ID: 1187884325

View in Genome Browser
Species Human (GRCh38)
Location X:23875164-23875186
Sequence CACTTCAATCCAGGAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142759
Summary {0: 3, 1: 512, 2: 9337, 3: 41491, 4: 91416}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187884316_1187884325 17 Left 1187884316 X:23875124-23875146 CCTGTAGTCCCAGCTACTCGGGA 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
Right 1187884325 X:23875164-23875186 CACTTCAATCCAGGAGGCGGAGG 0: 3
1: 512
2: 9337
3: 41491
4: 91416
1187884320_1187884325 8 Left 1187884320 X:23875133-23875155 CCAGCTACTCGGGAGGCTGAGGC 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
Right 1187884325 X:23875164-23875186 CACTTCAATCCAGGAGGCGGAGG 0: 3
1: 512
2: 9337
3: 41491
4: 91416
1187884318_1187884325 9 Left 1187884318 X:23875132-23875154 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1187884325 X:23875164-23875186 CACTTCAATCCAGGAGGCGGAGG 0: 3
1: 512
2: 9337
3: 41491
4: 91416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187884325 Original CRISPR CACTTCAATCCAGGAGGCGG AGG Intronic
Too many off-targets to display for this crispr