ID: 1187836323

View in Genome Browser
Species Human (GRCh38)
Location X:23435663-23435685
Sequence CACAGAGAAAGAGACTGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187836321_1187836323 -4 Left 1187836321 X:23435644-23435666 CCAACTCCAGGCAGCTCAGCACA 0: 6
1: 70
2: 181
3: 302
4: 721
Right 1187836323 X:23435663-23435685 CACAGAGAAAGAGACTGTTTAGG No data
1187836317_1187836323 24 Left 1187836317 X:23435616-23435638 CCACAGGAGTGCGTCTATCACCA No data
Right 1187836323 X:23435663-23435685 CACAGAGAAAGAGACTGTTTAGG No data
1187836322_1187836323 -10 Left 1187836322 X:23435650-23435672 CCAGGCAGCTCAGCACAGAGAAA 0: 7
1: 71
2: 190
3: 340
4: 673
Right 1187836323 X:23435663-23435685 CACAGAGAAAGAGACTGTTTAGG No data
1187836320_1187836323 -3 Left 1187836320 X:23435643-23435665 CCCAACTCCAGGCAGCTCAGCAC 0: 5
1: 73
2: 194
3: 307
4: 802
Right 1187836323 X:23435663-23435685 CACAGAGAAAGAGACTGTTTAGG No data
1187836319_1187836323 4 Left 1187836319 X:23435636-23435658 CCACTGTCCCAACTCCAGGCAGC No data
Right 1187836323 X:23435663-23435685 CACAGAGAAAGAGACTGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187836323 Original CRISPR CACAGAGAAAGAGACTGTTT AGG Intergenic
No off target data available for this crispr