ID: 1187844792

View in Genome Browser
Species Human (GRCh38)
Location X:23524338-23524360
Sequence TGCCATTGCTGTTGTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187844792_1187844806 13 Left 1187844792 X:23524338-23524360 CCATCCCCACAACAGCAATGGCA No data
Right 1187844806 X:23524374-23524396 ATCTCTGGGCACTGGGGGATGGG No data
1187844792_1187844803 7 Left 1187844792 X:23524338-23524360 CCATCCCCACAACAGCAATGGCA No data
Right 1187844803 X:23524368-23524390 GAGAGCATCTCTGGGCACTGGGG No data
1187844792_1187844799 -2 Left 1187844792 X:23524338-23524360 CCATCCCCACAACAGCAATGGCA No data
Right 1187844799 X:23524359-23524381 CAGGGTGTGGAGAGCATCTCTGG No data
1187844792_1187844801 5 Left 1187844792 X:23524338-23524360 CCATCCCCACAACAGCAATGGCA No data
Right 1187844801 X:23524366-23524388 TGGAGAGCATCTCTGGGCACTGG No data
1187844792_1187844802 6 Left 1187844792 X:23524338-23524360 CCATCCCCACAACAGCAATGGCA No data
Right 1187844802 X:23524367-23524389 GGAGAGCATCTCTGGGCACTGGG No data
1187844792_1187844800 -1 Left 1187844792 X:23524338-23524360 CCATCCCCACAACAGCAATGGCA No data
Right 1187844800 X:23524360-23524382 AGGGTGTGGAGAGCATCTCTGGG No data
1187844792_1187844804 8 Left 1187844792 X:23524338-23524360 CCATCCCCACAACAGCAATGGCA No data
Right 1187844804 X:23524369-23524391 AGAGCATCTCTGGGCACTGGGGG No data
1187844792_1187844805 12 Left 1187844792 X:23524338-23524360 CCATCCCCACAACAGCAATGGCA No data
Right 1187844805 X:23524373-23524395 CATCTCTGGGCACTGGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187844792 Original CRISPR TGCCATTGCTGTTGTGGGGA TGG (reversed) Intergenic
No off target data available for this crispr