ID: 1187841031

View in Genome Browser
Species Human (GRCh38)
Location X:23488258-23488280
Sequence GCAGATATACAAATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187841029_1187841031 -7 Left 1187841029 X:23488242-23488264 CCTAAATTTTTACAAAGCAGATA No data
Right 1187841031 X:23488258-23488280 GCAGATATACAAATGGACAATGG No data
1187841028_1187841031 3 Left 1187841028 X:23488232-23488254 CCTAAATAGACCTAAATTTTTAC No data
Right 1187841031 X:23488258-23488280 GCAGATATACAAATGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187841031 Original CRISPR GCAGATATACAAATGGACAA TGG Intergenic
No off target data available for this crispr