ID: 1187854706

View in Genome Browser
Species Human (GRCh38)
Location X:23625584-23625606
Sequence AAATTGAAACAGTTTTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187854706_1187854710 10 Left 1187854706 X:23625584-23625606 CCAGGGGAAAACTGTTTCAATTT No data
Right 1187854710 X:23625617-23625639 CAGATGGATACTCAACAAAGAGG No data
1187854706_1187854707 -6 Left 1187854706 X:23625584-23625606 CCAGGGGAAAACTGTTTCAATTT No data
Right 1187854707 X:23625601-23625623 CAATTTCCCAGTAACACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187854706 Original CRISPR AAATTGAAACAGTTTTCCCC TGG (reversed) Intergenic
No off target data available for this crispr