ID: 1187856000

View in Genome Browser
Species Human (GRCh38)
Location X:23636761-23636783
Sequence ACTTGGCTCCCTTTGTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187856000_1187856004 13 Left 1187856000 X:23636761-23636783 CCCAAAGACAAAGGGAGCCAAGT No data
Right 1187856004 X:23636797-23636819 GAGCCTGAAACTCGCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187856000 Original CRISPR ACTTGGCTCCCTTTGTCTTT GGG (reversed) Intergenic
No off target data available for this crispr