ID: 1187836322

View in Genome Browser
Species Human (GRCh38)
Location X:23435650-23435672
Sequence TTTCTCTGTGCTGAGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1281
Summary {0: 7, 1: 71, 2: 190, 3: 340, 4: 673}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187836322_1187836323 -10 Left 1187836322 X:23435650-23435672 CCAGGCAGCTCAGCACAGAGAAA 0: 7
1: 71
2: 190
3: 340
4: 673
Right 1187836323 X:23435663-23435685 CACAGAGAAAGAGACTGTTTAGG No data
1187836322_1187836324 5 Left 1187836322 X:23435650-23435672 CCAGGCAGCTCAGCACAGAGAAA 0: 7
1: 71
2: 190
3: 340
4: 673
Right 1187836324 X:23435678-23435700 TGTTTAGGAATAACTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187836322 Original CRISPR TTTCTCTGTGCTGAGCTGCC TGG (reversed) Intergenic
900015287 1:144690-144712 TTTCTCTGTGCTGGTCAGGCTGG - Intergenic
900045554 1:503283-503305 TTTCTCTGTGCTGGTCAGGCTGG - Intergenic
900067754 1:744997-745019 TTTCTCTGTGCTGGTCAGGCTGG - Intergenic
901040862 1:6362499-6362521 TTTCTATATGCTTGGCTGCCTGG - Intronic
901958819 1:12808508-12808530 TTCCTCTGTGCTGTGCTGTGGGG + Intergenic
902120221 1:14158966-14158988 TTTCTCTATTCTGAGCCACCGGG + Intergenic
902143883 1:14380009-14380031 TCTCTCTGTTCTGAGCTGTCTGG - Intergenic
902278021 1:15353382-15353404 TTTGTGTGGGCTCAGCTGCCTGG + Intronic
902393634 1:16120334-16120356 TTTCTGGGTTCTGAGCTGCAGGG - Intergenic
903072435 1:20732934-20732956 TTTCTCTGTGGTGTGGTGCATGG - Intergenic
903091563 1:20923686-20923708 TTTCTCTGTGCTTTGCAGTCTGG - Intronic
903500640 1:23798499-23798521 TTTCACTGTGTTGAGCAGGCTGG + Intronic
904408876 1:30312845-30312867 TTTCTCTCTCCTGACCTGCTCGG + Intergenic
904425237 1:30418632-30418654 TTTCTCTGTTCTCAGCCTCCAGG - Intergenic
905213895 1:36393319-36393341 CTTCTGTGTGCTGCGCTCCCAGG - Intronic
906352785 1:45078534-45078556 TTTCTCTGTTCTGAGCTACCTGG + Intronic
906553684 1:46689449-46689471 TTCCTCTCTGCTCAGCTCCCAGG + Intronic
906826940 1:48992358-48992380 TCTCTCTGTGCAGAGCTCCCTGG + Intronic
907004138 1:50893551-50893573 TCTCTCTGTACTGAGTTGCTTGG + Intronic
907261712 1:53223036-53223058 TCTCTCCATGCTGAGCTGCCTGG - Intergenic
907768817 1:57439233-57439255 TTTCTCTGTGTTGATCTCCTTGG - Intronic
908175458 1:61551726-61551748 TTTCTCTGTGCTGAGCTGTCTGG + Intergenic
908302189 1:62773411-62773433 TCTCTTTGTGCTGAGATGCCTGG + Intergenic
908598880 1:65718162-65718184 TTTCTCTGTTCTGAGCCACTTGG + Intergenic
908958801 1:69670398-69670420 TTTCTCTTTTCTGAGCTACTTGG + Intronic
909209601 1:72807330-72807352 TCGCTCTATGTTGAGCTGCCTGG + Intergenic
909231183 1:73092910-73092932 TCTGTCCATGCTGAGCTGCCTGG + Intergenic
909271420 1:73627775-73627797 TCTCTCTGTGCTGAGCTGCCTGG - Intergenic
909438743 1:75673702-75673724 TCTCTCTGTTCTGAGCTCCTAGG - Intergenic
909615817 1:77606620-77606642 TTTCTCTGTGCTGAGCTGCTTGG - Intronic
909848713 1:80433528-80433550 TCTCTCTGTGCTGAGCCACCTGG + Intergenic
909870437 1:80731735-80731757 TGTCTCTGTGCTGAGCTGCCTGG - Intergenic
910102425 1:83593410-83593432 TCTCTCTGTGCTGAGCTGCCTGG + Intergenic
910313753 1:85858495-85858517 TTTCTCTATGCTTAGGTGCCTGG + Intronic
910349178 1:86276889-86276911 TCTCTCTGTTCTGAGCCACCTGG + Intergenic
910470305 1:87546319-87546341 TCTCTCTGTGCTGAGCTTCCTGG + Intergenic
910515265 1:88053786-88053808 TTTCTCTCCGCTGAGCTGTCTGG + Intergenic
910560333 1:88582793-88582815 TCTCTCTGTGCTGAGTCACCTGG - Intergenic
910639651 1:89446208-89446230 TTTCTCTGTGCTGAGCCACCTGG + Intergenic
910639821 1:89447283-89447305 TTGCTGTGAGCTGAGCTTCCTGG + Intergenic
910725034 1:90328871-90328893 TCTCTCTGTGCTGAGCTGCCTGG - Intergenic
910818998 1:91325438-91325460 TCTCTCTGTGCTGAGCCACTTGG - Intronic
911019982 1:93376089-93376111 TCTCTTTATGCTGAGCTGCGTGG - Intergenic
911981243 1:104569182-104569204 TCTCTCTGTGCTGAACTACCCGG - Intergenic
912026042 1:105174356-105174378 TTTCTCTTTTCTGTGCTACCAGG - Intergenic
912041766 1:105398996-105399018 TCTCTCTGTGCTGAGACACCTGG + Intergenic
912152872 1:106880864-106880886 TTTCTCTGTGCTGAGCCACCTGG - Intergenic
912374846 1:109201669-109201691 TTCCTTTGTGCTGACCTGCTAGG + Intronic
912477264 1:109947029-109947051 ATTCTCTGAGCTGTGCTCCCAGG + Intergenic
912633146 1:111266889-111266911 TCTCTCTGTGCTGAGCTGCCTGG + Intergenic
912873002 1:113327431-113327453 TCTCTGTGTGTTGAGCTGCCTGG + Intergenic
912899156 1:113629809-113629831 TCTCTCTGTGCTGAGCCTCTTGG + Intronic
912906690 1:113714908-113714930 TCTCTCTGTGCTGAGCTGCTTGG - Intronic
913042476 1:115040884-115040906 TCTCTCTGTGCTGCACTGCCTGG - Intergenic
913146963 1:116002203-116002225 TCTCTCCATGCTGAGCTCCCTGG + Intronic
913221777 1:116666293-116666315 TTTCCCGGTGCTGAGCTGTCTGG - Exonic
913988055 1:143583858-143583880 TTTCTGTGTGCTGAGCAGCAGGG + Intergenic
914197733 1:145458242-145458264 TTTCTGTGAGCTGAGCAGCAGGG + Intergenic
914476837 1:148031353-148031375 TTTCTGTGAGCTGAGCAGCAGGG + Intergenic
914503381 1:148266490-148266512 TTTCTGTGAGCTGAGCAGCAGGG - Intergenic
915005479 1:152630920-152630942 TCTCTCTGTGCTGAGATGCCTGG - Intergenic
915481242 1:156187366-156187388 TTTCTCTGTCCTGTTCTGCAAGG + Intergenic
915693518 1:157715719-157715741 TCTCTTTGTGCTGTGCCGCCTGG + Intergenic
916321932 1:163513623-163513645 TCTCTCTCTTCTGAGCTGCTTGG - Intergenic
916518788 1:165544656-165544678 TTTCTCGGTGCTCAGCAACCTGG + Exonic
916769031 1:167890418-167890440 TTTCTCTGTGCTGAGCTGCTTGG + Intronic
917188304 1:172387111-172387133 TTTCTCTGTGGTGATCTGACAGG + Exonic
917226301 1:172787839-172787861 TCTCTCTGTTCTGAGCCACCTGG + Intergenic
917246228 1:173004395-173004417 TCTCTCTGTGCTGAACCACCTGG + Intergenic
917376436 1:174352939-174352961 TCTCTGTGTGCTGAGCTACCTGG + Intronic
917387161 1:174490439-174490461 TCTCTCTATGTTGAGCTGCCTGG + Intronic
917493407 1:175517877-175517899 TGTTTCCGTGCTGAGCAGCCTGG - Intronic
918018628 1:180663502-180663524 TCTTTCTGTGCTGAGGTGCCTGG + Intronic
918476127 1:184927513-184927535 TTTCTCTGTGTTGAGCTGCCTGG + Intronic
918540746 1:185629751-185629773 TTTCTATGTTCTGACCTGCTAGG - Intergenic
918986183 1:191630084-191630106 TCTCTCTGTCCTGAGCCACCTGG - Intergenic
918989827 1:191684523-191684545 TTTCTCTGTGCTGAGCAACCTGG + Intergenic
919169904 1:193939958-193939980 TGTGTGTGTACTGAGCTGCCTGG - Intergenic
919286892 1:195574775-195574797 TCTCACTTTGCTGAGCTGTCTGG - Intergenic
919336746 1:196244985-196245007 TCTCTCTGTGCTGACCTGCCTGG - Intronic
919456012 1:197819698-197819720 TCTCTCTGGGCTGAGCTTCCTGG - Intergenic
919478142 1:198054431-198054453 TTGCTCTGAGCTGCGCTGCCTGG + Intergenic
919511624 1:198472417-198472439 CCTCTGTGTGCTGAGCTGCCTGG - Intergenic
919514797 1:198510266-198510288 TCTCTCTCTGCTGAGCTGCCTGG + Intergenic
920209975 1:204320924-204320946 TTTCCAGGTGCTGGGCTGCCTGG - Intronic
920596660 1:207279102-207279124 TCTCTTTGTGCTGAGCTGCCTGG + Intergenic
920845492 1:209589947-209589969 TCTTGCTGTGCTGAGGTGCCAGG + Intronic
921147078 1:212368013-212368035 TCTCTCTGCTCTGAGTTGCCTGG - Intronic
921373237 1:214447221-214447243 TTCCCCTTGGCTGAGCTGCCTGG + Intronic
921769861 1:219022916-219022938 TCTCTTTGTGATGAGCTGCCTGG - Intergenic
921929242 1:220741878-220741900 TCTCTCTGTGCTGAGCTGCTTGG + Intergenic
922320371 1:224481612-224481634 TCTCTCTGTGCTGAGATACCTGG + Intronic
922357989 1:224795038-224795060 TCTTTCTATGCTGAGCTGCCTGG + Intergenic
922388436 1:225113342-225113364 TCTCTGTGTGCTGAGCTGCCTGG + Intronic
922685424 1:227635003-227635025 TGCCTCTGGGCTGAGCTGCCTGG - Intronic
923960177 1:239072220-239072242 TCTCTCTGTGCTGGGCCACCTGG - Intergenic
924490694 1:244535124-244535146 TCTCTCAGTGCTGAGCTGCCTGG + Intronic
924516066 1:244767580-244767602 TCTCTCTGTGCTGAGCTGCCTGG + Intergenic
924629321 1:245721936-245721958 TCTCTCTGTGCTGAGCTACCTGG - Intergenic
1063594223 10:7418938-7418960 TTTCTCTGTTCTGTGGTGCTTGG + Intergenic
1063968241 10:11363321-11363343 TTCCTCTATGCAGAGCTCCCTGG - Intergenic
1064521609 10:16209089-16209111 TTTCTTTGTGCTGGGCCTCCTGG + Intergenic
1064768621 10:18700505-18700527 TTTCTTTGTGCTCAGCTACATGG + Intergenic
1064987392 10:21225245-21225267 TCTCTCTGTGCTTAGCTCCATGG + Intergenic
1065381406 10:25095377-25095399 TTTCTCTGTTCTGAGCCTCCTGG + Intergenic
1065748309 10:28862091-28862113 TTTCTCTGTGTTGAGTAGGCTGG + Intronic
1065921958 10:30400427-30400449 TCTCTCTGTGCTGAGCCACTTGG - Intergenic
1066272354 10:33836309-33836331 TGTCTCTGTGCTGAGGCTCCTGG - Intergenic
1066525988 10:36280430-36280452 TTTTTCTCTGCTGTGCTCCCTGG + Intergenic
1066663206 10:37756501-37756523 TTTCTCTGTGTTGGTCAGCCTGG - Intergenic
1066708355 10:38204624-38204646 TCTCTCTGTTCTAGGCTGCCTGG - Intergenic
1066981152 10:42417958-42417980 TCTCTCTGTGCTAGGCTGCCTGG + Intergenic
1067581742 10:47450704-47450726 GTGCCCTGTGCTGAGCTCCCAGG - Intergenic
1067669203 10:48304403-48304425 TGAGTCTGTGATGAGCTGCCAGG - Intergenic
1068287720 10:54961890-54961912 TTTCACTGGGATGACCTGCCTGG + Intronic
1068392282 10:56414025-56414047 TCTCTCTGTGCTGAGCTGCCTGG + Intergenic
1068411276 10:56659583-56659605 TCTCTCTGTTCTGAGCCACCTGG + Intergenic
1068476319 10:57531193-57531215 TTTCTCTATTCTGATATGCCTGG + Intergenic
1068713025 10:60155225-60155247 TTTCTCTATGCTGTGCTGCCTGG - Intronic
1070059262 10:72966935-72966957 TTTCACTGTGCTGGGCTGCCTGG + Intergenic
1070181804 10:74021176-74021198 CTTCCCTTTGCTGAGCAGCCTGG - Intronic
1070895518 10:79980602-79980624 TCTCTCCATGCTGAGGTGCCTGG - Intronic
1071237331 10:83664303-83664325 TGCCTCAGTGCTGAGCTGCAAGG - Intergenic
1071483007 10:86079012-86079034 TTTCTGAGTGCTGTGCTGACGGG - Intronic
1071799312 10:89041937-89041959 TCTCTCTGTGCTGAGCTGCCTGG + Intergenic
1071899342 10:90101994-90102016 TCTCTCTGTTCTGAGCTGCCTGG - Intergenic
1071935410 10:90525636-90525658 TCTCTCTGTGCTGAGCTGTCTGG + Intergenic
1071963112 10:90825104-90825126 TCTCTCTGTGTTGAGTTGCCTGG - Intronic
1072058907 10:91788811-91788833 TGTATCTGTGCTGAGCTGCCTGG - Intergenic
1072236884 10:93461228-93461250 TTTCTGTGGGCTGAGCTGTGAGG - Intronic
1072280984 10:93865280-93865302 TTCCTCTGTGTTGAGCTGCAAGG + Intergenic
1072492204 10:95919501-95919523 TCTCTCCATGCTGAGCTGCCTGG + Intronic
1073826994 10:107336062-107336084 TCTCTCTGTGCTAAGCCACCTGG + Intergenic
1073872532 10:107881091-107881113 CTTTTCTGTGCTGAGTTGCCTGG - Intergenic
1074302038 10:112241831-112241853 TCACTCTGTGCTGAGCTGCCTGG + Intergenic
1074502687 10:114041405-114041427 GTTCTGAGTGCTGAGCTGCAGGG - Intergenic
1074803676 10:117027016-117027038 TCTCTCTGTTCTGAGCCACCTGG - Intronic
1075062197 10:119264990-119265012 TTACTCCGTGCTGAGCTGGTTGG + Intronic
1075195052 10:120348928-120348950 TCTCTCTGTTCTCAGCTGCCTGG - Intergenic
1075225441 10:120624788-120624810 TGTCTGTGTGCTGAGGTGCCAGG + Intergenic
1075340397 10:121643217-121643239 TTTCTCTGTGTTGACCAGGCTGG + Intergenic
1075496490 10:122923571-122923593 TCTCTCTCTGCTGAGCTGTCTGG - Intergenic
1075558095 10:123447761-123447783 TCTCTCTCTGCAGAGCTGGCAGG - Intergenic
1075830472 10:125406934-125406956 TCTCTCTGTGCTGAGCTTCCTGG + Intergenic
1075859154 10:125659912-125659934 TTTCCCTGTGCTGTGCAGTCTGG + Intronic
1076369669 10:129943820-129943842 TTTTTCTGTGCTGAGCTCTCTGG + Intronic
1076535414 10:131173931-131173953 CTTCCCAGTCCTGAGCTGCCAGG - Intronic
1076971880 11:139756-139778 TTTCTCTGTGCTGGTCAGGCTGG - Intergenic
1077427386 11:2489581-2489603 TTTCTGTGAGCTGTGCTGCCTGG - Intronic
1077835589 11:5924056-5924078 TGTCTCTGTGCTGAGCCATCTGG - Intronic
1077858812 11:6157172-6157194 TTTGTGTGAGCTGTGCTGCCTGG - Intergenic
1077912122 11:6581031-6581053 TCTGTCTGTGCTGAGCTGCTTGG - Intronic
1078244590 11:9562826-9562848 TCTCTCTGTGCTGAGCTGCCTGG + Intergenic
1078842964 11:15096283-15096305 TTTCTCTGAACTGAGCTGCCTGG + Intergenic
1078992762 11:16665825-16665847 TCTCTCTGTGATGAGCTGCTTGG - Intronic
1079069139 11:17328251-17328273 TCTCTCTGTGCTGAGCCACCTGG + Intronic
1079308584 11:19345429-19345451 ATGCTCTGTGCTGAGCTCCGGGG + Intergenic
1079532967 11:21477318-21477340 TCTCTCTGTGCTAAGCTCCCAGG - Intronic
1079571982 11:21953809-21953831 TCTCTCTGTTCTGAGCCACCTGG - Intergenic
1079686976 11:23371101-23371123 TATCTCTGTGCTGAGTCACCTGG - Intergenic
1079961307 11:26927667-26927689 TCTCTCTGTTCTGAGCCACCTGG + Intergenic
1080084105 11:28258239-28258261 TCTCTCTGTTCTGAGCTACCTGG + Intronic
1080096951 11:28419278-28419300 CCTCTCTATGCTGAGCTGCCTGG - Intergenic
1080351242 11:31387385-31387407 TCTCTCTGTGCTAAGCTGCCTGG - Intronic
1080489714 11:32750203-32750225 TCTCTCTGTGCTGAGCTTCCTGG + Intronic
1080796511 11:35568377-35568399 TCTCTCTATGCTGAGCTGCCTGG - Intergenic
1080834291 11:35926201-35926223 TTCCTCTGTGCCCTGCTGCCTGG + Intergenic
1081049276 11:38316651-38316673 TCTCTCTGTGCTGAATTGCTTGG - Intergenic
1081073605 11:38641717-38641739 TCTCTCTGTTCCAAGCTGCCTGG + Intergenic
1081212484 11:40354223-40354245 TCTCTCCATGCTGAGCTGCCTGG + Intronic
1082823756 11:57562612-57562634 ACTCTCCGTGCTGAGCTCCCTGG - Intronic
1082962878 11:58935382-58935404 TCTCTCTGTGCCCTGCTGCCTGG + Intronic
1083174321 11:60939678-60939700 CTTCTGTGGGCTAAGCTGCCTGG - Intronic
1083769991 11:64861506-64861528 TTTTTCAGTGCTGATGTGCCAGG + Intronic
1084596551 11:70120162-70120184 TTTTCCTGTGCTGAGCTGGAGGG + Intronic
1084654681 11:70508246-70508268 GTTCTCTGTGCTCAGCTGAGGGG - Intronic
1084763728 11:71294024-71294046 TCTCTCTGTGCTGAACTGCCTGG + Intergenic
1085147444 11:74213616-74213638 TCTCTCTGTGCTGAGCTTCCTGG - Intronic
1085178570 11:74511906-74511928 CCTCCCTGTGCTGAGCTGCCTGG - Intronic
1085194612 11:74661549-74661571 ACTCTCTGTGCTGAGCCGCCTGG + Intronic
1085572003 11:77568168-77568190 TCTCTCTGTACTGAACTTCCTGG + Intronic
1085980627 11:81719316-81719338 TTTCTCTGTGCTCAGGTTCCTGG - Intergenic
1086028689 11:82326816-82326838 TTTCTCCATGCTGGGCTGCCTGG - Intergenic
1086261378 11:84945422-84945444 TCTCTCTGTGCTGAGCTGCCTGG + Intronic
1086277247 11:85146255-85146277 TCTCTCTCTCCTGAGCTTCCTGG + Intronic
1086468073 11:87075901-87075923 TCTCTGTGTGCTGAACTGCTTGG + Intronic
1086569719 11:88267456-88267478 AGTCTCTGTACTGAGCTACCTGG - Intergenic
1086847758 11:91773432-91773454 TCTTTCTGTGCTGAGCTCCCTGG + Intergenic
1087031898 11:93714856-93714878 TCTCTCTGTGCTGAGCTGCCTGG + Intronic
1087313260 11:96576506-96576528 TCTCTATGTGCTGAGCTACCTGG + Intergenic
1087345431 11:96965294-96965316 TCTGTCTGTGCTTAGCTGCCTGG - Intergenic
1087350197 11:97020984-97021006 TCTCTCTGTGCTGTGCTACCTGG - Intergenic
1087598273 11:100282444-100282466 TCTCTCTGTTCTGAGCCACCTGG + Intronic
1087720864 11:101664467-101664489 TCTCTCTATGCTGAGCTAACTGG + Intronic
1088154735 11:106789864-106789886 TCTCTCTGTGCTGAGCCACCTGG + Intronic
1088181938 11:107122171-107122193 TATCTCTATGCTTAGCTGCTTGG - Intergenic
1088411410 11:109538944-109538966 TATCTCTGTGCTGAACTGCCTGG + Intergenic
1088938104 11:114425306-114425328 TCTCTCTGTGCTGAGCCACCTGG + Intronic
1088944379 11:114495074-114495096 TGTCTTTATGCTGAGTTGCCTGG + Intergenic
1089357003 11:117860505-117860527 TTTCTCAGGGGTGAGCTGGCAGG - Intronic
1089578737 11:119468318-119468340 TATCTCTGTGCTGAGCTCCCTGG + Intergenic
1089615618 11:119693082-119693104 TATCCTTGTGCTGGGCTGCCGGG - Intronic
1089762078 11:120735400-120735422 TCTCTCTGTGCTTAGCCACCTGG + Intronic
1089957535 11:122585629-122585651 TTTCTCAGTGCTGAGATTACAGG - Intergenic
1090111317 11:123911827-123911849 TCTCTCTGTGCTGATCCACCTGG - Intergenic
1090210252 11:124916084-124916106 TCTGTTTGTGCTGAGCTGCCTGG + Intergenic
1090515574 11:127423256-127423278 TTTCTCTCTGCTGTGCTGCCTGG + Intergenic
1090676781 11:129006594-129006616 TGTCTCTGTGATAAGCTACCTGG + Intronic
1091336199 11:134768063-134768085 TTTCTCTGCATTGGGCTGCCTGG - Intergenic
1092225461 12:6745453-6745475 TTTCTCTTTGCTGACCTGTGGGG + Intergenic
1092446449 12:8562074-8562096 TTTCTCTGTCCTGTTCTGCAAGG + Intergenic
1092476968 12:8827969-8827991 TCTCTTTGTGCTGAGCTGCCTGG + Intronic
1092622622 12:10289209-10289231 TTTCTCTGTGGTGAACTGTTGGG - Intergenic
1093107697 12:15109314-15109336 TTCTTCTGTGCTAACCTGCCTGG + Exonic
1093180553 12:15962261-15962283 TTTCTTTATGCTCATCTGCCAGG + Intronic
1093321215 12:17717977-17717999 TCTTTCCATGCTGAGCTGCCAGG + Intergenic
1093419919 12:18963965-18963987 CCTGTCTGTGCTGAGCTGCCTGG + Intergenic
1093538309 12:20248685-20248707 TCTCTCTGTGCTGAGCCTCCTGG - Intergenic
1093608000 12:21118037-21118059 TCTCTCTGTGCTAAGCTGCTTGG + Intronic
1093931921 12:24962121-24962143 TCTCTCTGTGCTGAGCCGCCTGG - Intergenic
1095169813 12:39020509-39020531 CCTCTCTCTGCTGAGCTGCCTGG - Intergenic
1095181599 12:39153414-39153436 TCTCTCTCTGATGAGCTCCCTGG + Intergenic
1095460953 12:42443849-42443871 TTTCTCTGTCCTGTTCTGCAAGG - Intronic
1095808030 12:46342839-46342861 TCTGTCTATGCTGAGCTGCCTGG + Intergenic
1095860354 12:46909192-46909214 TCTTTCTGTGCTGGGCTGCATGG - Intergenic
1096428959 12:51527540-51527562 TTTCTCAATGTTGAGGTGCCTGG - Intergenic
1096959007 12:55558974-55558996 TCTTTCTGTGGTGTGCTGCCTGG - Intergenic
1097425931 12:59445274-59445296 TATCTCTGTGTTGAGCTGCCTGG + Intergenic
1097466370 12:59929368-59929390 TTTCTCCATGCTGAGCTGCCTGG - Intergenic
1097742993 12:63267475-63267497 TTACTCTGTGCAGAGCTGAGGGG + Intergenic
1097770048 12:63572712-63572734 TTTCTCTGTGCTAAGCTGCCTGG - Intronic
1098060440 12:66555185-66555207 TGTCTCTGTGCTGAGCCACCTGG - Intronic
1098626588 12:72678523-72678545 TGTCACTGTGCTGGGCTCCCTGG + Intergenic
1098648960 12:72940762-72940784 TCTCTCTGTGCTAAACTGCCTGG + Intergenic
1098736638 12:74113107-74113129 TCTCTGTCTGCTGAGCTGCCCGG - Intergenic
1098798274 12:74921907-74921929 TCTCTCCATGCTGTGCTGCCTGG - Intergenic
1098870517 12:75812299-75812321 TTTCTTTCTGCTTAGCTGGCAGG - Intergenic
1098975380 12:76896533-76896555 TCTCTCCATGCTGAGCTGCCTGG - Intergenic
1099024607 12:77448974-77448996 CCTCTCTGTGCTGAGCTGCCTGG - Intergenic
1099428664 12:82553959-82553981 TCTCTTTGTCCTGTGCTGCCTGG + Intergenic
1099523435 12:83690918-83690940 TCTTTCTCTGCTGAACTGCCTGG - Intergenic
1099781774 12:87203673-87203695 TCCCTCTGTGCTGAGCTGCATGG - Intergenic
1099857233 12:88182867-88182889 TTTCTCTGTCCTGTTCTGCAAGG + Intronic
1099882352 12:88481314-88481336 TCTCTCTGTGCTGAGCCACCTGG - Intergenic
1099992338 12:89737354-89737376 TCTCTCTCTGCTGAGCTGCCTGG - Intergenic
1100066539 12:90652983-90653005 TCTCTATGTGCTGTGCTGCCTGG - Intergenic
1100403093 12:94249427-94249449 TTTCACTGTGTTGGGCTGGCTGG + Intronic
1100857646 12:98772332-98772354 TTCCTCTGTGCTTAGATGTCTGG - Intronic
1100909064 12:99337879-99337901 TCACTCTGTGCTGAGCTGCCTGG + Intronic
1100923852 12:99521741-99521763 TCTCTCTCTGCTGAGCCACCTGG + Intronic
1101167323 12:102052234-102052256 TCTCTCCATGCTGTGCTGCCTGG - Intronic
1101251855 12:102945129-102945151 TCACTCTGTGCTGAGCTGTCTGG + Intronic
1101260651 12:103026366-103026388 TTTCTCTCTGCTGAGGTTCTTGG - Intergenic
1101260899 12:103028534-103028556 TTTCTCTCTGCTGAGGTTCTTGG + Intergenic
1101592229 12:106134697-106134719 TTTCTTTGAGCTAAGCTCCCTGG - Intronic
1101607585 12:106259194-106259216 TCCCTCTGTGCTGAGCTGCCTGG - Intronic
1102266726 12:111492154-111492176 TCTCTTTGTGCTGAGCTGCTTGG - Intronic
1102760519 12:115380865-115380887 TTCCTCTGTGCTGTGCTCCCAGG - Intergenic
1102845121 12:116172590-116172612 TTTCACTATGCTGTGTTGCCTGG - Intronic
1103434902 12:120917228-120917250 TTTCTTTGTGCTTAACTGGCTGG - Intergenic
1103813402 12:123633831-123633853 TTGCTCTGCGCTGAGGTGCTGGG + Exonic
1103940920 12:124500764-124500786 TTTCTGTGTCTTGAGCGGCCTGG + Intronic
1104541953 12:129673971-129673993 TCTCTGTGTGCTGAGCTGACAGG - Intronic
1105429346 13:20323286-20323308 TTGCTCTGTGCTGAGCTGTGTGG + Intergenic
1105558912 13:21472637-21472659 TTTCTTTGTGCTGAGCTCCCTGG + Intergenic
1105953108 13:25251214-25251236 TTTCACTGTGCTGACCAGGCTGG + Intronic
1106074897 13:26449360-26449382 TGTCCCTGTACTGAGCTGCCTGG - Intergenic
1106855337 13:33846130-33846152 TCTCTCCATGCTGAGTTGCCTGG + Intronic
1107287686 13:38814516-38814538 TGTCTCTGTGCTGAGCCACCTGG + Intronic
1107524089 13:41213396-41213418 TCTCTCTGTGCTGAGCCGCCTGG + Intergenic
1107754166 13:43600809-43600831 TCTCTCAATGCTGAGCTGCCTGG - Intronic
1107808115 13:44174101-44174123 TTTCTCTATGTTGAGCTTCCTGG + Intergenic
1108099357 13:46937156-46937178 AGTCTCTGTGCTGAGCAACCTGG - Intergenic
1108138119 13:47386778-47386800 TCTCTCTGTGCTAAGCTGCCTGG - Intergenic
1108255837 13:48610730-48610752 TATCTCTGTTCTGAGCTATCTGG + Intergenic
1108531104 13:51328366-51328388 TTGCTCCGTGCTGAATTGCCTGG - Intergenic
1108690362 13:52853977-52853999 TCCCTGTGTGCTGAGCTCCCTGG + Intergenic
1108858135 13:54820694-54820716 ACTCTCTGTGTTGAGCTTCCTGG - Intergenic
1109045899 13:57410019-57410041 TCTCTCCTTGCTGAGCTGCATGG - Intergenic
1109211135 13:59537580-59537602 TTTCTCTGTGCTAAGCCACCTGG + Intergenic
1109336578 13:61002853-61002875 TCTGTCTGTGCTGAGCTGCCTGG + Intergenic
1109440086 13:62358177-62358199 TTTCTCTGCTCTAGGCTGCCTGG - Intergenic
1109685942 13:65819565-65819587 TCTATCTGTGCTGAGCTGCCTGG - Intergenic
1109747761 13:66648342-66648364 TCTCTTTGTGCTGAGCTGCCTGG - Intronic
1109961540 13:69638569-69638591 TCTCTCTGTGCTAAGCTGCCTGG + Intergenic
1110448658 13:75617259-75617281 CCTCTCTGTTTTGAGCTGCCTGG + Intergenic
1110665679 13:78115478-78115500 TCTTTCTGTGCTGAGCTGTCTGG + Intergenic
1110885974 13:80636417-80636439 TCCTTCTGTGCTGAGCTTCCTGG + Intergenic
1110901599 13:80831798-80831820 TCTGTCTGTGGTGAGCTTCCTGG - Intergenic
1111303340 13:86373518-86373540 TCTCTCCATGCTGAGCTGTCTGG + Intergenic
1111388873 13:87564890-87564912 TTACTCTGTGCTGAGCTGGGAGG - Intergenic
1111449226 13:88391712-88391734 TCTCTCTGTGCTGAGCTTCTGGG - Intergenic
1111568683 13:90049054-90049076 TTTCTCTCTGCTATGCTGCCTGG + Intergenic
1111583333 13:90252965-90252987 TTTTTCTGTGCTGGAGTGCCTGG + Intergenic
1111639433 13:90948077-90948099 TCTTTCTATGCTGAGCTGCCTGG - Intergenic
1111895011 13:94130652-94130674 ATTCTCTGAGATGAGCTGCCTGG - Intronic
1112176955 13:97035028-97035050 TCTCTTTGCTCTGAGCTGCCTGG - Intergenic
1112589928 13:100753622-100753644 TTTCTCTGTGTTGATGTGCCAGG + Intergenic
1112758860 13:102671130-102671152 TTTCTCTGTCCTGTTCTGCAAGG + Intronic
1112865998 13:103898809-103898831 TTTCTCTGTACTGAGCCTCCTGG - Intergenic
1113049927 13:106199436-106199458 TTTTTGTGTGCTGAGATGACTGG - Intergenic
1113076971 13:106476575-106476597 TTTCTGTGTCCTGGGCTGACGGG - Intergenic
1113244123 13:108376322-108376344 TTTCTCCTTGCTGAGCTGCCTGG + Intergenic
1113395253 13:109941365-109941387 TTTCTCAGTTCTTATCTGCCTGG + Intergenic
1114248011 14:20933032-20933054 TTGCTGTGAGCTGTGCTGCCTGG - Intergenic
1114250845 14:20959131-20959153 TTGCTGTGAGCTGTGCTGCCTGG - Intergenic
1114251013 14:20960194-20960216 TCTCTGTGTGTTGAGCTGCCTGG - Intergenic
1114761490 14:25321592-25321614 TTTCCCTGTTCTGAGCTGCCTGG + Intergenic
1114783632 14:25569603-25569625 TTTCTTTGTGCTGAGCCACCTGG + Intergenic
1115661127 14:35495053-35495075 TGTGTGTGTGCTGAGCTTCCTGG - Intergenic
1116086938 14:40253157-40253179 TCTGTCTTTGCTGAGCTGTCTGG + Intergenic
1116106552 14:40514687-40514709 ATTTTCTGTGCTGAGCAGCCTGG - Intergenic
1116392809 14:44413757-44413779 TCTCTCTGTGCTGAGCTTCCTGG - Intergenic
1116413327 14:44650394-44650416 TCTGTTTGTGCTGAGCTGCCTGG - Intergenic
1116434180 14:44877869-44877891 TTTCTCTGTGCTGAGCCGCCTGG - Intergenic
1116497673 14:45582601-45582623 TTCCCCTGTGCTGAGCTGCCTGG + Intergenic
1116542030 14:46110756-46110778 TCTCTCTATGCTGAGCTGCCTGG - Intergenic
1116669335 14:47821262-47821284 TCTGTGTGTGCTGAGCTGCCTGG + Intergenic
1116766073 14:49071347-49071369 TCTATCTGTGCTGAGTTACCTGG - Intergenic
1116834985 14:49761902-49761924 TCTCTCCGTTCTGAGCTACCTGG + Intergenic
1116970778 14:51062777-51062799 TTTCTTTCTGCTGAGCTCCTTGG - Intronic
1117110475 14:52447551-52447573 TCTCTCTGTTCTGAGCCACCTGG - Intronic
1117234094 14:53753017-53753039 TTTCTCTGTGCTGAGCCATCTGG - Intergenic
1117418472 14:55519710-55519732 TTTTTCTGTGCTGAGCTGCCTGG - Intergenic
1117504368 14:56388042-56388064 TTTCTCTACGCTGAGCTGCCTGG + Intergenic
1117606882 14:57439542-57439564 TCTCTCTGTGCTGAACTGCCTGG + Intergenic
1117795309 14:59387940-59387962 TGTGTGTGTGCTGAGCTGCCTGG + Intergenic
1117842903 14:59880055-59880077 TCTCTCTGTGATGAGATGCCTGG + Intergenic
1117870892 14:60198874-60198896 TGTGTCTGTGCTGAGCTTCCTGG - Intergenic
1117893394 14:60450782-60450804 TCTCTCTGTGCTGAGCTGCCTGG - Intronic
1118034107 14:61848435-61848457 TCTCTCTGTGCTGAGCAGTCTGG + Intergenic
1118080791 14:62357836-62357858 TTTCTTTGTGCTAAGCAGCAGGG + Intergenic
1119096745 14:71840108-71840130 TCTCTTTGTTCTGAGCTGCCTGG + Intergenic
1119172335 14:72544838-72544860 TTTCTCTCTGCAGAGCTGCCTGG - Intronic
1120126418 14:80749118-80749140 TCTCTCAGTGCTGAACTGCCTGG - Intronic
1120275892 14:82371493-82371515 TGTCTGAGTGCTGAGCTGCTTGG - Intergenic
1120340574 14:83216570-83216592 TTCCTCTGTGCTGAGTTGCCTGG + Intergenic
1120426290 14:84351737-84351759 TCTGTCCATGCTGAGCTGCCTGG - Intergenic
1120426353 14:84352562-84352584 TCTGTCCATGCTGAGCTGCCTGG + Intergenic
1120697563 14:87660443-87660465 TCTCTCTGTGCTGAGCCACCTGG - Intergenic
1121153076 14:91654888-91654910 TTTCTCTGTGCTAAGCTGCCTGG - Intronic
1121376068 14:93411572-93411594 TTTCTCTGTTCTCAGCTGCCTGG - Intronic
1121544964 14:94756449-94756471 CTTCTCTGAGCTCAGCAGCCAGG - Intergenic
1121960257 14:98253159-98253181 CTCCTCTGTGCTGACCTGGCAGG + Intergenic
1122477055 14:102017637-102017659 CTTCTCTGTGCTGTAATGCCAGG + Intronic
1123151603 14:106186709-106186731 TTTCTTTGTGCTGAAGTTCCTGG + Intergenic
1202853195 14_GL000225v1_random:34585-34607 TATCTCTGTACTGATCTCCCAGG - Intergenic
1202868909 14_GL000225v1_random:141412-141434 TATCTCTGTACTGATCTCCCAGG + Intergenic
1124081262 15:26500662-26500684 TCTCTCTGTTCTGAGCCACCTGG + Intergenic
1125574805 15:40747969-40747991 TTTCTCTTGGCTGAGATGCCTGG + Intronic
1125878220 15:43168262-43168284 TCTCTCTTTGCTGGCCTGCCTGG + Intronic
1126053197 15:44706616-44706638 TCTTTCTGTGATCAGCTGCCTGG + Intronic
1126218377 15:46183568-46183590 TCTCTCTGGGCTGTGCTGCCTGG + Intergenic
1126261329 15:46696017-46696039 TCACTTTGTTCTGAGCTGCCAGG - Intergenic
1126440668 15:48684258-48684280 CCTGTCTATGCTGAGCTGCCTGG - Intergenic
1126706987 15:51414933-51414955 TATCTCTATGCTGTGCTGCCTGG - Intergenic
1126811370 15:52408955-52408977 TTTCTGTGTGCTGAACCACCTGG - Intronic
1127033969 15:54894944-54894966 TCTCTAAGTGCTGAGATGCCTGG + Intergenic
1127140499 15:55970546-55970568 TCTCTCTGTTCTGAGCTGCCTGG - Intronic
1127171018 15:56300672-56300694 TCTCTCTCTGCTGAGTTGCTTGG - Intronic
1127173600 15:56329064-56329086 CTTCTCTGTGCTGAGCTGTGTGG - Intronic
1127493349 15:59485396-59485418 TTTCTTTGTGCTGAGCTACCTGG - Intronic
1127971384 15:63965318-63965340 TCTCTCTGTACTGACCTGCCTGG + Intronic
1128900929 15:71422549-71422571 TCTCTCTGTGATAAGCTGCCTGG + Intronic
1128966361 15:72061975-72061997 TATCTCCTTGCTGAGCTGCCTGG - Intronic
1129376653 15:75138000-75138022 TTTCAGTGGGCTGTGCTGCCTGG - Intergenic
1129642514 15:77394412-77394434 TCTTTCTGTGCTGAGCTGCCTGG - Intronic
1129706987 15:77799981-77800003 CTTCTCAGTGCTGAGCTTCCTGG - Intronic
1129985965 15:79919955-79919977 TTGGTCTGTGCAGAGTTGCCTGG + Intronic
1130335483 15:82953556-82953578 TTTTACTGTCCTGAGATGCCAGG - Intronic
1130441028 15:83954858-83954880 TCTCTCTCTGCTGAGCCACCTGG + Intronic
1130772646 15:86940102-86940124 TTTCTCTGTGTTGCTCAGCCTGG + Intronic
1130833533 15:87627352-87627374 TTGCTCTGCCATGAGCTGCCAGG - Intergenic
1130956724 15:88632036-88632058 TTCCTCTGTGCTGTGCTGACAGG - Exonic
1130961822 15:88664442-88664464 TTTGTCTGTGCCACGCTGCCTGG - Intergenic
1131068822 15:89451250-89451272 TTGCTCTTTGCTGTGTTGCCCGG + Intergenic
1131716312 15:95114243-95114265 TCTCTCTGTACTGAGCCACCTGG - Intergenic
1131945125 15:97611000-97611022 TCTCTCTCTCCTGAGCTACCTGG - Intergenic
1132416266 15:101621122-101621144 TGTCTCTGTTCTGTGATGCCTGG - Intergenic
1133118627 16:3592706-3592728 TAGCTCTGAGCTGAGCTCCCTGG - Exonic
1133319079 16:4902033-4902055 CTTCTCTGTGGTGAGCACCCAGG + Intronic
1133788873 16:8993952-8993974 TTTCTCTATGCTGATCAGGCTGG + Intergenic
1133834045 16:9350893-9350915 TCTCTCTCTGCTGAGCTGTCTGG + Intergenic
1134005260 16:10814777-10814799 TTTATCTGTGCTGTGCAGCACGG - Intronic
1135177701 16:20245448-20245470 TTTCTCTTTGCTGCTCTGTCTGG + Intergenic
1135239742 16:20793708-20793730 TTTCCCTGCCCTCAGCTGCCTGG - Intronic
1136389050 16:29950840-29950862 TGTCTCTTTGCTGAGCTTCCTGG + Intronic
1136676487 16:31913316-31913338 TTTCTCTATGCTGAGCTACCTGG + Intronic
1137775349 16:51049542-51049564 TTTCTCTCTGCTGGGCTGCGAGG - Intergenic
1138575493 16:57904733-57904755 TTTCTCTGTGATGATCGGACAGG - Exonic
1138713706 16:58998000-58998022 TTTCTCTGCAATGAGCTGCCAGG - Intergenic
1139922616 16:70469408-70469430 AGTCCCTGTGCTGGGCTGCCTGG - Intronic
1140092212 16:71847836-71847858 TTTCTCTCTGTTCAACTGCCTGG + Intronic
1140172504 16:72621086-72621108 TTTCTCTGTTTTGAGCTTCTGGG - Intergenic
1140224659 16:73067710-73067732 TTTATCTGTGCCAAGCTGCAGGG - Intergenic
1140258154 16:73354659-73354681 TTTCAGTGTGCACAGCTGCCTGG + Intergenic
1141356495 16:83351438-83351460 TCTCTCTGTGTAGAGATGCCAGG - Intronic
1141485277 16:84334611-84334633 TGTATCTGTGCTGAGCCACCTGG - Intergenic
1141566071 16:84902961-84902983 TTTCACTGTGTTGAGCAGGCTGG + Intronic
1142010386 16:87710977-87710999 TTGCCCTGGGCTGAGGTGCCCGG - Intronic
1142080820 16:88147806-88147828 ATTCTCTGAGCTCAGCTGCCTGG - Intergenic
1142448366 16:90157766-90157788 TTTCTCTGTGCTGGTCAGGCTGG + Intergenic
1142459120 17:77557-77579 TTTCTCTGTGCTGGTCAGGCTGG - Intergenic
1142919692 17:3173188-3173210 CTTCTCTGTGCTGAGCTTCCTGG - Intergenic
1143509577 17:7388109-7388131 TTCATCTGTGCTGAGCTGGATGG - Intronic
1143611242 17:8019121-8019143 TTTCTCTGTACTTAGGTCCCAGG + Intronic
1143857585 17:9863686-9863708 TCTCTCTGTGCTGCTCTACCTGG + Intronic
1144793443 17:17874898-17874920 TTTCTCTGTGCAGAGACCCCTGG - Intronic
1145069136 17:19788273-19788295 TTGCTGTGAGCTGCGCTGCCTGG - Intronic
1145099922 17:20066387-20066409 TTGTTCTGTGCAGAGCTGGCTGG + Intronic
1145117348 17:20224208-20224230 TCTCTTCATGCTGAGCTGCCTGG + Intronic
1146051235 17:29555181-29555203 TATCTCTCTTCAGAGCTGCCGGG - Intergenic
1146098798 17:29959010-29959032 TCTCTCTGTGCTGAGCTGCCTGG + Intronic
1146216650 17:30981904-30981926 TGTCTGTGTGCTGAGCTGCCTGG + Intronic
1146242431 17:31243203-31243225 TGTGTGTGTGTTGAGCTGCCTGG + Intronic
1146590992 17:34127873-34127895 TTTCTCTATGCTGAGCATCCCGG + Intronic
1146615269 17:34351269-34351291 TCTCTCTGTGCTGAGATGCCTGG - Intergenic
1148166638 17:45488741-45488763 TTTCTCTGTGTTGATCAGGCTGG - Intronic
1149075559 17:52593888-52593910 TGTCTCTGTGCTGAACTTCCAGG + Intergenic
1149111194 17:53033090-53033112 TCTCTCTGTGCTGAGCTGCCTGG + Intergenic
1149180537 17:53931556-53931578 TCTCTCTGTGCTGAGCCACCTGG + Intergenic
1149239893 17:54636341-54636363 TCACTCTGTGCTGAGCTGCTTGG - Intergenic
1149572846 17:57685893-57685915 TTTCTCTGAGCTGAGCAATCAGG - Intergenic
1149906387 17:60529782-60529804 TCTCTCTGTGCTGAGCTGCCTGG - Intergenic
1150201896 17:63365744-63365766 TTTCTATGTGATGAGATGCCTGG - Intronic
1150251841 17:63709932-63709954 TTTCTCTTTGCTGAGCAGCTTGG - Intronic
1150397814 17:64835142-64835164 TTTCTCTGTGTTGATCAGGCTGG - Intergenic
1150550474 17:66204863-66204885 TTTCTCCATGCTGAACTGCTTGG - Intergenic
1151041297 17:70863606-70863628 TATCTCTGAGCTGAGCTGTGAGG + Intergenic
1151816450 17:76473728-76473750 CTGCTCTGTGCAGATCTGCCAGG + Exonic
1151972373 17:77465477-77465499 TTTCTCTGTGCTGTGCTCTGAGG + Intronic
1152094306 17:78264067-78264089 TTTCTCTGCGCTGGGCAACCTGG - Intergenic
1152107614 17:78340283-78340305 GTTCTCTGAGCTCATCTGCCTGG - Intergenic
1152359624 17:79825579-79825601 CCTCTCTGTTCTGAGCTTCCAGG + Intergenic
1152468667 17:80478755-80478777 CTCCTCTGTGCCGAGGTGCCAGG - Intergenic
1203164397 17_GL000205v2_random:80490-80512 TATCTCTGTGCTCATCAGCCTGG - Intergenic
1153183164 18:2458962-2458984 TCTCTATGTGCTGAGCTTCCTGG + Intergenic
1153336988 18:3934949-3934971 TTTCTCAGTGCTGTGTAGCCTGG + Intronic
1153356475 18:4142975-4142997 TTTCTCTGTGCTGAGCTGCCTGG + Intronic
1153562189 18:6382856-6382878 CTGCTCTCTTCTGAGCTGCCAGG + Intronic
1154405359 18:14085657-14085679 TGTTTCTGTGCTGCACTGCCTGG - Intronic
1154930975 18:20995689-20995711 TCTCTCTGCGCTGAGCTGCCAGG - Intronic
1155097024 18:22566337-22566359 CTCCTCTTTGCTCAGCTGCCAGG + Intergenic
1155282021 18:24249966-24249988 TTGCTGTCTGCTGTGCTGCCTGG - Intronic
1155443539 18:25885827-25885849 TCTTTCTGTGCTGAGCTGCCTGG - Intergenic
1155533917 18:26795624-26795646 TCTCTCTGTTCTGAGCCACCTGG - Intergenic
1155767519 18:29653453-29653475 TCTCTCTGTTCTGAGCTTCCTGG - Intergenic
1156055703 18:32999623-32999645 TCTCTCTGTGCTGAGCTGCATGG - Intronic
1156912278 18:42425367-42425389 TCTCTCTGTGCTGAGATGCCTGG + Intergenic
1156977147 18:43237211-43237233 GCTCTCTGTGCTGAGCAACCTGG + Intergenic
1157937091 18:51884669-51884691 TCTCTATGTCCTGAGCTGCCTGG - Intergenic
1158481157 18:57823262-57823284 TCTCTCTGTGCTGAGCTGCTTGG + Intergenic
1158944318 18:62435442-62435464 TTTCTCCGTGCTGATCTGCAAGG + Intergenic
1158948896 18:62474068-62474090 TCTCTCTGTGATGAGCTGCCTGG + Intergenic
1159091912 18:63859861-63859883 ACTCTCTGTGCTGAGCTGCCTGG + Intergenic
1159144334 18:64434111-64434133 TTTCTTTCTGCTCAGCTGACTGG - Intergenic
1159260172 18:66003942-66003964 TTTCTGTGAGCTGCACTGCCTGG - Intergenic
1159446432 18:68546010-68546032 TTTCTCGGTGCTGAGTTGCCTGG - Intergenic
1159478677 18:68959363-68959385 TCTTTCTGTGCTGAGCTGCTTGG + Intronic
1159648184 18:70943908-70943930 TCTTTGTGTGCTGAGCTGCCTGG - Intergenic
1159775226 18:72597401-72597423 TCATTCTGTGCTTAGCTGCCTGG + Intronic
1159802476 18:72918952-72918974 TATCTCTGTGCTGAGCTACCTGG + Intergenic
1159896375 18:74001009-74001031 TCTCTCTGTTCTGAGCCACCTGG + Intergenic
1160648838 19:210064-210086 TTTCTCTGTGCTGGTCAGGCTGG - Intergenic
1162692899 19:12448820-12448842 TTGCTCTGTTCTGAGCCACCTGG + Intronic
1164408670 19:27977653-27977675 TCTCTCTGTGCTGAGCTTTCTGG - Intergenic
1164620766 19:29694861-29694883 TGTCTCTGGGCTGAGATGTCTGG - Intergenic
1164681980 19:30140971-30140993 TTTCACTGTGTTGACCAGCCTGG + Intergenic
1165645544 19:37432310-37432332 TCTTTCTGTGCTGAGTTGCCTGG - Intronic
1165983582 19:39747449-39747471 CCTCTCCGTGCTGAGCTGCCTGG - Intergenic
1165984160 19:39752626-39752648 TCTCTCTGTGCTGGGCTGCCTGG - Intergenic
1166755955 19:45191785-45191807 TCTCTCTGTGCTGAGCTGCCTGG + Intronic
1166757302 19:45201333-45201355 TATCTCTGTACGGAGCTGCCTGG + Intronic
1166903990 19:46090968-46090990 TCTCTCTGTGCTATGCTGCCTGG + Intergenic
1167083264 19:47291550-47291572 TCTCTCTGTGCTGAGATGCCTGG - Intronic
1167555925 19:50195693-50195715 TTGCTCAGTGCTGACCTGCTCGG - Intronic
1167584695 19:50367593-50367615 TCTCTCTCTGCTGAGCTACCTGG + Intronic
1167869065 19:52352431-52352453 TTTCTCTGTGTTGATCAGGCTGG + Intronic
1168430041 19:56271490-56271512 TTTCCCGGTGATGAGTTGCCAGG + Intronic
924978518 2:198976-198998 TGTCTCTGTGCTGATCTACTTGG - Intergenic
925269374 2:2591399-2591421 TTGCTTTGAGCTGTGCTGCCAGG - Intergenic
925269539 2:2592415-2592437 TCTCTCTGTGTTGAGCCACCTGG - Intergenic
925369274 2:3332347-3332369 TTTCTCCCTTCGGAGCTGCCGGG - Intronic
925689200 2:6504163-6504185 CTTCCATGTGTTGAGCTGCCTGG - Intergenic
925698833 2:6612921-6612943 TCTGTCCATGCTGAGCTGCCTGG + Intergenic
926834045 2:16998464-16998486 TCTATCTCTTCTGAGCTGCCTGG + Intergenic
927184450 2:20472360-20472382 TGTCTGTGTGCTGAGCTCCAGGG - Intergenic
927478310 2:23431033-23431055 TTTCTCCGTGCTGTGCAGCCTGG + Intronic
927570161 2:24152637-24152659 TCTCTCTGTGCTGAGCCACCTGG + Intronic
927594618 2:24385772-24385794 TCTCTCTGTTCTGAGCCACCTGG + Intergenic
928113564 2:28528908-28528930 TTCCTCTAGGGTGAGCTGCCGGG - Intronic
928146344 2:28780284-28780306 TTTCTCTGTGTTGATCAGGCTGG + Intronic
928220272 2:29397611-29397633 TTTCTATGTGATGACCAGCCTGG + Intronic
928293671 2:30061913-30061935 TATCTCTGTACTGAGCTTCCTGG - Intergenic
928495554 2:31828506-31828528 TTTCTCTGTGCTGAGGCACCTGG + Intergenic
928715419 2:34055257-34055279 TCTGTCTGTGCTGAGCTGCCTGG + Intergenic
928768033 2:34671140-34671162 TCTCTCTGTGCTGAGCTTCCTGG - Intergenic
928932466 2:36637931-36637953 TCTCTCTGTTCTGAGCTGCCTGG - Intronic
929100054 2:38302598-38302620 TGTCTCTGTGCTGAGCTGCCTGG - Intronic
929215307 2:39405206-39405228 TCTCTCTGTTCTGAGCTGCCTGG - Intronic
929281599 2:40086766-40086788 TTTCTCTGTGCTAAGCTGCCTGG + Intergenic
929529172 2:42736293-42736315 TGTCTCTGTGCTGAGCTGCCTGG + Intronic
929855528 2:45635719-45635741 TTTCTCTATGTTGATCAGCCTGG - Intergenic
930091393 2:47533933-47533955 TTTCTCTGTGCCTGGCTGACTGG - Intronic
930230572 2:48840421-48840443 TCTGTCTGTGCTATGCTGCCTGG + Intergenic
930288745 2:49467353-49467375 TCTCTCTGTGCTGAACTGCCTGG + Intergenic
930423972 2:51190209-51190231 TTTCTCTTGCCTGAGCGGCCTGG + Intergenic
930778380 2:55197483-55197505 CAAATCTGTGCTGAGCTGCCTGG - Intronic
930938395 2:56983809-56983831 TTTCTCTGTGCTGTTTTGCAAGG + Intergenic
931406795 2:61987544-61987566 TTTCTCTGTGCTGGACTACCTGG + Intronic
931600737 2:64000740-64000762 TCTCTTTCTGCTGAGCTGCATGG + Intronic
931694412 2:64860716-64860738 TTTCGCTGTGCTAAGAGGCCGGG - Intergenic
931736665 2:65200181-65200203 TCTCTCTGTGCTGAGCTGCCTGG - Intergenic
931796514 2:65715432-65715454 TTTCTCTGAGGTGAGTTTCCTGG + Intergenic
932648687 2:73532109-73532131 TGTCTCTGTGCTGAGCTGCTTGG + Intronic
932889608 2:75580426-75580448 TGCCTCTATGATGAGCTGCCAGG - Intergenic
933086701 2:78062014-78062036 TTTCTATGCACTGTGCTGCCTGG - Intergenic
933097988 2:78211520-78211542 TTTCTTTGTTCTAAACTGCCTGG - Intergenic
933114252 2:78446915-78446937 TTTCTCTGCACTGTGCTACCTGG + Intergenic
933333209 2:80921221-80921243 TTTCTCTGAGCTGAGCCACATGG + Intergenic
933489698 2:82970125-82970147 TCTCTCCATGCTGGGCTGCCTGG + Intergenic
933572852 2:84034184-84034206 CTTCTCAGTACAGAGCTGCCTGG - Intergenic
933590092 2:84223314-84223336 TTTCTCTGTGGTGAGCCAGCTGG + Intergenic
934234904 2:90222109-90222131 TTTCTGTGTGGTGAGCAGCAGGG - Intergenic
934779908 2:96963317-96963339 TCTCTCTGAGCTGAGGTGCATGG - Intronic
934851760 2:97706386-97706408 TTGCGCTGTCCTGAGCTGCCGGG + Intergenic
934870692 2:97862011-97862033 TCTCTCTGTGCTGAGCCACCTGG - Intronic
934929112 2:98405506-98405528 TGTCTCTGTGCTGAGCTGCCTGG - Intergenic
934970692 2:98761722-98761744 TTGATCTGTGCACAGCTGCCCGG - Intergenic
934992163 2:98929493-98929515 TGTCTCTGTCCTGAGGAGCCAGG + Intronic
935078488 2:99769858-99769880 TCTCCCTGTGCTGAGCAGCCTGG + Intronic
935478494 2:103556356-103556378 TTTCTCTGTGCTGAGCTTCCTGG + Intergenic
936778104 2:115998616-115998638 TTTCTCTCTGCTGAGCTGCCTGG + Intergenic
936885154 2:117300810-117300832 CCTCTCTGCTCTGAGCTGCCTGG - Intergenic
936925454 2:117731726-117731748 TCTCTTTGTGCTGAGCTGCCTGG - Intergenic
936940278 2:117877839-117877861 TTGCTCTGTGCTGAACTACCTGG + Intergenic
937019138 2:118634180-118634202 TTGCTCTGTGCTTGGCTCCCAGG - Intergenic
937512609 2:122612545-122612567 CTTCTCTCTGCTGGGCTGCCTGG - Intergenic
937560671 2:123219743-123219765 TCTCTCTGTTCTAAGCTACCTGG - Intergenic
937628442 2:124069626-124069648 TCCCTCTGTGATGAGCTGCCTGG - Intronic
937738489 2:125319571-125319593 TTTCTCCATGCTGTGCTGCCTGG + Intergenic
937793877 2:125994281-125994303 TCTCTCTGTGTTGAGCTTACTGG + Intergenic
938161732 2:128990413-128990435 TTTCTCAATGCTGAGGTGCCCGG - Intergenic
938370363 2:130764393-130764415 AGCCTCTGTGCTGAGCTGCAAGG - Exonic
939273708 2:139971760-139971782 TTTCTCTGTGCTGAACCACCTGG - Intergenic
939404953 2:141745050-141745072 TTTGTCTGTGCTAAGCTGCCTGG + Intronic
939707784 2:145477296-145477318 TTACTCTGTGCTGAGCTGCCTGG + Intergenic
939913011 2:148006133-148006155 TATCTCAGTGCTGTGCTGCCTGG - Intronic
940402242 2:153261541-153261563 TTACTCTGTTCTGAAATGCCTGG + Intergenic
940468773 2:154065499-154065521 TTTCTCTGTGCTAAGCTGCCTGG - Intronic
940546977 2:155100949-155100971 TCTCTCTGTGCTGAGCCACCTGG - Intergenic
940559715 2:155280533-155280555 TTTCTCTTTGCTGAGCTGCCTGG + Intergenic
940786236 2:157984605-157984627 TTTCTCTGTTCTGAGCCACCTGG + Intronic
940806457 2:158192820-158192842 TTTCTCTGACCTAAGCTGCTTGG + Intronic
940971191 2:159898794-159898816 ACTCTCTGTACGGAGCTGCCCGG - Exonic
941256246 2:163234839-163234861 TTTCTATGTACTGGTCTGCCAGG - Intergenic
941390658 2:164909813-164909835 TCTCTCTAAGCTGTGCTGCCTGG + Intronic
941528138 2:166631623-166631645 TCTGTGTGTGCTGAGATGCCTGG + Intergenic
941742337 2:169047824-169047846 TCTCTCTGTGCTGAGCCACCTGG - Intergenic
942001465 2:171652494-171652516 TCTCTGTGTCCTGAGCTGTCTGG + Intergenic
942081540 2:172403703-172403725 CTTCTGTGTTCTGAGCAGCCTGG + Intergenic
942247999 2:174025132-174025154 TTTCTGTGTGTTGAACTGCGTGG - Intergenic
942391675 2:175501979-175502001 TCTCTCTTTGCTGAGCTGCCTGG + Intergenic
942459904 2:176161508-176161530 ATTCTGTGTCTTGAGCTGCCGGG + Intronic
942694163 2:178620267-178620289 TTTCTCTCTGGAGAGCTGGCAGG + Exonic
942794510 2:179801497-179801519 CTCCTCTGTGCTAAGGTGCCAGG + Intronic
942834398 2:180276831-180276853 TCTCTCTGTGCTGAGCCACCTGG + Intergenic
942862910 2:180636834-180636856 TCTCTCTGTGCTAAGCTGCTTGG - Intergenic
943117392 2:183691103-183691125 TGTCTCTATCCTGAGCTGCCTGG + Intergenic
943208087 2:184927359-184927381 TCTCTCAGTTCTGAGCTGGCTGG + Intronic
943237140 2:185337390-185337412 TATCTCTGTGTTGAGCTGCCTGG + Intergenic
943331242 2:186561737-186561759 TCTCTCTGGGCTGAACTTCCTGG - Intergenic
943755844 2:191556151-191556173 TTTCTCTGTGTTGTCCTGGCTGG + Intergenic
943831866 2:192473331-192473353 TTTTTCTGCTCTTAGCTGCCTGG - Intergenic
943845219 2:192635987-192636009 TGTCTCTGTTCTGAGCTGTTTGG - Intergenic
943967423 2:194354441-194354463 TCTCTCTGTGCTGAGCTGCCTGG - Intergenic
944005217 2:194896721-194896743 TCTCTCTGTGCTGACCTGCCTGG + Intergenic
944096822 2:195976708-195976730 TCTCTGTCTGCTAAGCTGCCTGG - Intronic
944616265 2:201464451-201464473 TCTTTCCATGCTGAGCTGCCTGG + Intronic
944751878 2:202717667-202717689 CTTCTCTGTTCTGAGCCCCCTGG + Intronic
944839829 2:203614351-203614373 TTTCTCAGTCCTTAGCTTCCTGG - Intergenic
944955193 2:204799650-204799672 TTTCTCTGTGCTGAGCTGCCTGG - Intronic
944963250 2:204900981-204901003 TCTGTCTCTGCTGAGCTTCCTGG + Intronic
945210348 2:207375868-207375890 TCTCTCTGTGCTGAGCCACCTGG - Intergenic
945484378 2:210377775-210377797 TCTGTCTGTGCTGTGCTGCCTGG - Intergenic
945531869 2:210965355-210965377 TTGCTTTGTGGTGAGCTGGCAGG - Intergenic
945575777 2:211526231-211526253 TCCCTCTGTGTTGAGCTGCCTGG - Intronic
945636105 2:212353024-212353046 TTTTACTGTGGTGAGTTGCCTGG + Intronic
945803621 2:214464498-214464520 TCTCTCCATGCTGAGCTCCCTGG + Intronic
946059292 2:216927835-216927857 TTCCATTGTGCTGATCTGCCAGG + Intergenic
946188436 2:217994701-217994723 TTTCTTGGGGCTGGGCTGCCAGG - Intronic
946508977 2:220334302-220334324 TCTCTCTGTGCTGAGGTGCTTGG + Intergenic
947439620 2:230108354-230108376 TCCCTCTTTGCTGAGCAGCCTGG + Intergenic
947505218 2:230703593-230703615 TCTCTCTGTGCTAAGCTGCTTGG + Intergenic
947556205 2:231095675-231095697 TTTCTCTGTCCTGTTCTGCAAGG + Intronic
947687034 2:232097275-232097297 TCTGTCTGTGCTGAGCCACCTGG + Intronic
948380687 2:237547995-237548017 TGTCACTGTGAGGAGCTGCCGGG - Intronic
948475378 2:238215719-238215741 TCACTCTGTGTTGAGATGCCTGG + Intergenic
948985914 2:241523143-241523165 TTTCACTGTGCTGGGCAGGCTGG - Intergenic
1169569062 20:6887103-6887125 TTTCTCTGTGCTCTGCATCCAGG + Intergenic
1169628420 20:7598215-7598237 TCTCTCTGTTCTGAGCCACCTGG - Intergenic
1169766981 20:9157189-9157211 TTTCTCTGTCCTTGGCTTCCAGG - Intronic
1170236160 20:14106712-14106734 TTTCTCTATGCTGAGCCACCTGG - Intronic
1170311597 20:14997881-14997903 TCTCTCCATGCTGAACTGCCTGG - Intronic
1170709139 20:18774732-18774754 TCTCCCAGTGCTGAGCTGCCTGG + Intergenic
1171943041 20:31349368-31349390 TCTCTCTGTGGTGAACTGCCTGG - Intergenic
1172164964 20:32893445-32893467 TCCCTCTGTGCTGAGCTGAGCGG - Intronic
1172825935 20:37786119-37786141 TCTCTCTGTGCTGAGCTGCCTGG + Intronic
1173127000 20:40346246-40346268 TCTCTCTGTGCTGAGCCACCTGG - Intergenic
1174705139 20:52647465-52647487 TTTCTCTGACCTGAAGTGCCAGG - Intergenic
1174938670 20:54899165-54899187 TTTCTCTGTGCTGAGCTGCTTGG - Intergenic
1175474637 20:59262987-59263009 TTCCTTTGTGCTGAGGTGCCTGG - Intergenic
1175632058 20:60549765-60549787 TCTCTCTGTGCCAAGCTGCCTGG + Intergenic
1176263061 20:64193301-64193323 GTTCTGTGGGCTGAGCTGGCAGG + Intronic
1176337215 21:5610316-5610338 TATCTCTGTGCTCATCAGCCAGG + Intergenic
1176410529 21:6447355-6447377 TGACTCTGGGCCGAGCTGCCAGG - Intergenic
1176470877 21:7105542-7105564 TATCTCTGTGCTCATCAGCCAGG + Intergenic
1176494438 21:7487320-7487342 TATCTCTGTGCTCATCAGCCAGG + Intergenic
1176506204 21:7651063-7651085 TATCTCTGTGCTCATCAGCCAGG - Intergenic
1177105301 21:16946932-16946954 TGTCTCTGTGATGAGCTGCCTGG - Intergenic
1177149115 21:17436989-17437011 TTTCACTGAGCTGAACTCCCAGG + Intergenic
1177222128 21:18208881-18208903 CCCCTCTGTGCTGAGCTGCCTGG + Intronic
1177740510 21:25148038-25148060 TCTCTCTGTGCTGAGCTGCATGG + Intergenic
1177760832 21:25400428-25400450 TCCCTCTGTGCTGGGCTGACTGG - Intergenic
1177771432 21:25519996-25520018 TTTCCCTATGCTGAACTGCCTGG - Intergenic
1179047323 21:37857645-37857667 TTGCTCTGTGCTATGCTTCCTGG + Intronic
1179187312 21:39094816-39094838 TGTCTCTGTTATGTGCTGCCCGG - Intergenic
1179435133 21:41357530-41357552 TTTCTCTCTGCAGGGCTGTCTGG - Intergenic
1179652616 21:42821396-42821418 TCTGTCTGTGCTGAGCTGCCTGG - Intergenic
1179686022 21:43055677-43055699 TGACTCTGGGCCGAGCTGCCAGG - Intronic
1180411611 22:12615512-12615534 TTTCTTTGTGTGGAGCTCCCAGG - Intergenic
1180868947 22:19135223-19135245 TTTCTGTGTGAGGGGCTGCCTGG - Intronic
1180993283 22:19951612-19951634 TTTCTCTGTGATCAGGGGCCAGG - Intronic
1181717055 22:24738532-24738554 TGTCTCTGTGCTGAACCGCCTGG - Intronic
1181762479 22:25067714-25067736 TTTCTCTGTCCTGGGCTGATAGG + Intronic
1183353941 22:37348693-37348715 TCTCTCTGTCCTCAGCTCCCGGG + Intergenic
1183497329 22:38154385-38154407 TCTCTCTGTGCTGGGCCGCCTGG - Intronic
1183629251 22:39023309-39023331 TTTCACTGTGTTGAGCAGGCTGG + Intronic
949448415 3:4161187-4161209 TCTCTTTGTGCTGTGCTGCCTGG + Intronic
949829135 3:8196190-8196212 TCTTGGTGTGCTGAGCTGCCTGG + Intergenic
949891599 3:8737498-8737520 TTCCTCTGTTCTTGGCTGCCTGG - Intronic
950270927 3:11614269-11614291 TCTACCTGGGCTGAGCTGCCTGG + Intronic
950695516 3:14698632-14698654 TCTCTCTGTGCTGAGCCACCTGG + Intronic
951029170 3:17862696-17862718 TCTTTCTGTGCTGAGCTTCTTGG + Intronic
951259804 3:20494835-20494857 TCTCTCTGTGCTGAGTCACCTGG + Intergenic
951398806 3:22204121-22204143 CCTCTCTCTGCTGAGCTGTCTGG - Intronic
951419716 3:22470147-22470169 TTTCTCAGAGCTCAGCTTCCAGG + Intergenic
951423235 3:22511550-22511572 TTTCTCTGTTCTGAGCCACCTGG - Intergenic
951436170 3:22667145-22667167 TTTCTCTTTGCTGCGCTCCTGGG - Intergenic
951436862 3:22675764-22675786 TTTCTCTATGATGACCTGCCTGG + Intergenic
951495115 3:23317045-23317067 TTGCTGTGAGCTGTGCTGCCTGG + Intronic
952008779 3:28875361-28875383 TCTCTCTGTGCTGAGATGCCTGG + Intergenic
952132691 3:30383773-30383795 TCTCTCTGTGCTGAGCCACCGGG + Intergenic
952220502 3:31319473-31319495 TGTCCCTTTGCTTAGCTGCCTGG - Intergenic
952355536 3:32579834-32579856 TCTCTCTGTGCTGATGTGTCTGG - Intergenic
952673114 3:35994534-35994556 TCTCCCTGTGCTTAGCTGTCTGG - Intergenic
952725857 3:36583238-36583260 TCTCTCTGTGCTGAGCTGCCTGG - Intergenic
952811771 3:37410912-37410934 TCTCTCTCTGCTGAGCTGCCTGG + Intronic
952912589 3:38203696-38203718 TGTCTCTGGGCGGAGCTGTCTGG + Intronic
952957233 3:38564901-38564923 ATCCTCAGGGCTGAGCTGCCAGG + Intronic
954300453 3:49698286-49698308 ATTCTCTGAGCTGGGGTGCCTGG - Intronic
954748143 3:52798606-52798628 CTTCTCAGTGCTGAGCTCCAAGG + Intronic
955274249 3:57532695-57532717 TCTCTGTGTGCTGAGCTGCCTGG + Intronic
955794627 3:62622640-62622662 TATCCCTGAGCTGAGCTGCATGG + Intronic
956245749 3:67181149-67181171 TTCCTCTCTGCTCATCTGCCAGG - Intergenic
956393154 3:68796065-68796087 TCTCTCTGTGCTGAGCTGCTTGG + Intronic
956879981 3:73500482-73500504 TATTTCTGAGCTGAGTTGCCAGG + Intronic
957409798 3:79824654-79824676 TTTCTCAATGATGTGCTGCCTGG + Intergenic
957537893 3:81530679-81530701 TCACTCTATCCTGAGCTGCCTGG + Intronic
957745719 3:84339787-84339809 GTTCTCAGTGCTGAGCTGCCTGG + Intergenic
957901268 3:86495799-86495821 TTTCTCTGTGCTTACCTGCTGGG + Intergenic
957925558 3:86805801-86805823 TCTCTCTGTTCTGAACTACCTGG - Intergenic
957965952 3:87322402-87322424 TCTGCCTGTGCTGAGCTGCTTGG - Intergenic
957977191 3:87461328-87461350 TCTGTCTGTGCTGAGCTGCCTGG - Intergenic
958052143 3:88362471-88362493 TTTCCCTGCACTGAGCAGCCTGG + Intergenic
958147226 3:89640824-89640846 TCTCTCTGTGCTGAGCTGCCTGG - Intergenic
958174785 3:89983264-89983286 TCTTTCTATGTTGAGCTGCCTGG - Intergenic
958682951 3:97353910-97353932 TCTCTCTGAGCTGAACTGCCTGG - Intronic
958950273 3:100408790-100408812 TTTTTCCGGGCTGTGCTGCCTGG + Intronic
959125335 3:102283978-102284000 TCTTTTTGTGCTGAGCTGGCTGG + Intronic
959127629 3:102308733-102308755 TCTGTCTGTGCTGAGCTGCCTGG - Intronic
959285059 3:104397965-104397987 TCTCTCTGTGCTGAGCTGCTTGG - Intergenic
959328638 3:104973014-104973036 TCTCTCTGTTCTGAGCCACCTGG + Intergenic
959331558 3:105012469-105012491 TTTCTCTGAGCTGAGAAGGCAGG + Intergenic
959500331 3:107099515-107099537 TCTATCTGTGCTTATCTGCCAGG - Intergenic
959806507 3:110561467-110561489 TGTCTCTGTGCTGAGCTACCTGG + Intergenic
959841760 3:110984341-110984363 ATTCTCTGTGCTGAACTCCCTGG - Intergenic
959868434 3:111299423-111299445 TCTCTCTGTTCTGAGCTGTCTGG + Intronic
960095377 3:113685214-113685236 TTTCTTCATGCTGAGCTGCCCGG + Intronic
960153431 3:114274368-114274390 TCTCTCTGTGCTGAGCTTCTTGG + Intergenic
960499019 3:118412579-118412601 TCTCTCTGTGCTGAGCTTCCTGG - Intergenic
960524965 3:118699196-118699218 TTTCTCTTGGCTTAGCTTCCAGG - Intergenic
960565023 3:119123643-119123665 TCTCTCTGTGCTGAGCTTCCTGG - Intronic
960766521 3:121136179-121136201 TCTCTCTGTGCTGTGCTGCCTGG - Intronic
960862634 3:122167711-122167733 TCTCTCTTGGCTGAGCTGCCTGG + Intergenic
960870147 3:122239701-122239723 TCTTTCTGTGCTGAGGTTCCTGG - Intronic
961234659 3:125355689-125355711 TCTCACTGTGTTGAGCAGCCTGG - Intronic
962015272 3:131432378-131432400 TCTCTCTGTGTTGAGCTGCCTGG - Intergenic
962038671 3:131682498-131682520 TCTGTCTGTAATGAGCTGCCTGG + Intronic
962078625 3:132113891-132113913 TTTCTTGGTGCTGAGCTGCCTGG + Intronic
962354327 3:134680938-134680960 CTCCTCTGGGCTCAGCTGCCAGG - Intronic
962465630 3:135655361-135655383 TCTCTCTGTGCTGGGCTGCCTGG - Intergenic
962667931 3:137674319-137674341 TCTTTCTGTGCTGAGCCACCTGG - Intergenic
962767680 3:138580304-138580326 TCTCTCTGTGCTGAGCTGCCTGG - Intronic
962870793 3:139491356-139491378 TCTCTTTCTGCTGAGCTGCCTGG + Intergenic
963020348 3:140868011-140868033 TCTCTCTGTGCTGGGCTGCCTGG + Intergenic
963154242 3:142078419-142078441 TCTGTCTGTGCTGAGCTGCCTGG - Intronic
963310208 3:143700939-143700961 TTGCTCTGTTCTAAGCTGCCTGG - Intronic
963330643 3:143910786-143910808 TCTCTCTGTGCTGAGCCACCTGG - Intergenic
963430682 3:145197743-145197765 TCTCTCCATGCTGAGCTACCTGG - Intergenic
963648732 3:147949251-147949273 TTTCTCTGTGTTGCCCTGGCTGG - Intergenic
963776508 3:149445544-149445566 TTTCGCTGTGTTGGCCTGCCTGG - Intergenic
963802345 3:149688416-149688438 TCTCTCCATTCTGAGCTGCCTGG - Intronic
964140715 3:153396349-153396371 TTTCTCTGTGTTGAGGTGCCTGG + Intergenic
964253813 3:154750886-154750908 TCTCTCTGTGCTGAGCAGCCTGG - Intergenic
964258807 3:154810936-154810958 TCTCTTTGTGCTGAGCTGCCTGG + Intergenic
964410123 3:156389281-156389303 TTTCTCTCTGAAGAGCTTCCTGG + Intronic
964582792 3:158259438-158259460 TCACTCTGTGCTGAACTGCCTGG + Intronic
964961151 3:162428104-162428126 TCTCTTTGTGTTGAGCTGCTTGG - Intergenic
964964951 3:162481282-162481304 TCTCTCTATTCTGAACTGCCTGG + Intergenic
964992789 3:162835154-162835176 TCCCTCTGTGCTGAGCTGCCTGG + Intergenic
965000012 3:162941210-162941232 TCTCTTTGTGCTGAACTGCCTGG - Intergenic
965045724 3:163574027-163574049 AGCCTCTCTGCTGAGCTGCCTGG - Intergenic
965059896 3:163772551-163772573 TCTCTCGGTGCTGAGTTGCCTGG + Intergenic
965095537 3:164220174-164220196 TTTCTCTGTCCTGTTCTGCAAGG + Intergenic
965099697 3:164279274-164279296 TCTCTCTGTGCTGAGCTTCCTGG - Intergenic
965144885 3:164889225-164889247 TCTCTCTATGGTGATCTGCCTGG + Intergenic
965317438 3:167209373-167209395 TCTCTCTGTGCTGAGCTTTCTGG - Intergenic
965499143 3:169436443-169436465 TTTCTCTGTGCTGGTCAGGCTGG + Intronic
965853936 3:173065656-173065678 TTTCTCTGTGCTGCTTTGCCTGG - Intronic
965854056 3:173066445-173066467 TCTCTCCATGCTGGGCTGCCTGG - Intronic
965975236 3:174613150-174613172 TCTCTCTGTTCTGAGCTGCCTGG + Intronic
965980420 3:174682538-174682560 TCTCTCTGTGCTGAGATGCCTGG - Intronic
966142051 3:176767712-176767734 TCTCTCTGTGCTGAGCTGTCTGG - Intergenic
966329094 3:178790741-178790763 TCTCTTTGTGCCGAGTTGCCTGG - Intronic
966384777 3:179384728-179384750 TCTCACTGTGCTGTGCTGGCTGG + Intronic
966401060 3:179547103-179547125 GCTCTCTGTGCAGACCTGCCTGG - Intergenic
966453821 3:180093267-180093289 TCTCTCTGTGCTGAGCTTTCTGG + Intergenic
966463603 3:180204085-180204107 TCTCTCTGTGCTGAGCTGCCTGG - Intergenic
966502696 3:180662950-180662972 ATGCTGTTTGCTGAGCTGCCTGG + Intronic
966533246 3:181004050-181004072 TTGCTCTCTTCAGAGCTGCCAGG + Intergenic
966622298 3:181978629-181978651 TTTTTCTGTGTTGAGCAGCATGG + Intergenic
966977875 3:185102065-185102087 TTTCTCTTGCCTGATCTGCCTGG - Intronic
967091590 3:186139099-186139121 TTGCTCTGTGCGTAGCTGCTGGG - Intronic
967210098 3:187160759-187160781 GAGCTCTGTACTGAGCTGCCTGG + Intronic
967609381 3:191484775-191484797 TCTCTCTGTGCTGAGTCACCTGG - Intergenic
967636718 3:191809597-191809619 TCTCTCTGAACTGAGCTTCCTGG - Intergenic
967655651 3:192044608-192044630 TGTCTCTATACTGAGCTACCTGG - Intergenic
967677594 3:192317864-192317886 TCTCTCTGTGCTAAGCTGCCTGG - Intronic
968096381 3:195933565-195933587 TCTCTCCATGCTGAGCTGTCTGG - Intergenic
968334607 3:197902010-197902032 TAACTCTTTGCTGAGCTACCTGG - Intronic
968369012 3:198210061-198210083 TTTCTCTGTGCTGGTCAGGCTGG + Intergenic
969354261 4:6615997-6616019 TTTCACTGTGCTGACCAGGCTGG + Intronic
970097874 4:12486069-12486091 TCGCTCAGTGTTGAGCTGCCTGG + Intergenic
970657921 4:18252098-18252120 TCTCTTTGTGCTGAGGTGCAAGG + Intergenic
970892923 4:21067748-21067770 TCTCTCTGTGCTGAGCTTCCTGG - Intronic
970915425 4:21328430-21328452 TCTTTGTGTGCTGAGGTGCCTGG + Intronic
971838466 4:31800749-31800771 CCTCTCTGTGCTGAGGTGCCTGG + Intergenic
972007443 4:34128292-34128314 TCTCTCTATGCTGAGCTGCCTGG - Intergenic
972207892 4:36799455-36799477 TCTCTCTGTGCTGAGATGTTTGG - Intergenic
972253931 4:37333371-37333393 TCTCTCTGTGCTGAGCTTCCTGG - Intronic
972278508 4:37581683-37581705 TTGCTGTGAGCTGTGCTGCCTGG + Intronic
972579375 4:40380930-40380952 TTTCTCTGTGCTGAGTTGCCTGG - Intergenic
972902632 4:43703486-43703508 ACTCTGTGTGCTGAGCTGCCTGG + Intergenic
972915583 4:43874216-43874238 CTTCTTTTTGCTGAGCTGCCTGG + Intergenic
973054024 4:45631249-45631271 TCTCTCTGTACTGAGCTGCCTGG - Intergenic
973074104 4:45901087-45901109 TCTCTCTATGCTTGGCTGCCTGG - Intergenic
973330775 4:48908303-48908325 GTTTTCTGGGCTGAGCTGCCAGG + Intergenic
973919693 4:55672869-55672891 TCTCTGCGTGCTGAGCTTCCTGG + Intergenic
974267062 4:59598833-59598855 TCTCTCCTTGCTGTGCTGCCTGG - Intergenic
974292399 4:59948926-59948948 TTTTTCCATGCTGAGCTGTCTGG - Intergenic
974328376 4:60444566-60444588 TTTCTCCATTCTGTGCTGCCTGG + Intergenic
974333255 4:60506374-60506396 TCTATCTGTTCTGAGCTCCCTGG - Intergenic
974414869 4:61594622-61594644 TCTCTCTGTGCTGAGCCACTTGG + Intronic
974469596 4:62301972-62301994 TTCCTGTGAGCTGTGCTGCCTGG - Intergenic
974559323 4:63496017-63496039 TCTCTCTGTGCTGAGCAGCCTGG - Intergenic
974611026 4:64215727-64215749 TTTTTCTCTGTTGAGATGCCTGG + Intergenic
974683091 4:65189770-65189792 TTTCTCTGTGATGAACACCCAGG - Intergenic
974799819 4:66802180-66802202 TTTCTGTGTGGTGAGCAGCAAGG - Intergenic
974867826 4:67602738-67602760 TGTGTGTGTGCTGAGCTGCCTGG + Intronic
975026844 4:69559440-69559462 TCCCTCTGTGCTGAGCCACCTGG - Intergenic
975369385 4:73567606-73567628 TCTCTCTGTGCTGAGCTGCCTGG + Intergenic
975504019 4:75118038-75118060 TCTCTCTCTACTGAGCTGCCTGG - Intergenic
975592660 4:76016429-76016451 TCTCTCTGTGCTGAGCTGCTTGG + Intronic
975629879 4:76388781-76388803 TCTCTCTGTGCTGAGCCACGTGG - Intronic
975675175 4:76820890-76820912 TTTCTCCATGCTCAGCTGCCTGG + Intergenic
975709246 4:77142879-77142901 TTTCTCTGTACAGAGCTAACTGG - Intergenic
976161320 4:82202063-82202085 TCTCTCTGTGCTGGGCTGCCTGG - Intergenic
976171605 4:82310593-82310615 TCTCTCTGTGCTGAACTGCCTGG + Intergenic
976344546 4:83985300-83985322 TTTCTCTGTGCAAAGGTGACTGG - Intergenic
976444220 4:85111238-85111260 CCTGTCTGTGCTGAGCTGCCTGG - Intergenic
976547647 4:86355931-86355953 TTTGTCTGTGTTAACCTGCCTGG - Intronic
976574857 4:86657497-86657519 TCTCTCTGTACTAGGCTGCCTGG + Intronic
976722171 4:88179179-88179201 TCTCTCTGTGCTCAGCCGCCTGG - Intronic
976728382 4:88239243-88239265 TCTTTCTGTGATGAGCTGTCTGG + Intergenic
977249888 4:94677947-94677969 TTTCTCTTAGCTTAGCTGCCAGG - Intergenic
977396965 4:96483632-96483654 TTTCTGCACGCTGAGCTGCCTGG + Intergenic
