ID: 1187852208

View in Genome Browser
Species Human (GRCh38)
Location X:23602203-23602225
Sequence TTGTGAAAGGGGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187852208_1187852214 2 Left 1187852208 X:23602203-23602225 CCTTCCTCCATCCCCTTTCACAA No data
Right 1187852214 X:23602228-23602250 TCTGTCAATTTACAAAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187852208 Original CRISPR TTGTGAAAGGGGATGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr