189 17:36163858-36163880 TAGGCTGAGCTTCCTGGAGGAGG - Intergenic
1146866121 17:36336559-36336581 TAGGCTGAGCTTCCTGGAGGAGG + Intronic
1146877756 17:36426790-36426812 TAGGCTGAGCTTCCTGGAGGAGG - Intronic
1148564000 17:48622493-48622515 TCTGCTGAGCTGTGTAGAGTTGG + Exonic
1148646138 17:49220433-49220455 TGTGCTGCGCTCCTTGGAGGAGG - Intronic
1149111196 17:53033096-53033118 TGTGCTGAGCTGCCTGGAGGTGG + Intergenic
1149180538 17:53931562-53931584 TGTGCTGAGCCACCTGGAGCTGG + Intergenic
1149239892 17:54636335-54636357 TGTGCTGAGCTGCTTGGAACTGG - Intergenic
1149242190 17:54663402-54663424 TGCGCTAAGCTCCCTGGGGTGGG - Intergenic
1149614093 17:57983351-57983373 TGTTCTGTGCTGCCTGCTGTTGG + Exonic
1149651793 17:58280409-58280431 GGTGCTGAGCTCCATGGAGGAGG - Exonic
1149845346 17:60006301-60006323 CAGGCTGAGCTGCCTGGAGGAGG - Intergenic
1149906386 17:60529776-60529798 TGTGCTGAGCTGCCTGGAGCTGG - Intergenic
1149992824 17:61392287-61392309 TGCGCTGAGGTGCTTGGAGAAGG - Exonic
1150083684 17:62262884-62262906 TAGGCTGAGCTGCCTGGAGGAGG - Intergenic
1150816460 17:68395966-68395988 TGTGCTGAGCCCTCTGGAGCTGG - Intronic
1150871144 17:68911715-68911737 TGTATTGAGCTGTCTGGAGCTGG - Intronic
1151334528 17:73432124-73432146 TGACGGGAGCTGCCTGGAGTGGG + Intronic
1151475982 17:74344600-74344622 TGTGCTGAGAGGCCTGGCGTGGG - Intronic
1151526267 17:74671110-74671132 TGCGCTGAGCTGCGTGGTGACGG + Intronic
1151679548 17:75616222-75616244 TGTGCTCTGCTCCCCGGAGTTGG + Intergenic
1151816454 17:76473734-76473756 TGTGCAGATCTGCCAGGAGGGGG + Exonic
1152313586 17:79566473-79566495 TGTGCTGTGCATCCTGGGGTGGG + Intergenic
1152422362 17:80200920-80200942 TGTGCTGAGCTGACAGGAGGTGG + Intronic
1152448633 17:80361963-80361985 TTTCCTCAGCTGCCTGGAGCTGG + Intronic
1152561189 17:81079567-81079589 TGGGGTGAGCTGCCCAGAGTTGG + Intronic
1153129178 18:1834858-1834880 TGAGCTGTACTGCCTGGGGTTGG - Intergenic
1153183165 18:2458968-2458990 TGTGCTGAGCTTCCTGGAGCTGG + Intergenic
1153356476 18:4142981-4143003 TGTGCTGAGCTGCCTGGAGCTGG + Intronic
1153425842 18:4961827-4961849 TGTTCTGAGCTATGTGGAGTTGG - Intergenic
1153429598 18:5000846-5000868 TGTGCTGAGATACCTGGAGCTGG - Intergenic
1153829872 18:8912652-8912674 TGTGCCGGGCTGCCAGGAGGAGG - Intergenic
1154405358 18:14085651-14085673 TGTGCTGCACTGCCTGGAGTTGG - Intronic
1154465233 18:14637665-14637687 TGCACTGCACTGCCTGGAGTTGG - Intergenic
1155282018 18:24249960-24249982 TCTGCTGTGCTGCCTGGGGTTGG - Intronic
1155533916 18:26795618-26795640 TGTTCTGAGCCACCTGGAGATGG - Intergenic
1155597414 18:27503284-27503306 TGTTCTGAGCTACCTTGAGCTGG - Intergenic
1156055702 18:32999617-32999639 TGTGCTGAGCTGCATGGAGCTGG - Intronic
1156786566 18:40922102-40922124 TGTGCTCAGCTCTCTGGAGGTGG + Intergenic
1156912279 18:42425373-42425395 TGTGCTGAGATGCCTGGAGCTGG + Intergenic
1157136141 18:45057649-45057671 AAGGCTGAACTGCCTGGAGTTGG - Intronic
1157294882 18:46435349-46435371 TGGGCTGAGGTGTCTGCAGTTGG - Exonic
1157585786 18:48800421-48800443 TGTGATGGGCTGGCTGGAGATGG - Intronic
1157879428 18:51305593-51305615 TGTGCTGAGCTGCCTGTAGCTGG - Intergenic
1157937090 18:51884663-51884685 TGTCCTGAGCTGCCTGGAGCTGG - Intergenic
1158116974 18:54006115-54006137 TGTGCTGAGCTGCCTTGTGCTGG - Intergenic
1158412751 18:57222194-57222216 TGTGTTGAGCCCACTGGAGTAGG - Intergenic
1158445440 18:57516513-57516535 TGAACTGAGCTGCCTAGAGAAGG - Intergenic
1158850694 18:61493351-61493373 TGCGCTGAGCATCCTGGAGGAGG - Intronic
1158948897 18:62474074-62474096 TGTGATGAGCTGCCTGGAGCTGG + Intergenic
1159091913 18:63859867-63859889 TGTGCTGAGCTGCCTGGAGCTGG + Intergenic
1159446431 18:68546004-68546026 GGTGCTGAGTTGCCTGGAGCTGG - Intergenic
1159648183 18:70943902-70943924 TGTGCTGAGCTGCCTGGAGCTGG - Intergenic
1159802477 18:72918958-72918980 TGTGCTGAGCTACCTGGAGTTGG + Intergenic
1160138359 18:76295576-76295598 TGTTTTGAGCTGCCTGGAGCTGG + Intergenic
1160270627 18:77380239-77380261 TGTACTGAGCTGCCAGGCGAGGG + Intergenic
1160653576 19:247266-247288 TGTCCTTAGCTGCCAGGAGGTGG - Intergenic
1162692900 19:12448826-12448848 TGTTCTGAGCCACCTGGAGCTGG + Intronic
1162693088 19:12449879-12449901 TGAGCTGTGCTGCCTGGGATTGG + Intronic
1163870997 19:19821340-19821362 GGTGCAGAGCTGCCCGGAGAGGG + Intronic
1163875025 19:19860808-19860830 GGTGCAGAGCTGCCCGGAGAGGG + Intergenic
1164146492 19:22515656-22515678 TGACCTGAGTTGCCTGGAGAGGG + Intronic
1164159874 19:22619478-22619500 TGACCTGAGTTGCCTGGAGAGGG - Intergenic
1164438323 19:28251673-28251695 TTTGCTAAGGTGCCTGGTGTGGG - Intergenic
1165053789 19:33160732-33160754 TGGGCAGAGCTTCCTGGAGAAGG + Intronic
1165485613 19:36093730-36093752 TGTGCTGGGCTTCCTGTAGGTGG - Intronic
1165983989 19:39751575-39751597 TGAGCTGTGCAGCTTGGAGTTGG - Intergenic
1166755956 19:45191791-45191813 TGTGCTGAGCTGCCTGGAGCTGG + Intronic
1166990311 19:46688930-46688952 TGTGGTGACCTCCCAGGAGTGGG - Intronic
1167083263 19:47291544-47291566 TGTGCTGAGATGCCTGGAGTTGG - Intronic
1167449232 19:49557156-49557178 TGTGCGGGGCTTCCTGGAGAAGG - Exonic
1167468346 19:49662119-49662141 TGTGCTGAGCTGCCTGGGTGGGG - Exonic
1167584696 19:50367599-50367621 TCTGCTGAGCTACCTGGAGCTGG + Intronic
1168000527 19:53442190-53442212 TGTGCTTAGCTTCTTTGAGTTGG - Intronic
1168005023 19:53479674-53479696 TGTGCTTAGCTTCTTTGAGTTGG - Intronic
1168449012 19:56448546-56448568 CCAGCTGTGCTGCCTGGAGTTGG - Intronic
1168449078 19:56448938-56448960 TGTGCTGAGCTGCCTAGAGTTGG - Intronic
1168605659 19:57758251-57758273 TAAGCTGTGCGGCCTGGAGTTGG - Intergenic
1168605820 19:57759238-57759260 TGTGCTGAGCTGCCTTTAGCTGG - Intergenic
925055115 2:851260-851282 TGAGTTGTGCTGCCTGGAGGAGG + Intergenic
925295010 2:2770379-2770401 AGTGCAGAGCTGCATGGAGCAGG - Intergenic
925484722 2:4315788-4315810 TCTGCTGAGCTGCCTGTAGCTGG + Intergenic
925484774 2:4316166-4316188 CAAGCTGTGCTGCCTGGAGTTGG + Intergenic
925572763 2:5329554-5329576 TGTGATGTGTTGCCAGGAGTGGG + Intergenic
925935825 2:8758408-8758430 TGAGCAGAGGTGCCTCGAGTTGG - Intronic
926518927 2:13884604-13884626 CTTGCTGAGCTCCCTGGAGTTGG - Intergenic
926601029 2:14845182-14845204 TGTTCTGAGCCGCCTGGAACTGG - Intergenic
926834046 2:16998470-16998492 TCTTCTGAGCTGCCTGGAGCTGG + Intergenic
926834219 2:16999480-16999502 TGAGCTGTGCAGCCTGGATTTGG + Intergenic
927570162 2:24152643-24152665 TGTGCTGAGCCACCTGGAGCTGG + Intronic
928293670 2:30061907-30061929 TGTACTGAGCTTCCTGGAGCTGG - Intergenic
928383938 2:30847668-30847690 TGTGCTTAGCTGCCTGAAGCTGG - Intergenic
928484051 2:31711638-31711660 TGAACTGTGCTGCCTAGAGTTGG - Intergenic
928484226 2:31712714-31712736 TGTGCTGAGTTGCCTGAAGCTGG - Intergenic
928738956 2:34326600-34326622 TGAGCTGAGATTCCTGGATTTGG + Intergenic
928768032 2:34671134-34671156 TGTGCTGAGCTTCCTGGAGTTGG - Intergenic
929024551 2:37587225-37587247 TTTCCTGAGCTTCCTGGGGTCGG + Intergenic
929100053 2:38302592-38302614 TGTGCTGAGCTGCCTGGAGCTGG - Intronic
929215306 2:39405200-39405222 TGTTCTGAGCTGCCTGGAGCTGG - Intronic
929281600 2:40086772-40086794 TGTGCTAAGCTGCCTGGATCTGG + Intergenic
929529173 2:42736299-42736321 TGTGCTGAGCTGCCTGGAGCTGG + Intronic
930230573 2:48840427-48840449 TGTGCTATGCTGCCTGGAGTTGG + Intergenic
930288746 2:49467359-49467381 TGTGCTGAACTGCCTGGATCTGG + Intergenic
930294430 2:49536595-49536617 TGTTCTGAGCCACCTGGAGCTGG - Intergenic
930778379 2:55197477-55197499 TGTGCTGAGCTGCCTGGAGCTGG - Intronic
930849411 2:55942628-55942650 TCTGCTGTGCTCCCAGGAGTTGG + Intergenic
931011151 2:57915835-57915857 TCTGCTGGGCTGACTGGAGGCGG - Intronic
931085855 2:58830298-58830320 TTTTCTGAGCTGCCTGCAGCTGG + Intergenic
931406968 2:61988605-61988627 TGAGCTGTGCTGCCTGGGGTTGG + Intronic
931572206 2:63680741-63680763 TGAGCTTTGCTGCCTGGGGTTGG - Intronic
931600922 2:64001807-64001829 TGAGCTGGGCTGCCTGGGCTTGG + Intronic
931637380 2:64352561-64352583 TGTCCTGAGCCACCTGGAGCTGG - Intergenic
931736664 2:65200175-65200197 TGTGCTGAGCTGCCTGGAGCTGG - Intergenic
932336497 2:70934666-70934688 TGTCCTGAGTCACCTGGAGTGGG + Intergenic
933489700 2:82970131-82970153 CATGCTGGGCTGCCTGGAGCTGG + Intergenic
933560488 2:83879595-83879617 AGAGCTGAGCTGCCAGGTGTTGG - Intergenic
934577937 2:95414673-95414695 TGTGCTGGGCTTCCTTGGGTGGG - Exonic
934601501 2:95662029-95662051 TGTGCTGGGCTTCCTTGGGTGGG + Intergenic
934779907 2:96963311-96963333 TGAGCTGAGGTGCATGGATTTGG - Intronic
934870563 2:97861328-97861350 TGAGCTGTGCTGCCTGGGGTTGG - Intronic
934870691 2:97862005-97862027 TGTGCTGAGCCACCTGGATCTGG - Intronic
934929109 2:98405500-98405522 TGTGCTGAGCTGCCTGGGGCTGG - Intergenic
935018831 2:99211364-99211386 TGTGCTGGGCTGTCTAGAGTTGG + Intronic
935019377 2:99215360-99215382 TGGGCTGAGCTGGATGGAGCTGG - Intronic
935078493 2:99769864-99769886 TGTGCTGAGCAGCCTGGGGCTGG + Intronic
935478495 2:103556362-103556384 TGTGCTGAGCTTCCTGGAGCTGG + Intergenic
935576463 2:104716793-104716815 TGTGCTGAGCCACCTGAAGCTGG + Intergenic
935617338 2:105100290-105100312 GGAGCTGAGCTGCCAGGTGTGGG + Intergenic
935813070 2:106818347-106818369 TGTGCTGAGCTGCCTAGAGTGGG - Intronic
936226688 2:110660710-110660732 TCTGGTTAGCTGCCTGGAGCCGG - Intronic
936534864 2:113304193-113304215 TGTGCTGGGCTTCCTTGGGTGGG + Intergenic
936778107 2:115998622-115998644 TCTGCTGAGCTGCCTGGGGCAGG + Intergenic
936885153 2:117300804-117300826 TGCTCTGAGCTGCCTGGAGCTGG - Intergenic
936925282 2:117730661-117730683 TGAGCTGCGCTGCTTGGGGTTGG - Intergenic
937318356 2:120946355-120946377 TGAGCTGAGCGGCCTGCAGAAGG + Intronic
937702754 2:124882327-124882349 TGTGCTGAGATGACAGGAGGGGG + Intronic
939090713 2:137776944-137776966 TCTGCTGAGGTGCCTGATGTAGG - Intergenic
939707969 2:145478820-145478842 TGAGCTGCACTGCCTGTAGTTGG + Intergenic
939913008 2:148006127-148006149 AGTGCTGTGCTGCCTGGGGTTGG - Intronic
940468772 2:154065493-154065515 TGTGCTAAGCTGCCTGGAGCTGG - Intronic
940546976 2:155100943-155100965 TGTGCTGAGCCACCTGGAACTGG - Intergenic
940559870 2:155281599-155281621 TGAGCTGTACTGCCAGGAGTTGG + Intergenic
940786237 2:157984611-157984633 TGTTCTGAGCCACCTGGAGCTGG + Intronic
941343041 2:164330777-164330799 TGTGCTCAGCTGCCTGCAACAGG + Intergenic
941559620 2:167028334-167028356 TGTCCTGAGCTGCCTGAATCAGG - Intronic
941742336 2:169047818-169047840 TGTGCTGAGCCACCTGGAGCTGG - Intergenic
941745855 2:169086869-169086891 TATACTGAGCTGCCTAGAGCTGG + Intronic
941851874 2:170191276-170191298 TGCGCTGCACTGCCTGGGGTTGG + Intronic
942035719 2:172008952-172008974 TGTCCTGAGCAGAATGGAGTGGG + Intronic
942562353 2:177234043-177234065 TGTGCTGGGCTGGCTGAATTGGG + Exonic
942778380 2:179612601-179612623 TGTGCTGAGTTATCTGGAGCTGG + Intronic
942814357 2:180034300-180034322 TGAGCTGTACTGCCTGGGGTTGG + Intergenic
942834399 2:180276837-180276859 TGTGCTGAGCCACCTGGAACTGG + Intergenic
942862909 2:180636828-180636850 TGTGCTAAGCTGCTTGGAGCTGG - Intergenic
942881846 2:180871012-180871034 TGAGCTATGCTGCCTGGGGTTGG - Intergenic
942882014 2:180872077-180872099 CCTGCTGACCTGGCTGGAGTTGG - Intergenic
943099588 2:183471861-183471883 TGAGCTGTACTGCCTGGGGTTGG + Intergenic
943117395 2:183691109-183691131 TATCCTGAGCTGCCTGGGGCTGG + Intergenic
943255029 2:185583738-185583760 CATTCTGTGCTGCCTGGAGTTGG - Intergenic
943331241 2:186561731-186561753 TGGGCTGAACTTCCTGGAGTCGG - Intergenic
943913211 2:193594074-193594096 TGTGCTGAGACACCTGGAGCTGG - Intergenic
943941813 2:194008344-194008366 TATGTTGCACTGCCTGGAGTTGG - Intergenic
944046099 2:195413768-195413790 TGAGCTGCACTGCGTGGAGTTGG - Intergenic
944078757 2:195760552-195760574 TCTGCTGAGCTGCTTGAAGCTGG - Intronic
944096637 2:195975616-195975638 TGAGCTGTGCTGCCTGGGGTTGG - Intronic
944096821 2:195976702-195976724 TCTGCTAAGCTGCCTGGAACTGG - Intronic
944133323 2:196370468-196370490 TGAGCTGTGCTGCCTGGGGGTGG + Intronic
944616267 2:201464457-201464479 CATGCTGAGCTGCCTGGAGCTGG + Intronic
944639437 2:201707962-201707984 TTTCCTGAGCTGCCTGAAGAAGG - Exonic
944751879 2:202717673-202717695 TGTTCTGAGCCCCCTGGAGCTGG + Intronic
944854966 2:203759067-203759089 CATGCTGAGCTTCCTGGAATTGG + Intergenic
944955192 2:204799644-204799666 TGTGCTGAGCTGCCTGGAGCTGG - Intronic
944963251 2:204900987-204901009 TCTGCTGAGCTTCCTGGAGCTGG + Intronic
944990586 2:205230577-205230599 TGAGCTGCACTGCCTGGGGTTGG + Intronic
945210347 2:207375862-207375884 TGTGCTGAGCCACCTGGAGCTGG - Intergenic
945484377 2:210377769-210377791 TGTGCTGTGCTGCCTGGAATTGG - Intergenic
945575772 2:211526225-211526247 TGTGTTGAGCTGCCTGGGGCTGG - Intronic
945803623 2:214464504-214464526 CATGCTGAGCTCCCTGGAGCTGG + Intronic
946984635 2:225257937-225257959 TGAGCTGTGCAGCCTGGGGTTGG - Intergenic
947439623 2:230108360-230108382 TTTGCTGAGCAGCCTGGAACTGG + Intergenic
947476833 2:230457607-230457629 AATGCTGTGCTTCCTGGAGTTGG + Intronic
947505219 2:230703599-230703621 TGTGCTAAGCTGCTTGGAACTGG + Intergenic
947586880 2:231361940-231361962 TGTGCTGAGCTTCCTTGGGTGGG + Intronic
947687035 2:232097281-232097303 TGTGCTGAGCCACCTGGAGCTGG + Intronic
948103827 2:235396885-235396907 TGTGCTGAGCAGCCTGGCTTGGG + Intergenic
948475379 2:238215725-238215747 TGTGTTGAGATGCCTGGAGCTGG + Intergenic
948475565 2:238216774-238216796 TGAGTTGTGCTGCCTGGGGTTGG + Intergenic
948774605 2:240277417-240277439 TGAGCTGCACTGCCTGGAGTTGG - Intergenic
948774785 2:240278491-240278513 TATGTTGAGCTACCTGGAGCTGG - Intergenic
1168743913 20:219548-219570 TGTGCCAGGCTGCTTGGAGTTGG - Intergenic
1168795548 20:608436-608458 TGGGCTGAGAAGCCAGGAGTGGG - Intronic
1168899989 20:1355202-1355224 TAAGCTGTGCTGCCTGGAGTTGG + Intronic
1169163487 20:3403184-3403206 TGTGTTGAGCTGCTTGGATGTGG - Intronic
1169623963 20:7541243-7541265 TGTGAGAAGCTGCCTGGAGTTGG - Intergenic
1170311595 20:14997875-14997897 CATGCTGAACTGCCTGGAATTGG - Intronic
1170668317 20:18406251-18406273 TGAGCTGCACTGCCTGGAGTTGG - Intronic
1170709142 20:18774738-18774760 AGTGCTGAGCTGCCTGGAGCTGG + Intergenic
1171943040 20:31349362-31349384 TGTGGTGAACTGCCTGGAGCTGG - Intergenic
1172177423 20:32980718-32980740 GGGGCTGAGCTGCATGCAGTGGG + Intergenic
1172310259 20:33912716-33912738 TGTGCTTAGCTTCTTTGAGTTGG + Intergenic
1172825936 20:37786125-37786147 TGTGCTGAGCTGCCTGGTGCTGG + Intronic
1173126999 20:40346240-40346262 TGTGCTGAGCCACCTGGAACTGG - Intergenic
1173204102 20:40979303-40979325 TGTGCTGTGCTGCCTAGAGCTGG + Intergenic
1173748506 20:45457014-45457036 TGTGCTATGCTGCCTGAACTTGG + Intergenic
1173869835 20:46334397-46334419 TTGGCTCAGCTGCCTGGAGTGGG + Intergenic
1173918155 20:46725156-46725178 TGGGCTAAGCTGCTTGGAGCAGG + Exonic
1174520664 20:51128014-51128036 TGAGCTGTGCTGCCTGGCCTGGG - Intergenic
1174690982 20:52504169-52504191 TGAGCTGTGCTGCCTGGGGTTGG - Intergenic
1174938669 20:54899159-54899181 TGTGCTGAGCTGCTTGGAACTGG - Intergenic
1175545982 20:59778132-59778154 TGTGCTCTCCTGCCTGGACTTGG + Intronic
1175632059 20:60549771-60549793 TGTGCCAAGCTGCCTGGAGCTGG + Intergenic
1175841499 20:62030626-62030648 TGTACTGAGGTGTGTGGAGTAGG - Intronic
1176263629 20:64197167-64197189 TGTGCTCCACAGCCTGGAGTCGG + Intronic
1176809307 21:13520721-13520743 TGCACTGCACTGCCTGGAGTTGG + Intergenic
1176939811 21:14911206-14911228 TGTGCTGACCTGCCTAGAGCTGG + Intergenic
1177137268 21:17318605-17318627 TGTGCTGTGCTGCCTGGAGTTGG - Intergenic
1177740511 21:25148044-25148066 TGTGCTGAGCTGCATGGAGATGG + Intergenic
1177760766 21:25400009-25400031 AAAGCTGCGCTGCCTGGAGTTGG - Intergenic
1177760829 21:25400422-25400444 TGTGCTGGGCTGACTGGAGCTGG - Intergenic
1177771429 21:25519990-25520012 TATGCTGAACTGCCTGGAGTTGG - Intergenic