977873576 4:102123292-102123314 TCTCTCTATGCTAAGCTGCCTGG + Intergenic
977985732 4:103380365-103380387 TCTCTCTCTGCTAAGCTGCCTGG - Intergenic
978520335 4:109609076-109609098 TCTCTCTGTGCTGAGCTGCCTGG + Intronic
979031882 4:115658869-115658891 TCTCTCTGTGCCGTACTGCCTGG + Intergenic
979057251 4:116012612-116012634 TCTCTCTATGCTGTGTTGCCTGG - Intergenic
979111491 4:116762627-116762649 TCTCTTTGTGCTGAGCTACCTGG - Intergenic
979156162 4:117392875-117392897 TCTCTTTGTGCTAAACTGCCTGG - Intergenic
979213173 4:118131917-118131939 TTTCTCTGTGCTGAGCTGCCTGG + Intronic
979219017 4:118199903-118199925 TCTCTCTGTGCTGAGCCACCTGG + Intronic
979395155 4:120178557-120178579 TTTCTCTGTGCTGAGCTGCCTGG - Intergenic
979573108 4:122252934-122252956 TCTGTGTGTGCTGAGCTTCCTGG - Intronic
979892685 4:126119572-126119594 TCTCTCTGTGCTGAGCCACTTGG + Intergenic
979913080 4:126395800-126395822 TCTCTCACTGCTGAGCTGCTTGG + Intergenic
980146771 4:128995679-128995701 TTGCTCTGTGATGAGCTGGGGGG + Intronic
980538280 4:134159454-134159476 TCTCTTTGTGCTGTGCTGTCTGG - Intergenic
980646929 4:135653831-135653853 TCTCTCTGTGCTGAGCTGCCTGG - Intergenic
980657804 4:135812137-135812159 TCTCTCTTTGTTGAGCTGCCTGG - Intergenic
980702567 4:136452551-136452573 TTTGTGCGTGCTGTGCTGCCCGG - Intergenic
981203674 4:142014565-142014587 TTTCTCTGTTCTGAGCCACCTGG + Intergenic
981297993 4:143155650-143155672 TCTCTCTGTTCTGAGCCACCTGG + Intergenic
981530692 4:145751496-145751518 TGTGTGTGTTCTGAGCTGCCTGG + Intronic
981880585 4:149606224-149606246 TCTCTCTGTACTGGGCTGCCTGG - Intergenic
981996265 4:150978171-150978193 TCTCTCTGTGCTGAACCACCTGG - Intronic
982584060 4:157214994-157215016 TTACTCTATGCTGAGCTGGGAGG + Intronic
982678135 4:158399606-158399628 TTTTTCTGTGCTCCTCTGCCTGG - Intronic
982683270 4:158458623-158458645 TCTCTTTGTGCTGAGCCACCTGG + Intronic
982797991 4:159668519-159668541 CATCTCTGTACTGCGCTGCCTGG + Intergenic
983017347 4:162629129-162629151 TCTCTCTGTGCAGAACTGCCTGG - Intergenic
983050209 4:163037773-163037795 TCTGTCTGTGCTGTGCTTCCAGG - Intergenic
983389028 4:167103875-167103897 GGTCTCTGTGATGACCTGCCTGG - Intronic
983493218 4:168412810-168412832 TTTCTCTGTGTTGAGCTGCCTGG - Intronic
984059290 4:174972644-174972666 TTGCTCTGTGCTGAGCAGGAGGG + Intronic
984310502 4:178052498-178052520 TTTCTGTGTGTTGAGTTGCCTGG + Intergenic
984355350 4:178652149-178652171 TCTCTCTGTGCTGAGCTGCCTGG + Intergenic
984529598 4:180900992-180901014 TCTCTCTGTGCTGAGCAACCTGG + Intergenic
985213894 4:187628765-187628787 CATCTCTGTGCTGTGCTGCCTGG - Intergenic
985229606 4:187800016-187800038 TCTCTCTGTAGTGAGCTGCCTGG - Intergenic
985967342 5:3347773-3347795 TTTCTCTATGCAGAGCAGCAAGG + Intergenic
986046752 5:4045178-4045200 TCTGTCTGTGCTGAGCTGCCTGG - Intergenic
986646221 5:9918878-9918900 TTTCTCTGTGCTGAGGAGCATGG - Intergenic
986756437 5:10840500-10840522 TCTTTCTGTGCTGAACTGCCTGG - Intergenic
987458002 5:18170397-18170419 GCTCTCTGTGCTAAGCTTCCTGG - Intergenic
987598859 5:20038840-20038862 TTTCTCTTTCCTGATCTCCCTGG - Intronic
987645984 5:20672676-20672698 TCTCTCTGTGCTGAGCTGCCTGG - Intergenic
987903990 5:24051435-24051457 ATTCACTCTGCTGAGCTGCCTGG - Intronic
988064871 5:26220169-26220191 TCTCTCCATGCTGAGCTGTCTGG - Intergenic
988384316 5:30540581-30540603 TCTCTTGATGCTGAGCTGCCTGG - Intergenic
988931748 5:36041519-36041541 TCTCCCTGTGCTAAGCTGCCTGG - Intronic
988939464 5:36128038-36128060 TCTCTTTGTCCTGAGCTGCCTGG - Intronic
988956265 5:36323621-36323643 TTTCTCTGTTCTGAGCCACCTGG + Intergenic
989028172 5:37089735-37089757 TTTCTCTGTCCTGTTCTGCTAGG - Intergenic
989461872 5:41708815-41708837 TTTCTCTGGGCTGGACTTCCCGG - Intergenic
989472145 5:41832318-41832340 TCTCTCTGTGCTGAACCGCCTGG - Intronic
990214114 5:53512579-53512601 TCTCTCTGTGCTGAGCCACCTGG + Intergenic
990578868 5:57149766-57149788 TTTTTCTGTGTTGAGCTGTCTGG + Intergenic
990579696 5:57156160-57156182 TCTCTCTTTGCTGAGCTGCCTGG - Intergenic
990828045 5:59923493-59923515 TCTCTCTGTCTTGAGCTACCTGG - Intronic
990909828 5:60842872-60842894 TTTATCAGTGCTTAGGTGCCAGG - Intronic
990922235 5:60979950-60979972 TCTCTGTGTGCAGAGCTGCCTGG - Intronic
991297282 5:65094244-65094266 TTTATTTGTGCTGAGCTGCTTGG - Intergenic
991682009 5:69149421-69149443 TCTCTCTCTGCTGAGCTGCCTGG + Intergenic
992021217 5:72626044-72626066 TTTCTCTGTGTAGTTCTGCCAGG - Intergenic
992309678 5:75482667-75482689 TTTCTTTGCGTTGAGCTGCCTGG - Intronic
992531663 5:77658671-77658693 TCTCTCTGTTCTGAGCTGCCTGG + Intergenic
992934642 5:81688547-81688569 TCTGTCTGTGCTGAGGTGCCTGG - Intronic
993155713 5:84219140-84219162 TCTCTCTGCTCTGAGCTGCCTGG - Intronic
993257173 5:85605892-85605914 CCTCTCTGTGCTGAGCTGTCTGG - Intergenic
993287248 5:86015716-86015738 TCTGTCTGTGCTGAGCTTCCTGG + Intergenic
993287411 5:86016768-86016790 TTGCTCTGAGCTGCACTGCCTGG + Intergenic
993677555 5:90835406-90835428 TGTGTCTGTGCTGAACTTCCTGG + Intronic
993981385 5:94546502-94546524 TCTCTCTGTGCTGAGCCACCTGG - Intronic
994217739 5:97158492-97158514 TTTCTTTGTGCTGAGCTGCCTGG + Intronic
994229462 5:97297425-97297447 AGTCCCTGTGCTGAACTGCCTGG + Intergenic
994310899 5:98268737-98268759 TCCCTCTGTGCTGTGATGCCTGG - Intergenic
994320132 5:98385869-98385891 TCTCTCTGAGCTGAGCTGCCTGG + Intergenic
994344022 5:98663886-98663908 TCTCTCTGTTCTGAGCTGCCTGG - Intergenic
994787797 5:104186785-104186807 TTTTTCTGAGCTGTGCAGCCAGG - Intergenic
995019481 5:107351438-107351460 TCTCTATGTGTTGAGCTGCCTGG + Intergenic
995265454 5:110153498-110153520 TCTCTCTCTGCTGAGCTGCCTGG - Intergenic
995358617 5:111268070-111268092 ATTCACTGTGAAGAGCTGCCTGG + Intronic
995557705 5:113346119-113346141 TCTCCCTGTGCTGAGCCACCTGG + Intronic
995573037 5:113502237-113502259 TGTCTCTGTGCTGAGCTGTCTGG + Intergenic
995837091 5:116409839-116409861 TTTCTGTCTGCTCAGCTGCCTGG + Intronic
996166300 5:120228383-120228405 TTTCTCCCTCCTGAGCTGCCTGG + Intergenic
996520520 5:124420837-124420859 TTTCTCTGTGCTGTGCTACTTGG - Intergenic
996653542 5:125912887-125912909 CCTCTCTGTTCTGAGCTGCTTGG + Intergenic
996666673 5:126067353-126067375 TCTCTCTGTGCTGAGCTGCCTGG - Intergenic
996962573 5:129269297-129269319 TCTCTGTGTGTTGAGCTGCCTGG + Intergenic
997003164 5:129785527-129785549 TCTCTTTGTGCTGAGCTACCTGG - Intergenic
997180500 5:131824025-131824047 TCTCTCTTTGCTGAGCCACCTGG + Intronic
997251472 5:132391951-132391973 TCTCTCTGTGCTGTGCTGATGGG - Intronic
997263854 5:132483642-132483664 TTCCTCTGAGCCCAGCTGCCTGG - Exonic
999548815 5:152661393-152661415 TATCTCTATGCTGTGCTGCCTGG - Intergenic
999849384 5:155522565-155522587 TCTCTGTGTGCTGAGCCACCTGG + Intergenic
1000286012 5:159826741-159826763 TTTCCTTGTGCTGGGCTGCTGGG - Intergenic
1000399589 5:160811979-160812001 TCTCTCTGTTCAGAGCTGTCTGG - Intronic
1000517950 5:162262712-162262734 TATCTCCCTGCTGAGCTACCTGG - Intergenic
1000581569 5:163040799-163040821 TTTCTCCATGCTGCCCTGCCTGG - Intergenic
1001142544 5:169156958-169156980 TTTCTGTTTACTAAGCTGCCAGG - Intronic
1002302834 5:178267194-178267216 TCTTTCTGTGATGAGCTGCGGGG + Intronic
1002494537 5:179602828-179602850 CTTCTTTGTGCATAGCTGCCAGG + Intronic
1002728288 5:181315628-181315650 TTTCTCTGTGCTGGTCAGGCTGG + Intergenic
1003261990 6:4525806-4525828 TTTCTCTGTGCTGAGCTGCCTGG - Intergenic
1003952209 6:11126995-11127017 TCTCTCTGTGCTGAGCTGCCTGG + Intronic
1003984183 6:11419188-11419210 TCTCTCTATGCTGTGTTGCCTGG - Intergenic
1004557913 6:16717577-16717599 TCTCTCTGTGTTAAGCTGCATGG - Intronic
1005037278 6:21568920-21568942 TGTGTGTGTGCTGAGCTGCCTGG + Intergenic
1005156965 6:22818690-22818712 TCTCTCTGTTCTGAGCCACCTGG + Intergenic
1005604464 6:27462225-27462247 TTTCTCTCTGTTGCGCAGCCTGG + Intronic
1006280936 6:33052389-33052411 TTTCTCTGTCCTGTTCTGCTAGG - Intergenic
1006554117 6:34851488-34851510 TCTCTCCATGCTAAGCTGCCTGG + Intronic
1007001708 6:38319730-38319752 TTGCTGTGAGCTGTGCTGCCTGG + Intronic
1007021927 6:38529235-38529257 TCTCTCTCTGCTGAGATGCCTGG - Intronic
1007627948 6:43257087-43257109 TTTCTCTCTGCTGAGAGGACCGG - Intronic
1008016903 6:46530826-46530848 TTCCACTGCTCTGAGCTGCCTGG + Intergenic
1008192478 6:48476272-48476294 TTTCTCTGTGCTGAGCTGTCTGG - Intergenic
1008304490 6:49885518-49885540 TGTCTTTGGGCTGAGCTCCCAGG + Intergenic
1008707470 6:54181043-54181065 TCTCTCTGTACTGAGCTGCCTGG + Intronic
1009211569 6:60869064-60869086 TGTCTCCTTGCTCAGCTGCCTGG + Intergenic
1009329613 6:62400884-62400906 TCTGTCTGTGCTGACCTGCCTGG + Intergenic
1009371276 6:62906013-62906035 TCTCTCTGTGTCAAGCTGCCTGG - Intergenic
1009375327 6:62961346-62961368 TTTCTGTGAGCTGCGCTGCCTGG + Intergenic
1009388023 6:63110871-63110893 TTTCTCTATCCTAAGCTGCCTGG + Intergenic
1009608728 6:65908336-65908358 TATCTCTGTGCTGAGCTGCCTGG - Intergenic
1009788132 6:68364615-68364637 TTTCCCTCTGCTGTGGTGCCTGG + Intergenic
1010182033 6:73097646-73097668 TTTCTCTGTGCTGAGGTGCCTGG - Intronic
1010313829 6:74421157-74421179 TCTGTCTGTGCTGAGCCACCTGG - Intergenic
1010343330 6:74782221-74782243 TCTCACTGTTCAGAGCTGCCTGG - Intergenic
1010514290 6:76753959-76753981 TCACTATGTGCTGGGCTGCCTGG - Intergenic
1010625931 6:78136101-78136123 TTTCTCTGTCCTGTTCTGCAAGG - Intergenic
1010676765 6:78754324-78754346 TCTCTGTGTTTTGAGCTGCCTGG - Intergenic
1010772577 6:79848275-79848297 TGTCTCTGTGCTCAGCCACCTGG - Intergenic
1010838928 6:80624045-80624067 TACCTCTATGCTGAGTTGCCTGG - Intergenic
1011019072 6:82790041-82790063 TCTCTCTGTGCTGAGCTGTCTGG - Intergenic
1011033317 6:82945242-82945264 TGTCTCTGTGCTGAGCCACCTGG - Intronic
1011236126 6:85218897-85218919 TCTATCAGTGCTGGGCTGCCTGG - Intergenic
1011271204 6:85581124-85581146 TCTCTCTGTGCTGAGCTTCCTGG - Intronic
1011291064 6:85778297-85778319 TCTCTCTCTGCTGAGCCACCTGG + Intergenic
1011333125 6:86232928-86232950 TCTCTCTGTTCTGAGCCACCTGG + Intergenic
1011341077 6:86314506-86314528 TTTGTGTGTGCTGAGCTTCCTGG - Intergenic
1011791735 6:90906594-90906616 TCTCTCTGTGCTGAGCCACCTGG + Intergenic
1012224617 6:96689439-96689461 TCTTTCTATGCTGAGCTGCCTGG - Intergenic
1012356141 6:98316684-98316706 TTTCCCTGTGCTGAGCTGCATGG - Intergenic
1012483207 6:99690491-99690513 TCTCTCTGTGCTAAGCTGCCTGG - Intergenic
1012588176 6:100947994-100948016 TTTCTCTGTCCTGTTCTGCAAGG - Intergenic
1012827457 6:104163627-104163649 TCTCTCTGTTCTGAGCTGGTTGG - Intergenic
1012940590 6:105410448-105410470 TCTCTCTATGCTGAACTGCCTGG - Intergenic
1013036008 6:106383933-106383955 TCTCTCTGTGCAAAGCTGACTGG - Intergenic
1013632792 6:112001453-112001475 TTTCTTTCTGCTGAGCTCCTGGG - Intergenic
1013632991 6:112002833-112002855 TTTCTTTCTGCTGAGCTCCTGGG + Intergenic
1013673321 6:112429557-112429579 TCCCTCTGTGCTGAGCTTCCTGG + Intergenic
1013908662 6:115247368-115247390 TCTCTCTGTACCGAGCTGCCTGG - Intergenic
1014234750 6:118941074-118941096 TCTCTCTGTTCTGAGCTGCTTGG - Intergenic
1014542313 6:122692052-122692074 CCTGTCTGTGCTGAGCTGCCTGG + Intronic
1014645959 6:123973119-123973141 CTTCTCTGTGCTGTAGTGCCAGG + Intronic
1014692545 6:124578842-124578864 TCTTTCTGCGCTGAGCTGCCTGG - Intronic
1014840686 6:126217603-126217625 TTCCTCTGTGCTGAGCTGCCTGG + Intergenic
1014862384 6:126485300-126485322 TCTCTCTGTGCTGAGCTACCTGG - Intergenic
1016457254 6:144244522-144244544 TCTGTCTCTGCTGAACTGCCTGG + Intergenic
1016541548 6:145171081-145171103 TCTTTCTGTGCTGAGCTGCCCGG - Intergenic
1016623711 6:146142265-146142287 TCTTTCTGTGCTGAGCTTCCTGG + Intronic
1016843862 6:148551515-148551537 TTTCTCTGTCCTGAACCCCCAGG + Exonic
