ID: 1187885616

View in Genome Browser
Species Human (GRCh38)
Location X:23886165-23886187
Sequence GTAAATCAGAGGTTCTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187885616 Original CRISPR GTAAATCAGAGGTTCTCAGT GGG (reversed) Intronic
902068533 1:13711415-13711437 CACATTCAGAGGTTCTCAGTTGG + Intronic
902166594 1:14576926-14576948 GTGAATCAGATATTCACAGTGGG + Intergenic
902836978 1:19053750-19053772 GTGAAACAGAGGCTCACAGTGGG + Intergenic
904969421 1:34407435-34407457 GTAGTTCAGAGGTTCTCACAGGG + Intergenic
905508954 1:38503266-38503288 GTAAAACAGTGGTACTTAGTGGG - Intergenic
905622533 1:39461109-39461131 GTTAACCAGAGGTTTTCAGCTGG + Intronic
907893695 1:58662963-58662985 GCAAATAATAGGTTTTCAGTGGG - Intronic
909776405 1:79490222-79490244 GAAAATGAGAGGTTCTAAGAGGG + Intergenic
909934601 1:81536945-81536967 GCAAATATAAGGTTCTCAGTAGG + Intronic
911869921 1:103084260-103084282 GTATATAAGAGGTTGTCAGGGGG - Intronic
912261449 1:108114887-108114909 GTAAGTCAGTTGTTCTCAGCTGG + Intergenic
913280319 1:117179294-117179316 CTAAATCAGTGGTTCTCAGCTGG - Intronic
914799416 1:150949530-150949552 GAAAATCTGAGGCTCTCTGTAGG + Intronic
914987143 1:152470934-152470956 ATCAATCAGAGGTTCTGAGAAGG - Intergenic
915019945 1:152769679-152769701 CTAATTCAGTGGTTCTCAATGGG - Intronic
916050394 1:161032189-161032211 GCATATGAGAGGTACTCAGTAGG - Intronic
916923165 1:169490203-169490225 ATAAATCAGTGGTTCTCAATCGG + Intergenic
918333137 1:183479445-183479467 CTAAATCAGTGGTTCTCAACTGG - Intronic
918902717 1:190444654-190444676 GTAAATCCCAGGTACTCAGGAGG - Intronic
919050940 1:192510553-192510575 GGAAATAAGACATTCTCAGTGGG + Intergenic
919345228 1:196367399-196367421 GTAAATCAAAGGATCTTAGAAGG - Intronic
919677213 1:200395315-200395337 CTAAATCAGTGGTTCTCAGCTGG - Intergenic
921965217 1:221080769-221080791 GTAAGTCAGAGGGACTCTGTTGG - Intergenic
922053557 1:222018474-222018496 GAAAATCAGAGATTCTTATTTGG + Intergenic
922438654 1:225632200-225632222 GTAGAACAGTGGTTCTCAGCTGG + Intronic
923146692 1:231203531-231203553 CAAAACCAGTGGTTCTCAGTGGG + Intronic
924154911 1:241165956-241165978 GTAGATCTGAGGTTCTGAGGCGG - Intronic
924671093 1:246126197-246126219 TTAGATCAGTGGTTCTCACTGGG + Intronic
1063498452 10:6531309-6531331 CTAAATCAGTGGTTCTCAGAGGG + Intronic
1068786621 10:60982659-60982681 GTAAAACAGAGGTTCCCAATAGG - Intronic
1068872542 10:61960755-61960777 GTATATCATAGGTGCTCCGTAGG + Intronic
1069283443 10:66684120-66684142 CTAAACCAGCAGTTCTCAGTTGG + Intronic
1072356259 10:94614588-94614610 ATAGATCAGTGATTCTCAGTTGG + Intergenic
1072543247 10:96414314-96414336 GTGAATCAGAGGTGAGCAGTTGG - Intronic
1072566656 10:96621966-96621988 CTAAAGCAGTGGTTCTCAATTGG - Intronic
1072642940 10:97226906-97226928 CTAAATCAGTGGTTCTCATGTGG + Intronic
1073006000 10:100325272-100325294 CTAGACCATAGGTTCTCAGTGGG - Intronic
1073031737 10:100531535-100531557 GTAAATTAGTGGTTGCCAGTGGG - Intronic
1073832127 10:107396913-107396935 GCAAATTAGAGATTCACAGTAGG - Intergenic
1074503645 10:114047064-114047086 GTAAATCTGTAGCTCTCAGTAGG - Intergenic
1075306200 10:121369924-121369946 TTAAGTCAGTGGTTCTCACTAGG + Intergenic
1076263597 10:129091539-129091561 CCAAATCAGTGCTTCTCAGTGGG + Intergenic
1076462740 10:130657410-130657432 GAAAATCAGAGGAGCTCAGGTGG - Intergenic
1076495402 10:130893952-130893974 GCCAATCAGAGGTTTACAGTGGG - Intergenic
1077739105 11:4825460-4825482 GAAAATCAAAGGTTCTCTGTAGG - Intronic
1077837541 11:5937821-5937843 CTAAATCAGAGGTTGGCAGTTGG - Intronic
1078145625 11:8720159-8720181 CTAAAGCAGTGGTTCTCAGTTGG - Intronic
1079927361 11:26511204-26511226 CTAAGTCAGAGGTACACAGTTGG - Intronic
1080515858 11:33019336-33019358 TTAACCCAGTGGTTCTCAGTGGG - Intronic
1080635142 11:34117280-34117302 CTAAATCAGTGGTTCTCATCTGG + Intronic
1080703830 11:34669291-34669313 AAAAAGCAGAGGTTCTAAGTGGG + Intergenic