1179558870 21:42200036-42200058 ATTGGTGAGCTGCCTGGATTTGG + Intronic
1179652438 21:42820401-42820423 TGAGCTGTGCTGCCTGGGGTTGG - Intergenic
1179959695 21:44761154-44761176 TGTGCTGAGCTGCACGGAGCAGG + Intergenic
1180184610 21:46133266-46133288 GGTGCTGACCTGACAGGAGTGGG + Intergenic
1180980442 22:19875811-19875833 TGTGCTGACCTTCCTGTTGTTGG - Intronic
1181717054 22:24738526-24738548 TGTGCTGAACCGCCTGGAGCTGG - Intronic
1181780723 22:25190983-25191005 AAAGCTGGGCTGCCTGGAGTGGG + Intronic
1182555997 22:31128564-31128586 TGTGCTGCGTCACCTGGAGTCGG - Exonic
1183013777 22:34969409-34969431 TGTGCTGTGCTTCATGGAGATGG - Intergenic
1184430645 22:44439994-44440016 TGTGGTGAGGGGCTTGGAGTAGG - Intergenic
1184524668 22:45014816-45014838 TCTGCTAAGCTGCCTGGAGGCGG + Intergenic
1185070598 22:48653797-48653819 TGAGCTGTGCTCCCTGGAGCTGG - Intronic
1185131413 22:49041237-49041259 AGGGCTGATCTGCCTGGAGTCGG - Intergenic
1185198847 22:49490091-49490113 GAGGCTGAGCTACCTGGAGTGGG - Intronic
949622984 3:5837235-5837257 TGTGTTGAGCTGCCTAGAATTGG + Intergenic
949829136 3:8196196-8196218 TGTGCTGAGCTGCCTGGAGCTGG + Intergenic
949852379 3:8432383-8432405 TGTACTGAGTTGACTGGAGATGG - Intergenic
949858206 3:8481564-8481586 TGAAATGAGCTGCCTGGAGAGGG + Intergenic
950695517 3:14698638-14698660 TGTGCTGAGCCACCTGGAGCTGG + Intronic
951129992 3:19030464-19030486 TATACTGAGCTGCTTGTAGTTGG - Intergenic
951259967 3:20495861-20495883 TGAGCTGCACTGCCTGGGGTTGG + Intergenic
951392863 3:22129203-22129225 TCTGCTGAGCTACCTAGAGCTGG + Intronic
951398805 3:22204115-22204137 TCTGCTGAGCTGTCTGGAGCTGG - Intronic
951436863 3:22675770-22675792 TATGATGACCTGCCTGGAGCTGG + Intergenic
951495116 3:23317051-23317073 TGAGCTGTGCTGCCTGGAGTTGG + Intronic
952008780 3:28875367-28875389 TGTGCTGAGATGCCTGGAGCTGG + Intergenic
952673111 3:35994528-35994550 TGTGCTTAGCTGTCTGGAACTGG - Intergenic
952721842 3:36541787-36541809 TGTGCTGGGCTGGCTAGAGATGG + Intronic
952811772 3:37410918-37410940 TCTGCTGAGCTGCCTGGAGCTGG + Intronic
952912590 3:38203702-38203724 TGGGCGGAGCTGTCTGGAGCTGG + Intronic
953362306 3:42308953-42308975 TGTGCTGAGCTACCTGTAACTGG + Intergenic
953392400 3:42541068-42541090 TCTGCTGTGCTGGCAGGAGTGGG + Intergenic
953853159 3:46481121-46481143 GGTACTGAGCTTCCTGGAGGGGG - Intronic
953919566 3:46942704-46942726 TGAGATGAGCTGCCCTGAGTTGG - Intronic
955274250 3:57532701-57532723 TGTGCTGAGCTGCCTGGAGCTGG + Intronic
955361552 3:58280582-58280604 TTTGCTGAGCTGACAGAAGTAGG - Intronic
957262705 3:77921753-77921775 TTTGCTGAGCTGCAGGAAGTGGG - Intergenic
957537894 3:81530685-81530707 TATCCTGAGCTGCCTGGAATTGG + Intronic
957745720 3:84339793-84339815 AGTGCTGAGCTGCCTGGACTAGG + Intergenic
957810330 3:85214303-85214325 TTTGCTGAGCTGCCTAGAGCTGG + Intronic
957925557 3:86805795-86805817 TGTTCTGAACTACCTGGAGCTGG - Intergenic
957965950 3:87322396-87322418 TGTGCTGAGCTGCTTGGTGCTGG - Intergenic
957976073 3:87447196-87447218 TGTGCTGAGCTGCCTAGAATTGG + Intergenic
957977190 3:87461322-87461344 TGTGCTGAGCTGCCTGGAGTTGG - Intergenic
958052205 3:88362887-88362909 TGCGCTGCACTACCTGGAGTTGG + Intergenic
958147225 3:89640818-89640840 TGTGCTGAGCTGCCTGGAATTGG - Intergenic
958174784 3:89983258-89983280 TATGTTGAGCTGCCTGGAGTTGG - Intergenic
958670474 3:97197617-97197639 TGAGTTGTGCTGCCTGGGGTTGG + Intronic
958682950 3:97353904-97353926 TGAGCTGAACTGCCTGGATCTGG - Intronic
958760259 3:98297654-98297676 TCTGCTGAGCTGCCTGAAGCTGG - Intergenic
958837605 3:99163561-99163583 AGGGCTGAGCTGCCTGGAGCTGG - Intergenic
958840091 3:99192528-99192550 TGTTCTGAGCCACCTGGAGCTGG - Intergenic
959118389 3:102205442-102205464 TGTTCTGAGCTGCTTTGAGTGGG + Intronic
959127628 3:102308727-102308749 TGTGCTGAGCTGCCTGGAGCTGG - Intronic
959189914 3:103097819-103097841 TGAGCTGCACTGCCTGGGGTTGG + Intergenic
959191248 3:103113760-103113782 TGTGCTGAGCCACCTGGAACTGG - Intergenic
959285058 3:104397959-104397981 TGTGCTGAGCTGCTTGGATTTGG - Intergenic
959408952 3:105997130-105997152 TGTACTGAGCTGCATGTAGCTGG + Intergenic
959448165 3:106466595-106466617 TGTGCTGCACTGCCTAGAGCTGG + Intergenic
959466903 3:106699436-106699458 TGTGCTCAGGTGCCTGCAATGGG + Intergenic
959547327 3:107612611-107612633 TATGCTGAGCTGTCTAGAGCTGG + Intronic
959640091 3:108622895-108622917 TGTATGGAGCTGCCTGGAGCTGG + Intronic
959717144 3:109444937-109444959 TGTGCTGAGCTGCCTGAGGCTGG - Intergenic
959841759 3:110984335-110984357 TGTGCTGAACTCCCTGGAGCTGG - Intergenic
959913786 3:111793954-111793976 AGAGCCGTGCTGCCTGGAGTTGG + Intronic
960067247 3:113387241-113387263 CGAGCTGTGCTGCCTGGGGTTGG - Intronic
960095378 3:113685220-113685242 CATGCTGAGCTGCCCGGAGTTGG + Intronic
960153432 3:114274374-114274396 TGTGCTGAGCTTCTTGGAGCTGG + Intergenic
960153585 3:114275425-114275447 TGTGCCGTGCTGCCTGGGGTTGG + Intergenic
960207210 3:114917740-114917762 TGTGCTTAGCTGCCTGGTGCTGG + Intronic
960353955 3:116628502-116628524 CATGCTGGGCTACCTGGAGTTGG + Intronic
960404270 3:117239477-117239499 TGCGCTGAGCTTCCTGAAGCTGG - Intergenic
960499018 3:118412573-118412595 TGTGCTGAGCTTCCTGGAGCTGG - Intergenic
960565022 3:119123637-119123659 TGTGCTGAGCTTCCTGGAGCTGG - Intronic
960766520 3:121136173-121136195 TGTGCTGTGCTGCCTGGTGTTGG - Intronic
960870146 3:122239695-122239717 TGTGCTGAGGTTCCTGGAGCTGG - Intronic
961406582 3:126684018-126684040 TGAGCGGAGCTGGCTGGAGTGGG - Intergenic
962078626 3:132113897-132113919 GGTGCTGAGCTGCCTGGAGCTGG + Intronic
962465629 3:135655355-135655377 TGTGCTGGGCTGCCTGGAGCTGG - Intergenic
962767679 3:138580298-138580320 TGTGCTGAGCTGCCTGGAATTGG - Intronic
962870794 3:139491362-139491384 TCTGCTGAGCTGCCTGGAGCTGG + Intergenic
962870910 3:139492130-139492152 CAAGCTGTGCTGCCTGGAGTTGG + Intergenic
962998028 3:140651074-140651096 TGAGCTGAGCTGTCTAGGGTCGG - Intergenic
963020349 3:140868017-140868039 TGTGCTGGGCTGCCTGGAGCTGG + Intergenic
963310207 3:143700933-143700955 TGTTCTAAGCTGCCTGGACCTGG - Intronic
963430680 3:145197737-145197759 CATGCTGAGCTACCTGGAGTTGG - Intergenic
963528624 3:146446522-146446544 TGTGCTGAGCTGCCTAGATCTGG + Intronic
963528798 3:146447633-146447655 CAAGCTGTGCTGCCTGGAGTTGG + Intronic
963562523 3:146883698-146883720 TGGCTTGAGCTGCCTGGAGAGGG - Intergenic
963802343 3:149688410-149688432 CATTCTGAGCTGCCTGGAGTTGG - Intronic
964140716 3:153396355-153396377 TGTGTTGAGGTGCCTGGAGTTGG + Intergenic
964253641 3:154749803-154749825 GGAGCTGTGCTGCCTGGGGTTGG - Intergenic
964258808 3:154810942-154810964 TGTGCTGAGCTGCCTGGAGCTGG + Intergenic
964582793 3:158259444-158259466 TGTGCTGAACTGCCTGGAACTGG + Intronic
964992792 3:162835160-162835182 TGTGCTGAGCTGCCTGGATTTGG + Intergenic
965000011 3:162941204-162941226 TGTGCTGAACTGCCTGGAATTGG - Intergenic
965027015 3:163315544-163315566 TGTGCTAAGCTGCCTGAAGTTGG + Intergenic
965034624 3:163422900-163422922 TGAGCTGAGCTGCCTTGGATTGG - Intergenic
965045722 3:163574021-163574043 TCTGCTGAGCTGCCTGGAGCTGG - Intergenic
965059897 3:163772557-163772579 GGTGCTGAGTTGCCTGGAGCTGG + Intergenic
965099696 3:164279268-164279290 TGTGCTGAGCTTCCTGGAGCTGG - Intergenic
965231594 3:166060999-166061021 CATGCTGTGCTGCCTGGGGTTGG - Intergenic
965264387 3:166522170-166522192 TATGCTGAGCTGCCTAGAGTTGG + Intergenic
965291506 3:166887730-166887752 TGTGCAGTCCTGCCTGGATTGGG + Intergenic
965358805 3:167710825-167710847 TGTGCTGAACTTCCTGAAGCTGG - Intronic
965853933 3:173065650-173065672 TGTGCTGCTTTGCCTGGGGTTGG - Intronic
965854054 3:173066439-173066461 CATGCTGGGCTGCCTGGAGTTGG - Intronic
965867083 3:173217242-173217264 TGAGCTGTGCTGCCTGGGGTTGG + Intergenic
965975237 3:174613156-174613178 TGTTCTGAGCTGCCTGGAGCTGG + Intronic