1017243321 6:152195665-152195687 TTTCTCTGTGCTGAGTTCCCTGG + Intronic
1017650381 6:156576127-156576149 CCTCTCTGTGCTGTGCTTCCTGG - Intergenic
1018917494 6:168145770-168145792 TGTCTCTGTGCTGAGGCACCTGG + Intergenic
1019044336 6:169131654-169131676 TTGCTATGAGCTGTGCTGCCTGG - Intergenic
1019044497 6:169132634-169132656 TCTCTCTCTGTTGAGCCGCCTGG - Intergenic
1019552402 7:1609663-1609685 TCTCTCTGTGTTGCCCTGCCTGG - Intergenic
1019937898 7:4268317-4268339 TCTCTCTGGGCTCACCTGCCTGG - Exonic
1020485270 7:8713825-8713847 TCTTTCTGTTCTGAGCTGCCTGG + Intronic
1020506044 7:8989437-8989459 TTTCTCTATTCTGAGCTTTCTGG - Intergenic
1020607285 7:10355698-10355720 TCTTTCTGTGCTGAGCTGCCTGG + Intergenic
1021034917 7:15785583-15785605 TCTCTCTGTTCTGAGCCACCTGG - Intergenic
1021123847 7:16827039-16827061 TCTCTCTGTGATGAGCTACCTGG - Intronic
1021473331 7:21031888-21031910 TATCAGTGAGCTGAGCTGCCAGG - Intergenic
1021842789 7:24734065-24734087 TCTCTCTATGCTAAGCTGTCTGG - Intronic
1022223475 7:28339495-28339517 TCTCTATGGGCTGAGCTGCCTGG + Intronic
1022366851 7:29730060-29730082 TTTCTCTGTGCTAAGCTGCCTGG + Intergenic
1022542032 7:31146464-31146486 TTACTGTGAGCTGTGCTGCCTGG + Intergenic
1022749760 7:33212872-33212894 TCTCTCTGTGCTGAGCCACCTGG + Intronic
1023208851 7:37781775-37781797 CCTGTCTGTGATGAGCTGCCTGG + Intronic
1023716370 7:43047751-43047773 TCTTTCTGTGCTGAGCTGCCTGG - Intergenic
1023780186 7:43647881-43647903 TCGCTCTGTGCTGGGCTGGCTGG - Intronic
1023931109 7:44707259-44707281 TTTCTGGGTTCTGAGCTGCAGGG - Exonic
1024170395 7:46778775-46778797 TCTCTCTGTTCTGAGCTGCCTGG - Intergenic
1024329471 7:48141644-48141666 TTTCTCTGTCCTGTTCTGCAAGG - Intergenic
1024336540 7:48212290-48212312 TTTCTCCATGCTGCACTGCCTGG + Intronic
1024488417 7:49947570-49947592 TCTGTGTGTGCTGAGCTGACTGG + Intronic
1024705777 7:51958556-51958578 TCTCTCTGTTCTGAGCCACCTGG + Intergenic
1024984019 7:55180529-55180551 TCTCTCTGTGCTGTGCCCCCAGG - Intronic
1025138094 7:56437267-56437289 TCTCTCTGTGCTGAGCTTCCTGG - Intergenic
1025160582 7:56655714-56655736 TCTCTCCATACTGAGCTGCCGGG - Intergenic
1025726148 7:64063488-64063510 TCTCTGCATGCTGAGCTGCCTGG + Intronic
1025854187 7:65263972-65263994 TTCCACTGTGCTGAGTGGCCAGG + Intergenic
1026390679 7:69898518-69898540 TTGGTGTGTACTGAGCTGCCTGG + Intronic
1026465102 7:70646993-70647015 TGTGTCTGGGCTGAGCTGCAAGG + Intronic
1026747237 7:73022963-73022985 TTTCTCTGTGTTGACCAGGCTGG - Intergenic
1026750887 7:73051106-73051128 TTTCTCTGTGTTGACCAGGCTGG - Intergenic
1026754536 7:73079216-73079238 TTTCTCTGTGTTGACCAGGCTGG - Intergenic
1026758188 7:73107249-73107271 TTTCTCTGTGTTGACCAGGCTGG - Intergenic
1027033341 7:74907534-74907556 TTTCTCTGTGTTGACCAGGCTGG - Intergenic
1027089217 7:75286235-75286257 TTTCTCTGTGTTGACCAGGCTGG + Intergenic
1027092860 7:75314163-75314185 TTTCTCTGTGTTGACCAGGCTGG + Intergenic
1027096503 7:75342130-75342152 TTTCTCTGTGTTGACCAGGCTGG + Intergenic
1027322843 7:77025547-77025569 TTTCTCTGTGTTGACCAGGCTGG - Intergenic
1027405274 7:77854309-77854331 TCTCTGTCTGCTGAGCTGCCTGG + Intronic
1027524191 7:79245910-79245932 TCTTTCTGTGCTGGGCTGCCTGG - Intronic
1027674825 7:81143969-81143991 TCTCCATGTGCTGAGCAGCCTGG - Intergenic
1027826209 7:83119299-83119321 TCTCTCTGTGCTGGGCTGCATGG - Intronic
1027921402 7:84399911-84399933 TCTCTCTATGCTAAGATGCCTGG - Intronic
1028022479 7:85793210-85793232 TCTCTCCATGCTCAGCTGCCTGG - Intergenic
1028181598 7:87730847-87730869 TCTCTCTGTGCTGAGCTGCCTGG - Intronic
1028207429 7:88033404-88033426 TCATTCTGTGCTGGGCTGCCTGG + Intronic
1028354224 7:89886956-89886978 TCTCTCTGTGCTGAGCTGTCTGG + Intergenic
1028521890 7:91741646-91741668 TTTCTCTGTTCTGAGCCACCTGG + Intronic
1028950466 7:96629990-96630012 TCTCTCTGTTCTGAGCCACCTGG + Intronic
1029410764 7:100408782-100408804 TTCCTCTGTGCTGATCTCCCAGG - Intronic
1029825413 7:103187399-103187421 TTTCTCTGTGCTAAGCTACCTGG - Intergenic
1030222565 7:107111510-107111532 TCTCTGTGTTTTGAGCTGCCTGG - Intronic
1030662819 7:112239514-112239536 TCTCTCCATGCTGAGCTGTCTGG - Intronic
1030881154 7:114882073-114882095 TTTCTCTGTGATGAGCCACCTGG + Intergenic
1030966411 7:115997219-115997241 TCTCTGTGTGCTGAGCTACCTGG - Intronic
1031098595 7:117449534-117449556 TCTCTCTGTGCTGAGCCACCTGG - Intergenic
1031215362 7:118883344-118883366 TCTCTCTCTGCTGAGCTTCCTGG - Intergenic
1031260185 7:119507894-119507916 TCTCTCTGTGCTGAGCTGCCTGG - Intergenic
1031412395 7:121456193-121456215 TTTCTTCATGCTGAGCTTCCTGG + Intergenic
1031546058 7:123052866-123052888 TCTCTTTCTGCTGAGCTGCCTGG + Intergenic
1031565990 7:123297237-123297259 TCTTTCTGTGCTGAGCTGCCTGG - Intergenic
1031753930 7:125613362-125613384 CCTCTCTGTGCTGAGCTTCATGG - Intergenic
1031905940 7:127459360-127459382 TCTTTCTGTGCTGAGCTGCCTGG - Intergenic
1031996561 7:128235795-128235817 TATGTTTGTGCTGATCTGCCTGG - Intergenic
1032138671 7:129306962-129306984 TGTCTCTGTGCTGAACTGCCTGG + Intronic
1032942555 7:136811259-136811281 TCTCTCTGTGCTAAGCTGCCTGG - Intergenic
1033049672 7:137992827-137992849 TTTCTCTGTCCTTACCTGCAGGG - Intronic
1033541869 7:142365009-142365031 TCTCTCTCTGCTGAACTACCTGG + Intergenic
1033813955 7:145050550-145050572 TCTTTCTGTGCTGAGCTACCTGG + Intergenic
1033877551 7:145841804-145841826 TCTTTCTGTGCTGAGCTGCTTGG + Intergenic
1033950772 7:146781621-146781643 TTACTGTTTGCTGAACTGCCTGG - Intronic
1034398187 7:150843148-150843170 TCTCTCTGTGTTGAGCTGTCTGG - Intronic
1035097386 7:156366407-156366429 TTCCTTTGTGCTGAGCTGACAGG + Intergenic
1035550922 8:524084-524106 TCTGTCTGTGCTGAACTGCTGGG - Intronic
1036107397 8:5855819-5855841 TTTCTCTGTCCTGTTTTGCCAGG + Intergenic
1036280320 8:7394544-7394566 TTCCTCTGTGCTGAGCAGGCTGG + Intergenic
1036341207 8:7917339-7917361 TTCCTCTGTGCTGAGCAGGCTGG - Intergenic
1036488845 8:9205641-9205663 TTTCACTGTGCTGATCAGGCTGG - Intergenic
1036751567 8:11446830-11446852 TGCCTCTTTGCTGAGGTGCCAGG + Intronic
1036991267 8:13598306-13598328 TTGCCCTGTGCTGAGCAGCCTGG + Intergenic
1037209870 8:16374093-16374115 TTTATCTGTGTTGAGTTTCCTGG + Intronic
1037277211 8:17193397-17193419 TCTCTCTCTGCTGAGCTGCCGGG + Intronic
1037369804 8:18163472-18163494 TCTCTCTGTGTTGTGCTGCCTGG - Intergenic
1040483589 8:47849742-47849764 GTGCTCTGTGCTGAGCACCCAGG + Intronic
1041311271 8:56519341-56519363 CTTTTCTGTGCTGAGCTGTCTGG + Intergenic
1041492344 8:58448367-58448389 TTTCTCTGTGTTGATCAGGCTGG + Exonic
1041500277 8:58532857-58532879 TGTGTGTGTGCTGAGCTGCCTGG + Intergenic
1041607040 8:59793500-59793522 CCTCTCTGGGCTGAGCTGCCTGG - Intergenic
1041616153 8:59908281-59908303 TCTCTCTGTGGTGAGCTGCCTGG - Intergenic
1041770650 8:61469131-61469153 TTTCTCTGGGCTGAGATCACAGG + Intronic
1041883241 8:62778061-62778083 TCTGTATATGCTGAGCTGCCTGG + Intronic
1041947318 8:63460498-63460520 TCTCTCCATGCTGTGCTGCCTGG + Intergenic
1042281249 8:67058806-67058828 TTTCTCTGTGTTGGCCTGGCTGG - Intronic
1042428294 8:68673916-68673938 TTGCTGTGTGTTGAGCTGCCTGG - Intronic
1042691910 8:71509024-71509046 TTTCTCTGTGCTGTCCAGGCTGG - Intronic
1042980365 8:74519455-74519477 TGTGTGTGTGTTGAGCTGCCTGG - Intergenic
1043015852 8:74940126-74940148 TCTCTCTGTGCTGAGCTGCCTGG + Intergenic
1043215054 8:77574769-77574791 TCTCTCTGTACTGAGCTGTCTGG - Intergenic
1043310597 8:78854426-78854448 TGGCTCTGTGCTGAACTGCAGGG + Intergenic
1043323255 8:79017512-79017534 TCTCTCTGTGCTAAGCTCCCTGG + Intergenic
1043567456 8:81563063-81563085 TCTCTGTGTGCTGAGCTGCCTGG - Intergenic
1043998120 8:86843837-86843859 TCTTTCTGTGCTGAGCTGCCTGG - Intergenic
1044026123 8:87174932-87174954 CCTCTCTGTGCTGAGCTGCCTGG + Intronic
1044066351 8:87704273-87704295 TCTCTCTGTGCTGAGCTGCCTGG - Intergenic
1044124376 8:88438805-88438827 TTTCTCCATACTGAGCTGCTGGG - Intergenic
1044635374 8:94319111-94319133 TCTCTCTCTGCTGAGCTACCTGG + Intergenic
1044878076 8:96692469-96692491 TCTGTCTATGCTGAGCTGCCTGG - Intronic
1045041186 8:98226617-98226639 TCTCTCTGTCCTGAATTGCCTGG + Intronic
1045172068 8:99682614-99682636 TTTCTCTGTACTGAGCTGCCTGG + Intronic
1045172409 8:99686218-99686240 TCTCTCTGTACTGAGCTGCCTGG + Intronic
1045592378 8:103612915-103612937 TCTCTCTGTGCTGAGCCACCTGG + Intronic
1045602322 8:103732304-103732326 TCTCTTTGTGCTGAGCTGCCTGG + Intronic
1045621336 8:103981216-103981238 TCTCTCTCTGCTGAGCTGCCTGG - Intronic
1046114040 8:109764588-109764610 TCTGTCTGTGCTGAGTTACCTGG + Intergenic
1046399981 8:113692124-113692146 TGTCTCTGTGCTGTGCTGCCTGG + Intergenic
1046557410 8:115791379-115791401 TTATTCTGTGCTGAGCTTCCTGG - Intronic
1047138238 8:122106414-122106436 TCTCTCTATGCTGAGCTGCCTGG + Intergenic
1047342658 8:123998419-123998441 TCTCTCTGTACTGAGTTGCCTGG + Intronic
1047352308 8:124087942-124087964 TCTTTCTGTGCTCAGCTTCCTGG + Intronic
1047901210 8:129423838-129423860 TCTCTCTGTGCTGAGCCATCTGG - Intergenic
1047929605 8:129713584-129713606 TGTCTCTGTCCGGAGCTGTCTGG - Intergenic
1048078946 8:131103537-131103559 TTTGTCTGTGCTAATTTGCCAGG + Intergenic
1048646767 8:136429069-136429091 TCTCTATGTGCTGAGCCACCTGG - Intergenic
1048706116 8:137155567-137155589 TCTTTCTGTGCTGAACTGGCTGG + Intergenic
1049280000 8:141739438-141739460 TCTCTCTGTGGTGAGCTGAGTGG - Intergenic
1050145315 9:2560796-2560818 TCTTTCTGTGCAGAGCTGCCTGG - Intergenic
1050248121 9:3713362-3713384 TTGCTATGAGCTGTGCTGCCTGG - Intergenic
1050312373 9:4366689-4366711 TGTCTTTGTTCTGAGCTGGCTGG + Intergenic
1050439132 9:5642245-5642267 TCTCTCTGTGCTGAGTCTCCTGG + Intronic
1050618501 9:7428660-7428682 TCTCTCTGTCCTGAGCTGCCTGG - Intergenic
1050644192 9:7701875-7701897 TCTCTCTATGTTGAGCTGCCTGG + Intergenic
1050722082 9:8601522-8601544 TCTCTGTGTGCTGAGCTGCCTGG - Intronic
1050925549 9:11259002-11259024 TTTCTCTGTTCTGTTCTGCTAGG + Intergenic
1051207523 9:14704114-14704136 TGTCTCTGTGCTATGCTGCTTGG - Intergenic
1051358959 9:16265111-16265133 TTTCCCTGGGCGGAGCTCCCAGG - Intronic
1051431253 9:16983256-16983278 TTTCCCTGCGCGGAGATGCCAGG + Intergenic
1052531587 9:29691807-29691829 TCTATCTGTGCTGTGCTGCCTGG - Intergenic
1052607554 9:30723763-30723785 TCTGTCTGTGCTGAGCTACCTGG - Intergenic
1052981998 9:34457091-34457113 TTTCTCTGAGCTGTGCTGGCTGG - Intronic
1053204590 9:36175088-36175110 TCTCTGTGTGTTGAGCCGCCTGG - Intergenic
1054982699 9:71224176-71224198 TCACTATGTGCTGAGCTGCCTGG - Intronic
1055283547 9:74702770-74702792 TCTCTCTGTGCTGCCCTGGCTGG - Intergenic
1055302169 9:74892821-74892843 TATCTCTGTGCTGAGCTACCTGG - Intergenic
1055387380 9:75776591-75776613 TCTCTCTGTGCTGAGTCACCTGG - Intergenic
1055579846 9:77697578-77697600 TCTCTTTGTGCTGTGCTGCTTGG + Intergenic
1055827124 9:80339934-80339956 TTTTTCTTTGCTGAGCTGCCTGG - Intergenic
1055886353 9:81068781-81068803 TTTCTCTGTGCTGAGACCCCTGG + Intergenic
1056230459 9:84538293-84538315 TCTCTTTGGGCTGAGCTGCCTGG + Intergenic
1056338942 9:85604253-85604275 TCTCTCTGTGCTGAGTTGCCTGG - Intronic
1056516866 9:87360213-87360235 TCTCTCTGTGCTGAGCTCCCTGG - Intergenic
1056808085 9:89744120-89744142 TTGCCCTGTGAAGAGCTGCCTGG + Intergenic
1057208610 9:93187510-93187532 TCTCTCTGTGCTGATCTGAGAGG + Intronic
1057288950 9:93788158-93788180 TCTCTCTCTGCTGAGCCACCTGG + Intergenic
1057644556 9:96860406-96860428 TCTCTTTGTGCTAGGCTGCCTGG - Intronic
1057896594 9:98913862-98913884 CTTATCTGTGCTGGGATGCCTGG + Intergenic
1058046984 9:100367509-100367531 TTTCTCTGTCCTGTTCTGCAAGG + Intergenic
1059029383 9:110674805-110674827 TTTCTCTGTGCTGCCCAGCCTGG + Intronic
