ID: 1187857934

View in Genome Browser
Species Human (GRCh38)
Location X:23655056-23655078
Sequence CAGTTGTGCTGGAGGACAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187857934_1187857940 5 Left 1187857934 X:23655056-23655078 CCCCTTGTCCTCCAGCACAACTG No data
Right 1187857940 X:23655084-23655106 ACTCCCTCATCTGCTAACCAAGG No data
1187857934_1187857945 30 Left 1187857934 X:23655056-23655078 CCCCTTGTCCTCCAGCACAACTG No data
Right 1187857945 X:23655109-23655131 CCCAACACATATTGCCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187857934 Original CRISPR CAGTTGTGCTGGAGGACAAG GGG (reversed) Intergenic
No off target data available for this crispr