965980419 3:174682532-174682554 TGTGCTGAGATGCCTGGAGTTGG - Intronic
966142050 3:176767706-176767728 TGTGCTGAGCTGTCTGGTGCTGG - Intergenic
966151795 3:176874261-176874283 TGTGCTGAGCCATCTGGAGCCGG - Intergenic
966401059 3:179547097-179547119 TGTGCAGACCTGCCTGGAGCTGG - Intergenic
966453822 3:180093273-180093295 TGTGCTGAGCTTTCTGGAGCTGG + Intergenic
966463602 3:180204079-180204101 TGTGCTGAGCTGCCTGGAGCTGG - Intergenic
967636717 3:191809591-191809613 TGAACTGAGCTTCCTGGAGCTGG - Intergenic
967677593 3:192317858-192317880 TGTGCTAAGCTGCCTGGAGCTGG - Intronic
967754803 3:193156921-193156943 TGTTCTGTGCTGCCTGCTGTTGG + Intergenic
968005067 3:195237034-195237056 TGAGCTGCGCTGCCTGGGTTTGG + Intronic
968890103 4:3364333-3364355 TGTGCTGAGCTTCCTGGCACTGG + Intronic
968945230 4:3660137-3660159 TGGGATAAGCTGCCTGGTGTGGG - Intergenic
969660527 4:8524939-8524961 TGTGGTGACCTTGCTGGAGTGGG + Intergenic
970098031 4:12487130-12487152 TGAGCTGTGCTGCCTGGGGTTGG + Intergenic
970892922 4:21067742-21067764 TGTGCTGAGCTTCCTGGAGCTGG - Intronic
970915426 4:21328436-21328458 TGTGCTGAGGTGCCTGGAGCTGG + Intronic
970963289 4:21898340-21898362 CGAGCTGTGCTGCCTGGGGTTGG - Intronic
971171664 4:24239968-24239990 AGAGCTGAGGTGCCTGGGGTGGG - Intergenic
971690445 4:29827421-29827443 TGTGCTGAGCTGCCTGAAGCTGG - Intergenic
972007442 4:34128286-34128308 TATGCTGAGCTGCCTGGAGTTGG - Intergenic
972207889 4:36799449-36799471 TGTGCTGAGATGTTTGGGGTTGG - Intergenic
972253736 4:37332236-37332258 TGAGCTGCACTGCCTGGGGTTGG - Intronic
972253930 4:37333365-37333387 TGTGCTGAGCTTCCTGGAGCTGG - Intronic
972579374 4:40380924-40380946 TGTGCTGAGTTGCCTGGAGACGG - Intergenic
973054021 4:45631243-45631265 TGTACTGAGCTGCCTGGGGCTGG - Intergenic
973074103 4:45901081-45901103 TATGCTTGGCTGCCTGGAATTGG - Intergenic
973109502 4:46379357-46379379 TGTGCTTGGGTGCCTGAAGTGGG - Intronic
973919694 4:55672875-55672897 CGTGCTGAGCTTCCTGGAACTGG + Intergenic
974016996 4:56656546-56656568 TGTGCAGCCCTGCCTGGAGAGGG - Intronic
974224315 4:59018868-59018890 TGAGCTGTGCTGCCTGTGGTTGG + Intergenic
974267060 4:59598827-59598849 CTTGCTGTGCTGCCTGGAGCTGG - Intergenic
974285704 4:59864656-59864678 TTAGCTGTGCTGCCTGGAGTTGG + Intergenic
974333254 4:60506368-60506390 TGTTCTGAGCTCCCTGGACATGG - Intergenic
974559322 4:63496011-63496033 TGTGCTGAGCAGCCTGGTTGTGG - Intergenic
974589032 4:63919602-63919624 CATGCTGAGCTGCCTGGAATTGG + Intergenic
974589106 4:63920155-63920177 TAAGCTGCACTGCCTGGAGTTGG + Intergenic
974867827 4:67602744-67602766 TGTGCTGAGCTGCCTGGAGCTGG + Intronic
975335400 4:73170131-73170153 TAAGCTGTGCTGCCTGAAGTTGG - Intronic
975365642 4:73524537-73524559 TGAGCTGTGCAGCCTGGGGTTGG + Intergenic
975464287 4:74691982-74692004 TGTCCTGAGCTGCCAGCAGGGGG - Intergenic
975592663 4:76016435-76016457 TGTGCTGAGCTGCTTGGGGTTGG + Intronic
975592847 4:76017518-76017540 TGAGCTGTGTTGCCTGGAGTTGG + Intronic
975675177 4:76820896-76820918 CATGCTCAGCTGCCTGGAGCTGG + Intergenic
976161319 4:82202057-82202079 TGTGCTGGGCTGCCTGGAGTTGG - Intergenic
976728383 4:88239249-88239271 TGTGATGAGCTGTCTGGAGCTGG + Intergenic
976892785 4:90070637-90070659 TCTGCTAAGCTGCCTCAAGTGGG + Intergenic
976908353 4:90267616-90267638 TGTGCTCAGCTGCCTGCAGCTGG - Intronic
977325583 4:95571677-95571699 TGTGCTGAGCCACCTGGAACAGG + Intergenic
977341611 4:95764874-95764896 TCTGCTGAGCTGCCTAGAGCTGG - Intergenic
977396967 4:96483638-96483660 CACGCTGAGCTGCCTGGAGGTGG + Intergenic
977797957 4:101191474-101191496 TGTGCTGACTTGCCAGCAGTGGG + Intronic
977873577 4:102123298-102123320 TATGCTAAGCTGCCTGGAGCTGG + Intergenic
978008524 4:103650201-103650223 TGTTCTGAGCCACCTGGAGCTGG + Intronic
978520336 4:109609082-109609104 TGTGCTGAGCTGCCTGGAGCTGG + Intronic
979073351 4:116240372-116240394 TGGTCTGAGCTGCCTGAAGCTGG + Intergenic
979142864 4:117200851-117200873 TGAACTGTGCTGCCTGGGGTTGG - Intergenic
979156161 4:117392869-117392891 TGTGCTAAACTGCCTGGATCTGG - Intergenic
979184733 4:117773467-117773489 TGTGCTGAGCTGCCTCAAGCTGG - Intergenic
979213174 4:118131923-118131945 TGTGCTGAGCTGCCTGGAACTGG + Intronic
979395154 4:120178551-120178573 TGTGCTGAGCTGCCTGGAGCTGG - Intergenic
979573107 4:122252928-122252950 TGTGCTGAGCTTCCTGGAGCTGG - Intronic
979892686 4:126119578-126119600 TGTGCTGAGCCACTTGGAGCTGG + Intergenic
979913081 4:126395806-126395828 ACTGCTGAGCTGCTTGGAGTTGG + Intergenic
980227028 4:129999429-129999451 TGTGCTGAGCTGCCTGCAGTTGG - Intergenic
980646928 4:135653825-135653847 TGTGCTGAGCTGCCTGGAGCTGG - Intergenic
980657803 4:135812131-135812153 TTTGTTGAGCTGCCTGGATTTGG - Intergenic
980850897 4:138380120-138380142 GGTCCTGAGTTGCCTGAAGTGGG - Intergenic
981106402 4:140886332-140886354 TGTGTTCAGCTGAGTGGAGTGGG + Intronic
981140343 4:141260120-141260142 TGTGTTGAGCTGCCTGAAGCTGG - Intergenic
981394802 4:144234659-144234681 TGTGATGAGCTGCCTGAAGTTGG - Intergenic
981396770 4:144259045-144259067 AGTGCTGAGATGGCTGCAGTTGG + Intergenic
981530693 4:145751502-145751524 TGTTCTGAGCTGCCTGGAACTGG + Intronic
981653252 4:147082680-147082702 TTTACTGAGATCCCTGGAGTGGG + Intergenic
981837034 4:149065787-149065809 CATGCTGAGCTGCCAGGAGCTGG - Intergenic
981880584 4:149606218-149606240 TGTACTGGGCTGCCTGGAGCTGG - Intergenic
981894055 4:149775850-149775872 GGTGCTGAGCTACGTGGGGTTGG + Intergenic
981996264 4:150978165-150978187 TGTGCTGAACCACCTGGAGCTGG - Intronic
982719859 4:158848266-158848288 TCTGCTGAGCTGCCTAGAGCTGG - Intronic
982911504 4:161148417-161148439 TGAGCTGCACTGCCTGGGGTTGG - Intergenic
982911677 4:161149508-161149530 TGTGCTGAGCTTCGTGGAGCTGG - Intergenic
983017346 4:162629123-162629145 TGTGCAGAACTGCCTGGAGCTGG - Intergenic
983050208 4:163037767-163037789 TGTGCTGTGCTTCCAGGAGATGG - Intergenic
983050267 4:163038163-163038185 TGTGCTGGGCTGCCTACGGTTGG - Intergenic
983389027 4:167103869-167103891 TGTGATGACCTGCCTGGAGTTGG - Intronic
983456222 4:167968428-167968450 TGAGCTGTGCAGCCTGGGGTAGG - Intergenic
983493217 4:168412804-168412826 TGTGTTGAGCTGCCTGGAGCTGG - Intronic
983908193 4:173206247-173206269 TAAGCTGTGCTGCCTGGGGTTGG + Intronic
984358830 4:178701347-178701369 AGAGCTGAGCTGCCAGGAGTTGG - Intergenic
984396719 4:179211332-179211354 TGTTCTGAGCTGCCTAGAGATGG + Intergenic
984529599 4:180900998-180901020 TGTGCTGAGCAACCTGGAGCTGG + Intergenic
985089904 4:186351833-186351855 TGTGCTGAGCACCCAGGAGCAGG - Intergenic
985213892 4:187628759-187628781 TGTGCTGTGCTGCCTGGGCATGG - Intergenic
985229406 4:187798938-187798960 TAAGCTGTGCTGCCTGGGGTTGG - Intergenic
985229604 4:187800010-187800032 TGTAGTGAGCTGCCTGGACCGGG - Intergenic
985392810 4:189508631-189508653 TGAGCTGAAGTGGCTGGAGTGGG + Intergenic
985428105 4:189849940-189849962 TGTGCTGAGCTGTCTAGGATTGG - Intergenic
985488939 5:167799-167821 TTTCATGAGCTGGCTGGAGTGGG - Intronic
985718512 5:1476291-1476313 TGTTCAGAGCTGCCTGTGGTGGG + Intronic
986259847 5:6134649-6134671 AGGGCTGAGCTGCCAGGAGCTGG + Intergenic
986544330 5:8879478-8879500 TGTTCAGAGCTGCCTGAAGCTGG + Intergenic
986631053 5:9774798-9774820 TGTGCTGAGCTGCCTGAAGCTGG + Intergenic
986631238 5:9775893-9775915 TGAGCTGAGCTGCCTGGAGTTGG + Intergenic
986756434 5:10840494-10840516 TGTGCTGAACTGCCTGGGGCTGG - Intergenic
986946121 5:13023193-13023215 TCTGTTTTGCTGCCTGGAGTTGG - Intergenic
987458001 5:18170391-18170413 TGTGCTAAGCTTCCTGGAGCTGG - Intergenic
987616219 5:20277282-20277304 TGTGCTGAGTTGCCTTGAGTTGG - Intronic
988039735 5:25874155-25874177 TGTACTGAGATGCCTAGAGCTGG + Intergenic
988117957 5:26920617-26920639 TGCGCTGAGCTGCCTGCAGCTGG - Intronic
988931640 5:36040852-36040874 TGAGCTGCCCTGCCTGGAGTTGG - Intronic
988931745 5:36041513-36041535 TGTGCTAAGCTGCCTGGAGTTGG - Intronic
988939462 5:36128032-36128054 TGTCCTGAGCTGCCTGGAGGTGG - Intronic
