ID: 1187839430

View in Genome Browser
Species Human (GRCh38)
Location X:23471517-23471539
Sequence AAGTAGTAACAGAATGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187839424_1187839430 17 Left 1187839424 X:23471477-23471499 CCCACCATCTATTTCCTGTCTGA No data
Right 1187839430 X:23471517-23471539 AAGTAGTAACAGAATGAAGCAGG No data
1187839429_1187839430 -8 Left 1187839429 X:23471502-23471524 CCTTTCTGATAAAGAAAGTAGTA No data
Right 1187839430 X:23471517-23471539 AAGTAGTAACAGAATGAAGCAGG No data
1187839428_1187839430 -7 Left 1187839428 X:23471501-23471523 CCCTTTCTGATAAAGAAAGTAGT No data
Right 1187839430 X:23471517-23471539 AAGTAGTAACAGAATGAAGCAGG No data
1187839427_1187839430 3 Left 1187839427 X:23471491-23471513 CCTGTCTGAACCCTTTCTGATAA No data
Right 1187839430 X:23471517-23471539 AAGTAGTAACAGAATGAAGCAGG No data
1187839423_1187839430 27 Left 1187839423 X:23471467-23471489 CCACTTGGAGCCCACCATCTATT No data
Right 1187839430 X:23471517-23471539 AAGTAGTAACAGAATGAAGCAGG No data
1187839426_1187839430 13 Left 1187839426 X:23471481-23471503 CCATCTATTTCCTGTCTGAACCC No data
Right 1187839430 X:23471517-23471539 AAGTAGTAACAGAATGAAGCAGG No data
1187839425_1187839430 16 Left 1187839425 X:23471478-23471500 CCACCATCTATTTCCTGTCTGAA No data
Right 1187839430 X:23471517-23471539 AAGTAGTAACAGAATGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187839430 Original CRISPR AAGTAGTAACAGAATGAAGC AGG Intergenic
No off target data available for this crispr