1059041891 9:110823404-110823426 TCTCTCTGTGCTGAGCTGCCTGG - Intergenic
1059299668 9:113302267-113302289 TTTATCTGTGCTGCTCTCCCAGG + Intronic
1059384493 9:113953776-113953798 ACTCTCTGTGCTGGGCTGTCTGG + Intronic
1059839210 9:118192648-118192670 TCTCTCCATGCTGAGCTGCCTGG - Intergenic
1060189575 9:121583531-121583553 TTTCTCTGTGGTGAGACCCCTGG + Intronic
1061460047 9:130730235-130730257 TTTCTCTGTGTTGATCAGGCTGG + Intronic
1061638399 9:131930017-131930039 TCTCTCTGTGCTAAGCCACCTGG - Intronic
1061943970 9:133898154-133898176 CTTCTCTGTGCTTTGCAGCCCGG - Intronic
1062405667 9:136395115-136395137 CTGCTCTGCGCTGGGCTGCCAGG - Intronic
1062525110 9:136975062-136975084 TTGCTCTGAGCTTGGCTGCCAGG - Intergenic
1062753353 9:138272767-138272789 TTTCTCTGTGCTGGTCAGGCTGG + Intergenic
1203424444 Un_GL000195v1:24590-24612 TATCTCTGTGCTCATCAGCCAGG - Intergenic
1203575865 Un_KI270745v1:7546-7568 TTTCTCTGTGCTGGTCAGGCTGG + Intergenic
1186691900 X:11986179-11986201 TCTCTCTGTGCTGAGCCTCCTGG - Intergenic
1186835757 X:13436170-13436192 TTTCTTTGTGCTGTGCTGGAGGG + Intergenic
1187132891 X:16519080-16519102 TGTCTCTTTGCTGAGCTGCCTGG - Intergenic
1187205100 X:17174577-17174599 GTTCTCTGTTCTGAGCTGTCAGG + Intergenic
1187205364 X:17176440-17176462 GTTCTCTGCTCTGAGCTGTCAGG - Intergenic
1187612987 X:20962040-20962062 TCTCTTTGTGCTAAGCTGCCTGG - Intergenic
1187636736 X:21237789-21237811 TCTCTCTTTGCTGAGCCACCTGG - Intergenic
1187836322 X:23435650-23435672 TTTCTCTGTGCTGAGCTGCCTGG - Intergenic
1187889378 X:23920017-23920039 TCTTTCTGTACTGAGCAGCCTGG + Intronic
1188078394 X:25807128-25807150 TGTCTCTGTTCTGAGCTGCCAGG + Intergenic
1188192073 X:27183182-27183204 TCTCTCTGTGCTGAGCTGGCTGG - Intergenic
1188421006 X:29991215-29991237 TGTCTCTGTGCTAAACTGCCTGG + Intergenic
1188650887 X:32631191-32631213 TCTCTCTGTGATGAGCTGCCTGG + Intronic
1188996206 X:36888485-36888507 TCTCTTTCTGCTGAGCTGCCTGG - Intergenic
1188998981 X:36922868-36922890 TTTCTCTGTGCTGAGCTGCTTGG + Intergenic
1189013319 X:37069992-37070014 TTTCTCTATGCTGTTTTGCCTGG + Intergenic
1189411765 X:40779173-40779195 TCTCTCTGTGCTGAGCTGCCTGG + Intergenic
1189640911 X:43068897-43068919 TTTCTCTGTGGTGAGCCTCCTGG - Intergenic
1189769950 X:44416053-44416075 TCTCTCTGTTCTGAGCCACCTGG + Intergenic
1189854314 X:45208783-45208805 TCTCTCTGTGCTGAGCTGCCTGG + Intergenic
1189874232 X:45419717-45419739 TCTCTGTATGCTGAGCTGCCTGG + Intergenic
1189875567 X:45433121-45433143 CCTCTCTGTACTGAGCTGCCTGG + Intergenic
1190015250 X:46820654-46820676 TCTCTCTGTTCTGAGCTGCTTGG - Intergenic
1190037931 X:47042987-47043009 TCTCTCTGTGCTGAGTTGCCTGG - Intronic
1190056835 X:47186082-47186104 TTTCTCTGCGTTCAGCTGCACGG - Exonic
1190368050 X:49716242-49716264 ACTCTCTGTGCTGAGCTGTCTGG + Intergenic
1190374221 X:49773990-49774012 TCTTTTTGTGCTGAGCCGCCTGG + Intergenic
1190456903 X:50635617-50635639 TTTCTCGGTGCTGCAATGCCGGG + Exonic
1190602591 X:52108038-52108060 AGTCTCTGTGCTGAGCTGCCTGG + Intergenic
1191022564 X:55878142-55878164 TCTCTCTGTGCTGTGATGCCTGG + Intergenic
1191080003 X:56499681-56499703 TCTCTCCACGCTGAGCTGCCTGG - Intergenic
1191116647 X:56859907-56859929 TCTATCTGTGCTTAGCTGCCTGG + Intergenic
1191145032 X:57156751-57156773 TCTCTCTGTGCTGGGCTGCCTGG + Intergenic
1191188439 X:57638958-57638980 TGTCTCTATTCTGAGCTGTCTGG - Intergenic
1191657508 X:63614065-63614087 CTTCTCTCTTCTGAGCTGGCTGG - Intergenic
1191781671 X:64874798-64874820 TATCTCTGTGCTAAGCCACCTGG - Intergenic
1191810055 X:65176483-65176505 TTGCTCTCTTCAGAGCTGCCAGG - Intergenic
1191813472 X:65217084-65217106 TCTCTCAGTGCTGAGCTGCCTGG - Intergenic
1191827026 X:65376557-65376579 TCTCTCTTTGCTGAGCTGCTTGG - Intronic
1191991122 X:67038337-67038359 TCTCTTTGTGCTGAGGTGCCTGG + Intergenic
1192020510 X:67385927-67385949 TCTCTCTGTGATGAGCTGCCTGG - Intergenic
1192062270 X:67839514-67839536 TATCTCTGTTCTGAGCCCCCTGG - Intergenic
1192374996 X:70550037-70550059 TTCCACTATGTTGAGCTGCCTGG - Intronic
1192505528 X:71679882-71679904 TCTCTCTGTGCTGAGACACCTGG + Intergenic
1192677954 X:73219560-73219582 TCTCTCTGGGCTGCACTGCCTGG - Intergenic
1192836242 X:74802344-74802366 TCTCTCTGTTCTGAGCCACCTGG - Intronic
1192839066 X:74835625-74835647 TGTCTCTGAGCTGAGCTGTCTGG + Intronic
1192841288 X:74858300-74858322 TCTTTCTGTGCTGAGCTGCCTGG - Intronic
1192858388 X:75039266-75039288 TCTCTCCGTGCTGAACTGCCTGG + Intergenic
1192891037 X:75390488-75390510 TCTTTCTGTGCTGAGCTGCCTGG - Intronic
1192940984 X:75911722-75911744 TTTCTCTGTGCTGAGCTGCCTGG + Intergenic
1192958678 X:76103534-76103556 TCTCTCTATGTTGAGCTGCCTGG + Intergenic
1193052298 X:77114656-77114678 TCTCTCTGTGCTGAGCTTCCTGG + Intergenic
1193092684 X:77511076-77511098 TCTGTCTGTGCTAAGCTGTCTGG - Intronic
1193098447 X:77579433-77579455 TCTCTCTGTGCTGAGTTGCCTGG - Intronic
1193191031 X:78571892-78571914 ACTCTCTTTGCTGAGCTGCCTGG + Intergenic
1193193054 X:78596205-78596227 TCTCTCTGTGCTGAGATCCCTGG + Intergenic
1193214014 X:78840770-78840792 TTTTTCTGTGCTGAGCTGCCTGG - Intergenic
1193252658 X:79309830-79309852 TCTCTCTGTTCTGAGCTGCCTGG - Intergenic
1193280245 X:79640790-79640812 TTTCTCTTTGCTGAGCTGCCTGG + Intergenic
1193329844 X:80223671-80223693 TCTCTCTATGCTGGGCTGTCTGG + Intergenic
1193441157 X:81540063-81540085 TCTCCCTGTGCTGAGCTGCCTGG - Intergenic
1193529633 X:82641631-82641653 TCTTTCTGTGATGAGCTGCCTGG + Intergenic
1193563291 X:83047019-83047041 TCTCCCTGTGCTGAGCTGCCTGG + Intergenic
1193580588 X:83258780-83258802 TCTGTCTGTGCTGAGCCACCTGG - Intergenic
1193650422 X:84123973-84123995 TATCTCTGTGCTGAGCCACCTGG - Intronic
1193664708 X:84300868-84300890 TCTCTCTGTTCTGAGCTACCTGG - Intergenic
1193676182 X:84454854-84454876 TCTCTGTGTGCTGAGCCGCCTGG - Intronic
1193742456 X:85233079-85233101 TCTCTCTGTGCTGAGCTGCCTGG - Intergenic
1193894928 X:87101164-87101186 TTTCTCTGTGCTGAGACACCTGG - Intergenic
1193899521 X:87160780-87160802 TCTGTCTGTGCTGAGTTGCCTGG + Intergenic
1193911882 X:87316405-87316427 TCTCTATGTTCTGAGCTGGCTGG + Intergenic
1193931905 X:87562900-87562922 TTTCTCTGTGTTGAGCTGCCTGG - Intronic
1193986714 X:88251975-88251997 TTTCTCTCTACTGAGCTGCCTGG + Intergenic
1193989345 X:88286140-88286162 TCTCTCTGTGCTGAGCTGCCTGG - Intergenic
1194016356 X:88625771-88625793 TCTCTGTGTTCTTAGCTGCCTGG - Intergenic
1194036973 X:88886974-88886996 TCTCTCTCTGTCGAGCTGCCTGG + Intergenic
1194095987 X:89638849-89638871 TCTCTCTGTGCTGAGCCGCCTGG - Intergenic
1194110323 X:89825217-89825239 TCTCTCTGTGCTGAGTTGCTTGG - Intergenic
1194323089 X:92476959-92476981 GCTCTCTGTTCTGAGCTGCCTGG + Intronic
1194327603 X:92539917-92539939 TCTCTGTGTGCTGAGCCACCTGG + Intronic
1194387892 X:93278956-93278978 TCTCTCTGTGCTGAGCTTCCTGG - Intergenic
1194486529 X:94493179-94493201 TTTCTCTGTCCTGTTCTGCTAGG - Intergenic
1194500775 X:94678725-94678747 TCTCTTTGTGCTGAGCTGCCTGG + Intergenic
1194526604 X:94984322-94984344 TCTCTCTGTGCTGAGTCACCTGG - Intergenic
1194692801 X:97008785-97008807 ATTCTGTGTGCTGAGCTACCTGG + Intronic
1194787513 X:98105667-98105689 TCTCTCTGATCTGAGCTACCTGG + Intergenic
1194796000 X:98211361-98211383 TCTGTCTGTGCTGAGCCACCTGG - Intergenic
1194841877 X:98753460-98753482 TGTCCCTGTGCTGAGCCACCTGG + Intergenic
1194877439 X:99207598-99207620 TCTCTCAGTGCTGAGCTTCCTGG + Intergenic
1194947369 X:100085073-100085095 TTTCTCTGTACTCAGCTACATGG - Intergenic
1194989967 X:100536854-100536876 TTGCTCTGTGCTGAGCTGGGGGG + Intergenic
1195037016 X:100979958-100979980 TCTCTCTGTGCTGAGCTGCCTGG + Intronic
1195115882 X:101697143-101697165 TCTCTCTATTCTGAGCTGCCTGG - Intergenic
1195455402 X:105063905-105063927 CTTCTCTGTGCTGAGCCACCTGG + Intronic
1195543225 X:106086959-106086981 TCTGTCTGTGCTGAACTGCCTGG + Intergenic
1195782913 X:108484660-108484682 TCTCTCTGTGGTGAGCCACCTGG + Intronic
1196182017 X:112703222-112703244 TTCTGCTGTGCTGAGCTACCTGG + Intergenic
1196215963 X:113051477-113051499 TCTCTCTTTGCTGAGCCACCTGG - Intergenic
1196217481 X:113071225-113071247 TCTCTGTGTGCTGGGCTGCCTGG + Intergenic
1196233700 X:113255109-113255131 TATCACCGTGCTGAGCTTCCTGG + Intergenic
1196238871 X:113316816-113316838 TTTCTTTGTGCTGAACTGGGGGG - Intergenic
1196247503 X:113416389-113416411 TCTCTCTGTTCTGAGCCACCTGG - Intergenic
1196248541 X:113429403-113429425 TCTTTCTGTGCTGAGCTGCCTGG - Intergenic
1196269744 X:113697452-113697474 CTGCTCTGTTCAGAGCTGCCAGG + Intergenic
1196269963 X:113698997-113699019 TATCTCTCTGCTGAGTTGCCTGG + Intergenic
1196368850 X:114952739-114952761 TTTCTTTGTGTTGGGCTGCCTGG - Intergenic
1196532442 X:116805476-116805498 TTTTTCTGTGCTGAGACACCTGG + Intergenic
1196535327 X:116837577-116837599 TATCTCTGTTCTGAGCCACCTGG + Intergenic
1196552597 X:117046293-117046315 TTTCTCTCTGCTGAGCCACCTGG - Intergenic
1196619727 X:117807759-117807781 TCTCTCTATGTTGAGCTGCCTGG - Intergenic
1196962002 X:121013949-121013971 TCTCTCTGTGCTGCACTGCCTGG + Intergenic
1197025110 X:121738604-121738626 TCTGTCTGTGCTGAGCTGCCTGG - Intergenic
1197099456 X:122635973-122635995 TCCGTGTGTGCTGAGCTGCCTGG + Intergenic
1197129771 X:122991678-122991700 CTTCTCTGTGCTGAGCAAGCAGG + Intergenic
1197400008 X:125978490-125978512 TCTCTCCATGCTGAGCTGCCTGG - Intergenic
1197403190 X:126018856-126018878 TCTCTCTGTGCTGAGCCACCTGG + Intergenic
1197439436 X:126471672-126471694 CCTCTCTCTGCTGAGCTTCCTGG - Intergenic
1197458083 X:126702307-126702329 TGTCTCTGTGCTGAGCTACCTGG - Intergenic
1197514559 X:127410429-127410451 TCTCTCTGTACTGAGCTGCCTGG + Intergenic
1197537614 X:127709101-127709123 TCTCTCCTTGCTGAGCTGCCTGG - Intergenic
1197623435 X:128778404-128778426 TTTATTTGTGCTGAGTTGCCTGG + Intergenic
1197876427 X:131114034-131114056 TCTCTCTGTTCTGAGCCACCTGG + Intergenic
1198515092 X:137399599-137399621 TCTCTCTGTTCTGAGCCACCTGG + Intergenic
1198697112 X:139354305-139354327 TTCCTCTCTGCTGAGATGCCTGG + Intergenic
1198702450 X:139413129-139413151 TCTTTCTGTTCTGAGCTACCTGG + Intergenic
1198810721 X:140533680-140533702 TTTCTCTGTGCTGACATATCAGG + Intergenic
1198964523 X:142214043-142214065 TCTCTCTGTGTGGAGCTGCCTGG + Intergenic
1199037164 X:143064541-143064563 TCTCTCTGTGCTGGGCCACCAGG - Intergenic
1199135474 X:144244645-144244667 TCTCTCTGTTCTGAGCCACCTGG - Intergenic
1199189071 X:144949625-144949647 TCTTTCTGTGATGAGCTGCCTGG - Intergenic
1199223252 X:145341121-145341143 TCTCTCTCTGATGAGCTTCCTGG - Intergenic
1199277735 X:145965340-145965362 TCTCTCTCTGCTGAGCCACCTGG - Intergenic
1199316168 X:146380138-146380160 CCTCTCTTTTCTGAGCTGCCTGG - Intergenic
1199334224 X:146599946-146599968 TCTCTCTGTTCTGAGCCACCTGG + Intergenic
1199393770 X:147310253-147310275 TTTCTCTGTGCTGAGCCACCTGG - Intergenic
1199442950 X:147889429-147889451 TCTCTCTGTTCTAAGCTACCTGG + Intergenic
1199455075 X:148019765-148019787 TCTCTCTGGACTGAGCTGCCTGG + Intronic
1199457286 X:148043595-148043617 TCTCTCTGTGATGAGCTGCCAGG + Intergenic
1199485206 X:148339092-148339114 TCTCTCTGTGCTGATCCACCTGG - Intergenic
1199845386 X:151688998-151689020 TGTATCTGTGCTGAGCTGCCTGG - Intergenic
1200134206 X:153867026-153867048 AGTCCCTGGGCTGAGCTGCCTGG - Intronic
1200369886 X:155714527-155714549 TTTCTCTGTGTTGAGCCACCTGG + Intergenic
1200448990 Y:3300232-3300254 TCTTTCTGTGCTGAGCCGCCTGG - Intergenic
1200462985 Y:3479958-3479980 TCTCTCTGTGCTGAGTTGCTTGG - Intergenic
1200631188 Y:5590116-5590138 GCTCTCTGTTCTGAGCTGCCTGG + Intronic
1200636316 Y:5659135-5659157 TCTCTGTGTGCTGAGCCACCTGG + Intronic