988956266 5:36323627-36323649 TGTTCTGAGCCACCTGGAGCTGG + Intergenic
989215398 5:38899855-38899877 TGAGCTGTGCTGCCTGGGGTTGG + Intronic
989472144 5:41832312-41832334 TGTGCTGAACCGCCTGGAACTGG - Intronic
989489465 5:42033162-42033184 TGAGCTGTGCAGCCTGGGGTTGG + Intergenic
989657612 5:43761433-43761455 TGTGCTGAGCTGCCCTGAGCTGG + Intergenic
989690899 5:44142941-44142963 TGAGCTGTGCTGTCTGGGGTTGG + Intergenic
989771456 5:45151436-45151458 TCTGCTGATCTGACAGGAGTTGG + Intergenic
990578869 5:57149772-57149794 TGTGTTGAGCTGTCTGGATCTGG + Intergenic
990579695 5:57156154-57156176 TTTGCTGAGCTGCCTGGAGCTGG - Intergenic
990900072 5:60739945-60739967 TGTGCTGAGCTGCCTGTAGCTGG - Intergenic
990922234 5:60979944-60979966 TGTGCAGAGCTGCCTGGAGCTGG - Intronic
991209029 5:64083776-64083798 TGTGCTGAGCTGCCTGAAGCTGG + Intergenic
991237873 5:64419670-64419692 TGTTCTGAGCTGCCTGAAGCTGG - Intergenic
991395361 5:66198956-66198978 TGAGCTGCACTGCCTGGGGTTGG + Intergenic
991682010 5:69149427-69149449 TCTGCTGAGCTGCCTGGAGTTGG + Intergenic
991925205 5:71698462-71698484 AGAACTGACCTGCCTGGAGTGGG - Intergenic
992309677 5:75482661-75482683 TGCGTTGAGCTGCCTGGAGCTGG - Intronic
992531664 5:77658677-77658699 TGTTCTGAGCTGCCTGGAGCTGG + Intergenic
992562485 5:77966271-77966293 TGTTCTGAGCTGCCAGCAGCAGG - Intergenic
992653405 5:78884497-78884519 TGAGCTGGGATACCTGGAGTGGG + Intronic
993138308 5:83998187-83998209 TGAGCTGCACTGCCTGGAGTTGG - Intronic
993138409 5:83998912-83998934 TGTGCTGAGCTGCCCAGAACTGG - Intronic
993155712 5:84219134-84219156 TGCTCTGAGCTGCCTGGAGCTGG - Intronic
993257172 5:85605886-85605908 TGTGCTGAGCTGTCTGGAGCTGG - Intergenic
993287249 5:86015722-86015744 TGTGCTGAGCTTCCTGGAGTTGG + Intergenic
993932091 5:93953515-93953537 TGTGCAGAGCTGCCTGAGCTGGG + Intronic
993981205 5:94545410-94545432 TGAGCTGTGCTGCCTGGGGTTGG - Intronic
993981384 5:94546496-94546518 TGTGCTGAGCCACCTGGAGCTGG - Intronic
994217740 5:97158498-97158520 TGTGCTGAGCTGCCTGGAACTGG + Intronic
994229467 5:97297431-97297453 TGTGCTGAACTGCCTGGGGTTGG + Intergenic
994310896 5:98268731-98268753 TGTGCTGTGATGCCTGGAGTTGG - Intergenic
994739124 5:103595949-103595971 TGTGCTGTGCTGCTTTGAGAGGG + Intergenic
995265240 5:110152197-110152219 TGAGCTGTACTGCCTGGCGTGGG - Intergenic
995268533 5:110194307-110194329 TGTTCTGAGCTGCCTGAACTTGG + Intergenic
996166304 5:120228389-120228411 CCTCCTGAGCTGCCTGGAATGGG + Intergenic
996666672 5:126067347-126067369 TGTGCTGAGCTGCCTGGAACTGG - Intergenic
996906642 5:128608615-128608637 TAAGCTGTGCTGCCTGGGGTTGG + Intronic
997003163 5:129785521-129785543 TGTGCTGAGCTACCTGGATCTGG - Intergenic
997059954 5:130488851-130488873 TGTGCTGAGCTGCCTAGAGCTGG - Intergenic
997104814 5:131006330-131006352 TGTGCTAAGCTGTCTGGAGCTGG - Intergenic
997263851 5:132483636-132483658 TGAGCCCAGCTGCCTGGAGAGGG - Exonic
998041506 5:138953570-138953592 TCTGCAGAGCAGCCTGGAGATGG + Intronic
998521799 5:142807765-142807787 TGTGCTGAGCTGCGTGCTGCTGG + Intronic
998895696 5:146797625-146797647 TGTGCTTAGCTGCTGGTAGTCGG - Intronic
999070805 5:148741617-148741639 TATCCGGAGCTGACTGGAGTTGG - Intergenic
999306915 5:150525501-150525523 AGTCGTGAGCAGCCTGGAGTTGG + Intronic
999763180 5:154718536-154718558 TGTGGTGACCTCCCTGGAGTGGG - Intronic
1000399588 5:160811973-160811995 TGTTCAGAGCTGTCTGGAGCTGG - Intronic
1000517947 5:162262706-162262728 CCTGCTGAGCTACCTGGAGCTGG - Intergenic
1000539230 5:162519773-162519795 TGTACTGAGCTACCCGGAGCTGG + Intergenic
1001177772 5:169487538-169487560 TGTTCTGAGCCACCTGGAGCTGG - Intergenic
1001659953 5:173383855-173383877 TGACCAGAGCTGCCTGGATTAGG + Intergenic
1001984855 5:176065038-176065060 TGTGATGAACTGCCTTGAATGGG + Intronic
1002009937 5:176271029-176271051 TGAGTTGTGCTGCCTGAAGTTGG - Intronic
1002216790 5:177641279-177641301 TGAGTTGTGCTGCCTGAAGTTGG + Intergenic
1002232658 5:177779151-177779173 TGTGATGAACTGCCTTGAATGGG - Intronic
1002263330 5:178010653-178010675 TGTGATGAACTGCCTTGAATGGG + Intronic
1002302835 5:178267200-178267222 TGTGATGAGCTGCGGGGAGCTGG + Intronic
1002675738 5:180911036-180911058 AGTGCTGAGCCGCCAGGCGTAGG - Intronic
1002874754 6:1201298-1201320 TGTGCTGTGCTGCCTGGTGTTGG + Intergenic
1003261989 6:4525800-4525822 TGTGCTGAGCTGCCTGGAACTGG - Intergenic
1003690898 6:8352615-8352637 TGTGATGAGATGCCTGGGGAGGG - Intergenic
1003952210 6:11127001-11127023 TGTGCTGAGCTGCCTGGAGCTGG + Intronic
1003984182 6:11419182-11419204 TATGCTGTGTTGCCTGGTGTTGG - Intergenic
1005464363 6:26097667-26097689 ATTGCTGAGCTGCCTGAACTGGG + Exonic
1006386296 6:33732896-33732918 GGTGCTCAGATGCCTGGGGTAGG - Intronic
1007001711 6:38319736-38319758 TGAGCTGTGCTGCCTGGGGTTGG + Intronic
1007021926 6:38529229-38529251 TCTGCTGAGATGCCTGGAACTGG - Intronic
1007022254 6:38532484-38532506 TGAGCTGAGCAGCCTGTGGTTGG - Intronic
1007190415 6:40011810-40011832 TGAGCTGTGCTGTCTGGGGTTGG + Intergenic
1008100986 6:47391410-47391432 TATGCTATGCTGCCTGGAGTTGG + Intergenic
1008101089 6:47392133-47392155 TGAGCTGTGCTGCCTGGAACTGG + Intergenic
1008192475 6:48476266-48476288 TGTGCTGAGCTGTCTGGGGCTGG - Intergenic
1008238837 6:49084052-49084074 TGAACTGTGCTGCCTGAAGTTGG - Intergenic
1008304491 6:49885524-49885546 TGGGCTGAGCTCCCAGGAGCTGG + Intergenic
1008707471 6:54181049-54181071 TGTACTGAGCTGCCTGGAACTGG + Intronic
1008731668 6:54490886-54490908 CATGCAGAGCTGCCTGGAGCTGG + Intergenic
1008822594 6:55651530-55651552 AGAGCTGCGCTGCCTGGGGTTGG + Intergenic
1008848409 6:55995851-55995873 TGTGCTGAGCTGCCTAGAGCTGG + Intergenic
1008881847 6:56387972-56387994 GGAGCTGAACTGCCTGGAGCTGG - Intronic
1008881909 6:56388377-56388399 CATGCTGGGCTGCCTGGAATTGG - Intronic
1009039239 6:58157694-58157716 TGTGCTGAGCTGCTGGAACTGGG + Intergenic
1009215138 6:60912537-60912559 TGTGCTGAGCTGCTGGAACTGGG + Intergenic
1010174203 6:73007640-73007662 TGTGCACAGCTGCCTGCAATGGG - Intronic
1010280640 6:74018978-74019000 AGAGCTGTACTGCCTGGAGTTGG - Intergenic
1010313828 6:74421151-74421173 TGTGCTGAGCCACCTGGAACTGG - Intergenic
1010320656 6:74504954-74504976 TGAGCTATGTTGCCTGGAGTTGG - Intergenic
1010560181 6:77340052-77340074 TGTGCTGAGCTGCCTCCAACTGG + Intergenic
1010676764 6:78754318-78754340 TGTTTTGAGCTGCCTGGAACTGG - Intergenic
1010838926 6:80624039-80624061 TATGCTGAGTTGCCTGGAACTGG - Intergenic
1011018905 6:82788961-82788983 TGAGCTGTGCTGCCTGAGGTTGG - Intergenic
1011019070 6:82790035-82790057 TGTGCTGAGCTGTCTGGAGGTGG - Intergenic
1011271203 6:85581118-85581140 TGTGCTGAGCTTCCTGGAGCTGG - Intronic
1011291065 6:85778303-85778325 TCTGCTGAGCCACCTGGAGCTGG + Intergenic
1011598327 6:89037456-89037478 TGAGCTGCACTGCCTGGGGTTGG - Intergenic
1011791736 6:90906600-90906622 TGTGCTGAGCCACCTGGAATAGG + Intergenic
1012224614 6:96689433-96689455 TATGCTGAGCTGCCTGGGGCTGG - Intergenic
1012483206 6:99690485-99690507 TGTGCTAAGCTGCCTGGTGCTGG - Intergenic
1013673324 6:112429563-112429585 TGTGCTGAGCTTCCTGGAGATGG + Intergenic
1013908661 6:115247362-115247384 TGTACCGAGCTGCCTGGAGCTGG - Intergenic
1014073814 6:117214726-117214748 TGTGCTGAGCTGCCTAGAGCTGG + Intergenic
1014234749 6:118941068-118941090 TGTTCTGAGCTGCTTGGAGCTGG - Intergenic
1014542314 6:122692058-122692080 TGTGCTGAGCTGCCTGGAGCTGG + Intronic
1014692544 6:124578836-124578858 TGCGCTGAGCTGCCTGGAGCTGG - Intronic
1014840688 6:126217609-126217631 TGTGCTGAGCTGCCTGGAGCTGG + Intergenic
1014862383 6:126485294-126485316 TGTGCTGAGCTACCTGGTGCTGG - Intergenic
1015392878 6:132702570-132702592 TGAGCTGTGCTGCCTGGAGTTGG - Intronic
1015460824 6:133488527-133488549 TGTGTTGAGCTGCCTGGAGCTGG - Intronic
1015598495 6:134889562-134889584 TTTGCTGCTCTGGCTGGAGTGGG + Intergenic
1016228376 6:141771353-141771375 TATGCTGAGCTTCCTGGAGCTGG + Intergenic
1016228538 6:141772422-141772444 TGAACTGTGCTGCCTGGGGTTGG + Intergenic
1016229735 6:141788622-141788644 TGAGCTGCGCTGCCTGGGTTTGG - Intergenic
1016541547 6:145171075-145171097 TGTGCTGAGCTGCCCGGAGTTGG - Intergenic
1016605244 6:145914153-145914175 TGGGCTGAGTTGGCTGGGGTTGG + Intronic
1017194169 6:151682400-151682422 TATTCTGAGCTGCCGGGAGCTGG + Intronic
1017406926 6:154129403-154129425 GGCGCTGAGCTGCCTGTATTTGG + Intronic
1017491550 6:154950092-154950114 CGAGCTGTGCTGCCTGGGGTTGG + Intronic
1017650378 6:156576121-156576143 TGTGCTGTGCTTCCTGGGGTTGG - Intergenic
1017694776 6:157003558-157003580 TGGGCTTATCTGCCTGGAGAAGG + Intronic
1018917495 6:168145776-168145798 TGTGCTGAGGCACCTGGAGCTGG + Intergenic
1019044334 6:169131648-169131670 TGAGCTGTGCTGCCTGGGTTTGG - Intergenic
1019272839 7:160057-160079 TGTGCACACCTGCCTGGAGCCGG + Intergenic
1019709128 7:2510394-2510416 GGAGCTGAGCTTCCTGGACTTGG - Intergenic
1020077657 7:5269106-5269128 GGTGCTGAGCTGCCAGGAGATGG - Intergenic
1020577084 7:9947064-9947086 TGTGCTGAGCTGCCTAAGGCTGG - Intergenic
1020607286 7:10355704-10355726 TGTGCTGAGCTGCCTGGAACTGG + Intergenic
1021123846 7:16827033-16827055 TGTGATGAGCTACCTGGAGCTGG - Intronic
1021557820 7:21939544-21939566 TCTGCTGACCTCCCTGGAGGAGG - Intronic
1021630391 7:22639249-22639271 GGTGCTGAGCTGTAGGGAGTGGG - Intergenic
1021728244 7:23570949-23570971 AGCACTGAGCTGCCTGAAGTTGG + Intergenic
1022223476 7:28339501-28339523 TGGGCTGAGCTGCCTGGAGCTGG + Intronic
1022366852 7:29730066-29730088 TGTGCTAAGCTGCCTGGAGCTGG + Intergenic
1022533722 7:31083012-31083034 TTTCCTGAGCTCCCTGGAGGTGG + Intronic
1022542035 7:31146470-31146492 TGAGCTGTGCTGCCTGGGGTTGG + Intergenic
1022956666 7:35387060-35387082 TGTGCTCAGGTGACTGGAGGTGG - Intergenic
1023208852 7:37781781-37781803 TGTGATGAGCTGCCTGGAGTTGG + Intronic
1023208956 7:37782454-37782476 TGTGCTGTGATGCCTGGAGTTGG + Intronic
1023583269 7:41704287-41704309 GGTGCTGAGCTGCATGGGGGTGG + Intergenic
1023743566 7:43302237-43302259 TGGCCTGAGCTGCCTGGCTTGGG - Intronic
1023780182 7:43647875-43647897 TGTGCTGGGCTGGCTGGGGGTGG - Intronic
1024105243 7:46077565-46077587 TTTGCTGAGCTTTCTGGAATTGG - Intergenic
1024448871 7:49515310-49515332 TGTGCTGGGCTGTCTGCAGAGGG - Intergenic
1024704219 7:51939267-51939289 TGTGCTGTGCTGCCTTTGGTTGG + Intergenic
1025061636 7:55813516-55813538 CGGGCTGCACTGCCTGGAGTTGG - Intronic
1025115735 7:56256369-56256391 TGTGCTGAGCTGGCTGTGCTCGG - Intergenic
1025201476 7:56964578-56964600 GGTACTGAGCTGCCAGGAGACGG + Intergenic
1025670469 7:63612354-63612376 GGTACTGAGCTGCCAGGAGACGG - Intergenic
1025726149 7:64063494-64063516 CATGCTGAGCTGCCTGGAGCTGG + Intronic
1025754905 7:64329628-64329650 CATGCTGAGCTACCTGGAGCTGG + Intronic
1026148788 7:67770978-67771000 GGAGCTGAGCTGCCTGAGGTTGG + Intergenic
1027405275 7:77854315-77854337 TCTGCTGAGCTGCCTGGAGCTGG + Intronic
1027405461 7:77855422-77855444 TGAGCTGCACTCCCTGGAGTTGG + Intronic
1027524190 7:79245904-79245926 TGTGCTGGGCTGCCTGGTGCTGG - Intronic
1027604998 7:80288752-80288774 TGTGCTGGGCTGCTTGGAGCTGG - Intergenic
1027674823 7:81143963-81143985 TGTGCTGAGCAGCCTGGAACTGG - Intergenic
1027921401 7:84399905-84399927 TATGCTAAGATGCCTGGAGTTGG - Intronic
1028160865 7:87483481-87483503 TGAGCTATGCTGCCTGGGGTTGG - Intergenic
1028181597 7:87730841-87730863 TGTGCTGAGCTGCCTGGACCTGG - Intronic
1028521891 7:91741652-91741674 TGTTCTGAGCCACCTGGAGCTGG + Intronic
1028912490 7:96224253-96224275 TTTGCTGAGTTGACTAGAGTGGG - Intronic
1028950467 7:96629996-96630018 TGTTCTGAGCCACCTGGAGCTGG + Intronic
1029174644 7:98655982-98656004 TGTGCACATCAGCCTGGAGTTGG + Intergenic
1029825412 7:103187393-103187415 TGTGCTAAGCTACCTGGAGCTGG - Intergenic
1029956650 7:104647318-104647340 AGTGCAGAGCTGCCCTGAGTTGG - Intronic
1030391347 7:108931863-108931885 TGAGCCGTGCTGCCTGGGGTTGG + Intergenic
1030431492 7:109454914-109454936 TGTGATGAGCCACCTGGAGCTGG + Intergenic
1030662817 7:112239508-112239530 CATGCTGAGCTGTCTGGAATTGG - Intronic
1030907693 7:115206819-115206841 TGTCCTGAGTTGCCTAGAGCAGG + Intergenic
1031098425 7:117448554-117448576 TGAGCTGTGCGGCCTGGGGTTGG - Intergenic
1031098594 7:117449528-117449550 TGTGCTGAGCCACCTGGAACTGG - Intergenic
1031260184 7:119507888-119507910 TGTGCTGAGCTGCCTGGACCTGG - Intergenic
1031412396 7:121456199-121456221 CATGCTGAGCTTCCTGGAGTTGG + Intergenic
1031565989 7:123297231-123297253 TGTGCTGAGCTGCCTGGAGTTGG - Intergenic
1031657946 7:124380891-124380913 TGTGTTGAGCTGCCTGAAGGTGG - Intergenic
1031862402 7:126995022-126995044 TGTGCTGAACCACCTGGAGCTGG - Intronic
1031905688 7:127457836-127457858 TGAGCTGCACTGCCTGGGGTAGG - Intergenic
1031905939 7:127459354-127459376 TGTGCTGAGCTGCCTGGAACTGG - Intergenic
1031996560 7:128235789-128235811 TGTGCTGATCTGCCTGGACTTGG - Intergenic
1032785685 7:135197655-135197677 TGTGCTAAGCAGCCTGTGGTGGG - Intronic
1032939075 7:136767928-136767950 TGAGCTGCACCGCCTGGAGTCGG - Intergenic
1032942553 7:136811253-136811275 TGTGCTAAGCTGCCTGGGACTGG - Intergenic
1033542422 7:142369247-142369269 TGGGCTGTGCTGCCTGAGGTTGG + Intergenic
1033813956 7:145050556-145050578 TGTGCTGAGCTACCTGGACTTGG + Intergenic
1033877727 7:145842858-145842880 CGAGCTGTGCTGCCTGCAGTTGG + Intergenic
1034359847 7:150485250-150485272 TGTTATAAGCTGTCTGGAGTAGG + Intergenic
1034398061 7:150842439-150842461 TGTGCTGTGCTGCCTGGGGTTGG - Intronic
1034581665 7:152049494-152049516 TCTGCTGAGCTTCCTGGAGCTGG + Intronic
1034593262 7:152162658-152162680 GTTTCTGAGATGCCTGGAGTCGG + Exonic
1035139030 7:156738526-156738548 TGAGCTCTGCTGCCTGGGGTTGG - Intronic
1035513107 8:207061-207083 TGTCCTTAGCTGCCAGGAGGTGG - Intergenic
1035754128 8:2018328-2018350 TGAGCTGTGCTGCCTGGGGTAGG + Intergenic
1036393885 8:8350193-8350215 AGTGCTGGGCTGCCTGGTGCAGG + Intronic
1036446893 8:8829289-8829311 GGTGCTGAGCTGCACGGAGAAGG - Intronic
1036991271 8:13598312-13598334 TGTGCTGAGCAGCCTGGGACAGG + Intergenic
1037277212 8:17193403-17193425 TCTGCTGAGCTGCCGGGAGCTGG + Intronic
1037354028 8:17998524-17998546 TGTGTTGAAATGCCTGGAGCTGG + Intronic
1038192831 8:25339533-25339555 TGAGCTGAGCTGGGTGGAGGAGG + Intronic
1038437038 8:27543501-27543523 TGTGCTGAGCTGCATGTAACTGG - Intronic
1038456551 8:27675377-27675399 TGTGCTGAGCAGCCTGGCTGGGG + Intronic
1038513435 8:28162190-28162212 TGAGCTGAGCTGACTGGCGAAGG + Intronic
1038977876 8:32721430-32721452 AGTCCTGAGCTCCATGGAGTTGG + Intronic
1039185554 8:34911566-34911588 TGTGATGAGCTGACTGGTGAAGG + Intergenic
1039546580 8:38415060-38415082 TGTGATGAGAAGCCTGGAGCTGG - Intronic
1039656356 8:39412180-39412202 TGTAGTGGGCTGCCTGGAATTGG - Intergenic
1039886989 8:41660447-41660469 TGTACTGAGCTGCCCCGAGCTGG + Intronic
1040628083 8:49175304-49175326 TGAGCTGTGCAGCCTGGGGTTGG - Intergenic
1041141091 8:54820228-54820250 TGAGCTGTGCTGCCTGGGGCTGG + Intergenic
1041241573 8:55853286-55853308 TGTGCTGCGCTGTCTGTGGTCGG - Intergenic
1041490216 8:58425048-58425070 TGTGCTGGACTTCCTGGAGGAGG - Intronic
1041500281 8:58532863-58532885 TGTGCTGAGCTGCCTGGGTGGGG + Intergenic
1041606866 8:59792399-59792421 TGAGCTGTGCTTCCTGGAATTGG - Intergenic
1041615976 8:59907212-59907234 TGAGCTGTGTTGCCTTGAGTTGG - Intergenic
1041616152 8:59908275-59908297 TGTGGTGAGCTGCCTGGAGCTGG - Intergenic
1041793781 8:61724917-61724939 TGTGCTGATCTGACAGGAGATGG + Intergenic
1041883242 8:62778067-62778089 TATGCTGAGCTGCCTGGAGCTGG + Intronic
1041947320 8:63460504-63460526 CATGCTGTGCTGCCTGGAGTTGG + Intergenic
1042428293 8:68673910-68673932 TGTGTTGAGCTGCCTGGAGCTGG - Intronic
1042980364 8:74519449-74519471 TGTGTTGAGCTGCCTGGAGCTGG - Intergenic
1043015853 8:74940132-74940154 TGTGCTGAGCTGCCTGGATCTGG + Intergenic
1043312301 8:78876023-78876045 TGTGCTGAGCCACCCAGAGTTGG + Intergenic
1043763086 8:84094585-84094607 CAAGCTGGGCTGCCTGGAGTTGG + Intergenic
1044055600 8:87566145-87566167 TAGGCTGGGCTGCCTGTAGTGGG - Intronic
1044635376 8:94319117-94319139 TCTGCTGAGCTACCTGGAGGTGG + Intergenic
1044673684 8:94708989-94709011 TGTGCTGCTCTGGGTGGAGTGGG + Intergenic
1044878075 8:96692463-96692485 TATGCTGAGCTGCCTGGAGCTGG - Intronic
1045041187 8:98226623-98226645 TGTCCTGAATTGCCTGGAGTTGG + Intronic
1045172069 8:99682620-99682642 TGTACTGAGCTGCCTGGAGATGG + Intronic
1045172410 8:99686224-99686246 TGTACTGAGCTGCCTGGAGCTGG + Intronic
1045592379 8:103612921-103612943 TGTGCTGAGCCACCTGGAACTGG + Intronic
1045621335 8:103981210-103981232 TCTGCTGAGCTGCCTGGAACTGG - Intronic
1046114041 8:109764594-109764616 TGTGCTGAGTTACCTGGAACTGG + Intergenic
1046335545 8:112781706-112781728 TATGCTGAGCTGCCTGCAGTTGG - Intronic
1046399984 8:113692130-113692152 TGTGCTGTGCTGCCTGGGGTTGG + Intergenic
1046448508 8:114357340-114357362 TGTTCTGAGCTGCCTAAAGCTGG - Intergenic
1046463174 8:114569384-114569406 TGTGCTGAGCTGCCTGAAGCTGG + Intergenic
1046557409 8:115791373-115791395 TGTGCTGAGCTTCCTGGAGCTGG - Intronic
1047138240 8:122106420-122106442 TATGCTGAGCTGCCTGGGTCTGG + Intergenic
1047342659 8:123998425-123998447 TGTACTGAGTTGCCTGGAGCTGG + Intronic
1047352309 8:124087948-124087970 TGTGCTCAGCTTCCTGGAGCTGG + Intronic
1047901208 8:129423832-129423854 TGTGCTGAGCCATCTGGAATGGG - Intergenic
1048646609 8:136427996-136428018 TGAGCTGTGCTGCCTAGGGTTGG - Intergenic
1048646766 8:136429063-136429085 TGTGCTGAGCCACCTGGAACTGG - Intergenic
1049479980 8:142817999-142818021 TGTGCTGAGGTGCCTGGCTCTGG + Intergenic
1049675438 8:143886938-143886960 TCAGCTGAGCTGCCAGGAGCTGG - Intergenic
1049766314 8:144356879-144356901 TGTGGTGAGCTTCTTGGAGGAGG - Exonic
1050061224 9:1711788-1711810 TGAGCTGAGCTGGATGGAGATGG + Intergenic
1050145314 9:2560790-2560812 TGTGCAGAGCTGCCTGGAGCTGG - Intergenic
1050248118 9:3713356-3713378 TGAGCTGTGCTGCCTGGGGTTGG - Intergenic
1050258939 9:3820898-3820920 TGGGCAGAGCTGCCTAGAGAAGG - Intergenic
1050290457 9:4148805-4148827 ATTGCTGAGAAGCCTGGAGTGGG + Intronic
1050618500 9:7428654-7428676 TGTCCTGAGCTGCCTGGAGTTGG - Intergenic
1050618679 9:7429834-7429856 TGAGCTGTGCTGCCTGGGTTTGG + Intergenic
1050644193 9:7701881-7701903 TATGTTGAGCTGCCTGGAACTGG + Intergenic
1050807202 9:9695385-9695407 TGAGCTGGGTTGCCTGAAGTTGG + Intronic
1051039052 9:12784557-12784579 TGTGCTGAGCTTCCTAGAATTGG + Intronic
1051207522 9:14704108-14704130 TGTGCTATGCTGCTTGGAGTTGG - Intergenic
1051469609 9:17423086-17423108 CATGCTGGGTTGCCTGGAGTTGG + Intronic
1052094080 9:24363029-24363051 TTTGCTGGGCCGCCTGGAGTTGG - Intergenic
1052459347 9:28742201-28742223 CATGCTGTCCTGCCTGGAGTTGG + Intergenic
1052525202 9:29608497-29608519 AGTGCTGTGCTGGCTGCAGTGGG + Intergenic
1052531584 9:29691801-29691823 TGTGCTGTGCTGCCTGGGGTTGG - Intergenic
1052607553 9:30723757-30723779 TGTGCTGAGCTACCTGGAGCTGG - Intergenic
1052625625 9:30973288-30973310 AGAGCTGAGCTGCCAGGTGTTGG + Intergenic
1052709468 9:32035702-32035724 TTGGCTGAGCTGCCTTGAGTTGG - Intergenic
1052733008 9:32311304-32311326 TGTGCTGAGTTGCCTGTAGCTGG - Intergenic
1053153153 9:35755680-35755702 TCTGCTGATCTGCCAGGAGGAGG + Exonic
1053204589 9:36175082-36175104 TGTGTTGAGCCGCCTGGAGCTGG - Intergenic
1054982698 9:71224170-71224192 TGTGCTGAGCTGCCTGGAGCTGG - Intronic
1055283544 9:74702764-74702786 TGTGCTGCCCTGGCTGGGGTTGG - Intergenic
1055302168 9:74892815-74892837 TGTGCTGAGCTACCTGGAGCTGG - Intergenic
1055387379 9:75776585-75776607 TGTGCTGAGTCACCTGGAGCTGG - Intergenic
1055543565 9:77342158-77342180 AGAGCTGAGCTGCCAGGTGTCGG + Intronic
1055579847 9:77697584-77697606 TGTGCTGTGCTGCTTGGAGCTGG + Intergenic
1055826962 9:80338863-80338885 TGAGCTGTGCTGCCTAGTGTTGG - Intergenic
1055827123 9:80339928-80339950 TTTGCTGAGCTGCCTGGAACTGG - Intergenic
1056230460 9:84538299-84538321 TGGGCTGAGCTGCCTGGAGCTGG + Intergenic
1056516865 9:87360207-87360229 TGTGCTGAGCTCCCTGGAGCTGG - Intergenic
1057644555 9:96860400-96860422 TGTGCTAGGCTGCCTGGAGTTGG - Intronic
1058249136 9:102669338-102669360 TGCACTGTGCTGCCTGGGGTTGG + Intergenic
1059041890 9:110823398-110823420 TGTGCTGAGCTGCCTGGAGCTGG - Intergenic
1059365784 9:113785522-113785544 TGTGCCATGCAGCCTGGAGTGGG - Intergenic
1059406278 9:114099710-114099732 TGAGCTGAGCTGCTGGGGGTGGG - Intergenic
1059455151 9:114395664-114395686 TCTGCTTGGCAGCCTGGAGTTGG - Intergenic
1059839208 9:118192642-118192664 CATGCTGAGCTGCCTGGAGTTGG - Intergenic
1060296827 9:122348640-122348662 CGTGCGGAGCTGCCTGCAGGAGG - Intergenic
1060304611 9:122399177-122399199 TGTGCTGAGCTGCCTACAACTGG - Intergenic
1060675758 9:125513046-125513068 TATGGTGAGCTCCCGGGAGTGGG - Intronic
1060781678 9:126417761-126417783 TGTACTGTGATACCTGGAGTGGG + Intronic
1061210642 9:129190563-129190585 TGTGCTGAACTCCCTGGCATGGG + Intergenic
1061638398 9:131930011-131930033 TGTGCTAAGCCACCTGGAGCTGG - Intronic
1061883250 9:133578404-133578426 CGTGCTGAGCTCCCTGAAGATGG - Exonic
1062020731 9:134318230-134318252 TGTTCTGAGCTGGCTGGCGGGGG - Intronic
1062214879 9:135383856-135383878 TGTGCGGGGCTGCCTGGGGCTGG + Intergenic
1062283042 9:135760403-135760425 TGGGCTGGGGTGCCTGGAGGAGG - Intronic
1062374591 9:136256184-136256206 GGGGCTGAGCTCCCTGGAGCAGG - Intergenic
1062483678 9:136763837-136763859 TGGGCTGGGCTGCCTGGGCTGGG - Intronic
1062522193 9:136962739-136962761 TGGGTGGAGCTGCCTGGGGTTGG - Intergenic
1185734951 X:2489382-2489404 CATGCTGAGCTCCTTGGAGTCGG + Exonic
1186691899 X:11986173-11986195 TGTGCTGAGCCTCCTGGAGCTGG - Intergenic
1186911760 X:14174642-14174664 TGGGCTGTGCTGCCTCGGGTTGG + Intergenic
1187132641 X:16517525-16517547 TGAGCTGTGCTGCCTGAGGTTGG - Intergenic
1187132890 X:16519074-16519096 TTTGCTGAGCTGCCTGGAGCTGG - Intergenic
1187314940 X:18184139-18184161 TATGGTGAGCTGCATGGAGCTGG - Intronic
1187588376 X:20689427-20689449 TGTGCTGAGCTACCTTGAACTGG + Intergenic
1187612986 X:20962034-20962056 TGTGCTAAGCTGCCTGGAGCTGG - Intergenic
1187618043 X:21020071-21020093 TGAGCTGTGCTGCCTGAGGTTGG - Intergenic
1187836321 X:23435644-23435666 TGTGCTGAGCTGCCTGGAGTTGG - Intergenic
1187889379 X:23920023-23920045 TGTACTGAGCAGCCTGGAGCTGG + Intronic
1188078395 X:25807134-25807156 TGTTCTGAGCTGCCAGGAGCTGG + Intergenic
1188131106 X:26433830-26433852 TTTGCTGAGCTGCAGGCAGTAGG - Intergenic
1188425057 X:30036811-30036833 TGAGCTGCGCTGCCTGGGGTTGG + Intergenic
1188651370 X:32634786-32634808 TGAGCTGTGCTGCCTGGGGTTGG + Intronic
1188917931 X:35935008-35935030 TGAGCTATGCAGCCTGGAGTTGG + Intronic
1188972202 X:36632173-36632195 TGTGCTGAGCTACCTAGTGCTGG + Intergenic
1188973207 X:36642191-36642213 TGAGCTGTGCTGTCTGGAGCTGG + Intergenic
1188998982 X:36922874-36922896 TGTGCTGAGCTGCTTGGAGCTGG + Intergenic
1189330975 X:40145119-40145141 TGCACGGAGCTGCCAGGAGTCGG + Intronic
1189405853 X:40721781-40721803 TGTGCTGAGCCACCTGGAACTGG - Intronic
1189411766 X:40779179-40779201 TGTGCTGAGCTGCCTGGAACTGG + Intergenic
1189769951 X:44416059-44416081 TGTTCTGAGCCACCTGGAGCTGG + Intergenic
1189875568 X:45433127-45433149 TGTACTGAGCTGCCTGGAGCTGG + Intergenic
1189884987 X:45533301-45533323 TGTGCTGAGCCACCTAGAATTGG - Intergenic
1190015043 X:46819560-46819582 TGAGCTGTGCAGCCTGGGGTAGG - Intergenic
1190015249 X:46820648-46820670 TGTTCTGAGCTGCTTGGAGCTGG - Intergenic
1190037930 X:47042981-47043003 TGTGCTGAGTTGCCTGGAGATGG - Intronic
1190122219 X:47671815-47671837 TGTGCTGAGCTGCCTGTAGCTGG + Intergenic
1190368051 X:49716248-49716270 TGTGCTGAGCTGTCTGGAGCTGG + Intergenic
1190374222 X:49773996-49774018 TGTGCTGAGCCGCCTGGTACTGG + Intergenic
1190507817 X:51145158-51145180 CATGCTGGGCTCCCTGGAGTAGG + Intergenic
1190602592 X:52108044-52108066 TGTGCTGAGCTGCCTGGAGCTGG + Intergenic
1190808219 X:53860234-53860256 CGTGCTGAGCTGCCTGAAGCTGG + Intergenic
1191080001 X:56499675-56499697 CACGCTGAGCTGCCTGGAGTTGG - Intergenic
1191116648 X:56859913-56859935 TGTGCTTAGCTGCCTGGAGCTGG + Intergenic
1191145033 X:57156757-57156779 TGTGCTGGGCTGCCTGGAGTTGG + Intergenic
1191179256 X:57541496-57541518 TCTACTGAGCTGCCTGAAGGTGG - Intergenic
1191770724 X:64755642-64755664 TGTGCTGAGACACCTGAAGTTGG + Intergenic
1191813471 X:65217078-65217100 AGTGCTGAGCTGCCTGGAGTTGG - Intergenic
1191991123 X:67038343-67038365 TGTGCTGAGGTGCCTGGAGCTGG + Intergenic
1192374992 X:70550031-70550053 TATGTTGAGCTGCCTGGGGCTGG - Intronic
1192836241 X:74802338-74802360 TGTTCTGAGCCACCTGGAGCTGG - Intronic
1192839068 X:74835631-74835653 TGAGCTGAGCTGTCTGGAGGTGG + Intronic
1192858390 X:75039272-75039294 CGTGCTGAACTGCCTGGAGCTGG + Intergenic
1192941140 X:75912799-75912821 TGAGCTGTGCTGCCTGGGGTTGG + Intergenic
1192958679 X:76103540-76103562 TATGTTGAGCTGCCTGGAGCTGG + Intergenic
1192959392 X:76111043-76111065 TCTGCTGAGCTATTTGGAGTTGG - Intergenic
1193052299 X:77114662-77114684 TGTGCTGAGCTTCCTGGAGCTGG + Intergenic
1193098446 X:77579427-77579449 TGTGCTGAGTTGCCTGGAGCTGG - Intronic
1193191032 X:78571898-78571920 TTTGCTGAGCTGCCTGGAGCTGG + Intergenic
1193214013 X:78840764-78840786 TGTGCTGAGCTGCCTGGAGCTGG - Intergenic
1193247333 X:79244349-79244371 GGAGCTGTGCTACCTGGAGTTGG - Intergenic
1193252514 X:79308741-79308763 TGAGCTGTGCAGCCTGGAGTTGG - Intergenic
1193280246 X:79640796-79640818 TTTGCTGAGCTGCCTGGAGCTGG + Intergenic
1193280400 X:79641865-79641887 TGAGCTGCACTGCCTGGGGTTGG + Intergenic
1193283585 X:79685628-79685650 TGCGCTGAGCCGCCTGGAAGTGG + Intergenic
1193293852 X:79810072-79810094 TGAGCTGTTCTGCCTGGGGTTGG + Intergenic
1193329845 X:80223677-80223699 TATGCTGGGCTGTCTGGAGTTGG + Intergenic
1193329962 X:80224507-80224529 TGTGCTGTGCTACCTTGGGTTGG + Intergenic
1193344279 X:80387609-80387631 TGTGCTGAGCTGTCTGCAGCTGG + Intronic
1193366152 X:80636792-80636814 TGTGCTACGCTGTCTGGAGCTGG + Intergenic
1193580587 X:83258774-83258796 TGTGCTGAGCCACCTGGAACTGG - Intergenic
1193650420 X:84123967-84123989 TGTGCTGAGCCACCTGGAATGGG - Intronic
1193658288 X:84224899-84224921 TGAGCTAGGCTGCCTGGGGTGGG + Intergenic
1193676181 X:84454848-84454870 TGTGCTGAGCCGCCTGGAACTGG - Intronic
1193738300 X:85186288-85186310 TGCACTGAGCTGCCTGGTGTTGG + Intergenic
1193846698 X:86480338-86480360 TGTTCTGAGCTTACTGGAGGTGG + Intronic
1193876226 X:86865785-86865807 TGTGCCAATCTGCCTGGATTGGG - Intergenic
1193905769 X:87242842-87242864 TTTTCTGAGCTGCCTTGAGCTGG + Intergenic
1193989344 X:88286134-88286156 TGTGCTGAGCTGCCTGGAGTTGG - Intergenic
1194016355 X:88625765-88625787 TGTTCTTAGCTGCCTGGAGTTGG - Intergenic
1194257401 X:91652049-91652071 TGTGCTACGCTGCTTGGAGCTGG + Intergenic
1194257573 X:91653138-91653160 TAAGCTGTGCTGCCTGGGGTTGG + Intergenic
1194366423 X:93019331-93019353 TGTGATGATCAGCCAGGAGTGGG - Intergenic
1194387891 X:93278950-93278972 TGTGCTGAGCTTCCTGGAGATGG - Intergenic
1194492332 X:94567686-94567708 TGTGCTGGGCTGACTGAAATTGG + Intergenic
1194492396 X:94568117-94568139 TGAGTTGTGCTTCCTGGAGTTGG + Intergenic
1194507574 X:94751896-94751918 TGTATTGGGCTGCCTGGAGTTGG + Intergenic
1194526603 X:94984316-94984338 TGTGCTGAGTCACCTGGAATTGG - Intergenic
1194626265 X:96229872-96229894 TGAGCTGTGCAGCCTGGGGTTGG - Intergenic
1194692802 X:97008791-97008813 TGTGCTGAGCTACCTGGAGCTGG + Intronic
1194787514 X:98105673-98105695 TGATCTGAGCTACCTGGAGCTGG + Intergenic
1194795999 X:98211355-98211377 TGTGCTGAGCCACCTGGAACTGG - Intergenic
1194877440 X:99207604-99207626 AGTGCTGAGCTTCCTGGAGTTGG + Intergenic
1194892599 X:99398588-99398610 TGAGCTGTGCTGTCTGGGGTTGG + Intergenic
1195037017 X:100979964-100979986 TGTGCTGAGCTGCCTGGAGTTGG + Intronic
1195090029 X:101450087-101450109 TGTGCTGAGCCTCCTGGAGCTGG + Intronic
1195115881 X:101697137-101697159 TATTCTGAGCTGCCTGGAGCTGG - Intergenic
1195199464 X:102533476-102533498 TGTGCTGAGCTACCTAGACCTGG - Intergenic
1195455404 X:105063911-105063933 TGTGCTGAGCCACCTGGAGGTGG + Intronic
1195601278 X:106751597-106751619 TGAGCTGTACTGCCTGGAGTTGG - Intronic
1195601396 X:106752322-106752344 CATGCTGTGCTGCCTGGAGTTGG - Intronic
1196096625 X:111807995-111808017 CGCGCTGAGCTGCATGGAGTTGG + Intronic
1196154139 X:112407782-112407804 CGTTCTGAGCTTCCTGGAGCTGG - Intergenic
1196182018 X:112703228-112703250 TGTGCTGAGCTACCTGGAACTGG + Intergenic
1196217482 X:113071231-113071253 TGTGCTGGGCTGCCTGGAACTGG + Intergenic
1196234546 X:113262966-113262988 TGAGCTGGGCTGCCTGGGTTTGG + Intergenic
1196248539 X:113429397-113429419 TGTGCTGAGCTGCCTGGAGGTGG - Intergenic
1196264462 X:113626123-113626145 AGAGCTGTACTGCCTGGAGTTGG + Intergenic
1196368849 X:114952733-114952755 TGTGTTGGGCTGCCTGGAATTGG - Intergenic
1196552462 X:117045382-117045404 TGAGCTGTGCTGCCCGCAGTTGG - Intergenic
1196564593 X:117189774-117189796 TGTTCTGAGCTACCTGAAGCTGG - Intergenic
1196576544 X:117325391-117325413 TCTGCTGAGCTGCCTGTATTAGG + Intergenic
1197054015 X:122094904-122094926 TGTGCTTAGCTAACTGTAGTTGG - Intergenic
1197099458 X:122635979-122636001 TGTGCTGAGCTGCCTGGATCTGG + Intergenic
1197105089 X:122703809-122703831 CCTGCTGGGCTGCTTGGAGTCGG - Intergenic
1197361189 X:125505231-125505253 TTAGCTGCACTGCCTGGAGTTGG + Intergenic
1197400006 X:125978484-125978506 CATGCTGAGCTGCCTGGAGTTGG - Intergenic
1197439270 X:126470629-126470651 TGAGCTGTGCTGCCTGGGTTTGG - Intergenic
1197439435 X:126471666-126471688 TCTGCTGAGCTTCCTGGAGCTGG - Intergenic
1197458082 X:126702301-126702323 TGTGCTGAGCTACCTGGAACTGG - Intergenic
1197487592 X:127073718-127073740 TGTGCTGAGCTGCCTGAATTTGG + Intergenic
1197514560 X:127410435-127410457 TGTACTGAGCTGCCTGGAGCTGG + Intergenic
1197537612 X:127709095-127709117 CTTGCTGAGCTGCCTGGAGCTGG - Intergenic
1197623436 X:128778410-128778432 TGTGCTGAGTTGCCTGGAACTGG + Intergenic
1197670524 X:129272698-129272720 CATGCTGAGCTGCCTGTAGCTGG + Intergenic
1198515093 X:137399605-137399627 TGTTCTGAGCCACCTGGAGCTGG + Intergenic
1198697114 X:139354311-139354333 TCTGCTGAGATGCCTGGAGCTGG + Intergenic
1198702451 X:139413135-139413157 TGTTCTGAGCTACCTGGAGCTGG + Intergenic
1198770461 X:140125466-140125488 TGTGCTGAGCCTCCTGGAGCTGG + Intergenic
1198841130 X:140859191-140859213 TGTGCTGAGCCACCTTGAGCTGG - Intergenic
1198964524 X:142214049-142214071 TGTGTGGAGCTGCCTGGAGCTGG + Intergenic
1199223099 X:145340064-145340086 TGAGCTGTGCTTCCTGGGGTTGG - Intergenic
1199223251 X:145341115-145341137 TCTGATGAGCTTCCTGGAGCTGG - Intergenic
1199325145 X:146490298-146490320 TGAGCTGCACTGCCTGGGGTTGG - Intergenic
1199334225 X:146599952-146599974 TGTTCTGAGCCACCTGGAGCTGG + Intergenic
1199393769 X:147310247-147310269 TGTGCTGAGCCACCTGGAGTTGG - Intergenic
1199457287 X:148043601-148043623 TGTGATGAGCTGCCAGGAGCTGG + Intergenic
1199645869 X:149909990-149910012 TCTGCTGAGCTGCCTAGGGCTGG - Intergenic
1199845385 X:151688992-151689014 TGTGCTGAGCTGCCTGGAACTGG - Intergenic
1199921182 X:152405529-152405551 TGAGATGCACTGCCTGGAGTTGG - Intronic
1199983379 X:152933427-152933449 AGAGCAGAGCTGCCTGGGGTAGG - Intronic
1200379474 X:155819762-155819784 TGAGTTGCACTGCCTGGAGTTGG - Intergenic
1200576058 Y:4890995-4891017 TGTGCTATGCTGCTTGGAGCTGG + Intergenic
1200576230 Y:4892084-4892106 TAAGCTGTGCTGCCTGGGGTTGG + Intergenic
1200608484 Y:5296365-5296387 TGTGCTGAGCTGTCTGCAACTGG + Intronic
1200674650 Y:6135593-6135615 TGTGATGATCAGCCAGGAGTGGG - Intergenic
1201532276 Y:15005073-15005095 TTTGGTCAGCTGACTGGAGTGGG + Intergenic