1082667787 11:55995357-55995379 TTTTATCAGAGGTTCTTAGTTGG + Intergenic
1084052685 11:66610864-66610886 TTAGATCAGTGGTTCTCAGTGGG + Intergenic
1084359639 11:68661136-68661158 GTAACACAGGGATTCTCAGTCGG - Intergenic
1088207826 11:107414627-107414649 GCAAATCAGAGGTTCTGTTTTGG - Intronic
1091166270 11:133479123-133479145 GCAAATCTGTGTTTCTCAGTTGG + Intronic
1092131410 12:6115868-6115890 GGAAACCAGGGGTTCTCAGTCGG - Intronic
1092703720 12:11261562-11261584 GTAAATCAGACTTTGTCAGATGG - Intergenic
1093669932 12:21861824-21861846 CTAAAGCAGAGGTTGTGAGTGGG + Intronic
1093728202 12:22540023-22540045 GTAAAACTGAGGTTCTAGGTAGG - Intronic
1097489862 12:60253354-60253376 GTAAATAAGCGGTTGTCAGTGGG - Intergenic
1098285404 12:68901969-68901991 GTAAAGTAGAGCTCCTCAGTTGG - Intronic
1098927480 12:76366916-76366938 GTAAATCCCAGCTACTCAGTTGG - Intronic
1099177228 12:79435920-79435942 TTAAAGCAGGGGTTCTCAGCGGG - Intronic
1099670764 12:85688999-85689021 ATAAAGCAGAGGTGTTCAGTAGG + Intergenic
1100675412 12:96861253-96861275 TTAAACCAGTGGTTCTCAATTGG + Intronic
1101040122 12:100747139-100747161 GTAAGTCAGTGGTTCTCAACTGG - Intronic
1102156378 12:110732498-110732520 TTAAATCAGAGATCCTCAGGAGG - Intronic
1102251188 12:111388547-111388569 GTAATTCCGGGGTTCTCAGGAGG + Intergenic
1102654704 12:114472042-114472064 CTAAAACAGTGATTCTCAGTGGG - Intergenic
1102725403 12:115060072-115060094 CTAGAACAGAGGTTCTCAATGGG + Intergenic
1102924657 12:116817538-116817560 GAAAATCAGAGGAACTGAGTAGG - Intronic
1102959753 12:117084918-117084940 GCAAACCAGAGGTGCTCAGAGGG - Intronic
1104168487 12:126257040-126257062 GTAAAGGAGAGCTTCTCAGAGGG - Intergenic
1104260539 12:127178040-127178062 GTATATCAGATATTCCCAGTGGG - Intergenic
1107684221 13:42880445-42880467 TAAAATCCGAGTTTCTCAGTGGG + Intergenic
1107896746 13:44972470-44972492 ATAAATCAGTGGTTGCCAGTGGG + Intronic
1110723710 13:78795294-78795316 TTAAAGCAATGGTTCTCAGTAGG + Intergenic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1112486958 13:99828577-99828599 AAAAATCAGATGTTCTCAGTGGG + Intronic
1112672344 13:101654620-101654642 GCAAATCAGTGGTTCTCCTTCGG + Intronic
1115119380 14:29922342-29922364 GTAAAGCAGAGTTTCTCTTTGGG + Intronic
1115809554 14:37091802-37091824 ATAACTCAGAGGCTTTCAGTGGG - Intronic
1118122520 14:62860996-62861018 GTCACTCAGAGGTTCCCAGAAGG + Intronic
1118354285 14:64999451-64999473 GTAAATTAGTGGTTAGCAGTGGG + Intronic
1119801204 14:77447144-77447166 GTAAATCACAGCTTCTCAGGAGG - Intronic
1119863035 14:77950712-77950734 TTAAATCAGTTGTTCTTAGTGGG + Intergenic
1122186991 14:100006871-100006893 GGAAATCAGAGATTCTCTGGAGG + Intronic
1124432356 15:29618512-29618534 GTGAATCTGAAGTTCTCAGCAGG + Intergenic
1124434839 15:29638432-29638454 GTAAAACAGTGGTTCTCAGCTGG - Intergenic
1127323013 15:57865874-57865896 TTAGATCAGAGGTTCTCAAATGG - Intergenic
1127429665 15:58891136-58891158 GTAACCCAGTGGTTCTCAATGGG + Intronic
1131396342 15:92089564-92089586 GCAAGTAGGAGGTTCTCAGTGGG + Intronic
1131910717 15:97197140-97197162 GTAGATCAGAGGATTTCAGAAGG + Intergenic
1134193685 16:12142044-12142066 CTAAAGCAGAGATTCTCACTGGG - Intronic
1134559975 16:15200199-15200221 TTAAACCAGTGGTTCTCAATAGG - Intergenic
1134920515 16:18111808-18111830 TTAAACCAGTGGTTCTCAATAGG - Intergenic
1135285231 16:21187572-21187594 CTAGATCAGCAGTTCTCAGTTGG + Intergenic
1135464883 16:22676688-22676710 CTAATTCAGTGGTTCTCAGTCGG - Intergenic
1135627675 16:24010397-24010419 GTAAACCGGAGGTTCACAGAAGG - Intronic
1139553513 16:67690607-67690629 ATAGTTCAGAGGTTCTCAGCTGG - Intronic
1140614902 16:76650252-76650274 CTAAATCGCAGGTTCTCTGTAGG - Intergenic
1141284612 16:82659958-82659980 CTAAAGCAGTGGTTCTCAATGGG - Intronic
1141338323 16:83178359-83178381 CTAAATCAGTGGTTCTCAACTGG - Intronic
1141743005 16:85906717-85906739 TTAACTCAGTGGTTCTCAGGTGG + Intronic
1143590029 17:7879119-7879141 ATAAATCAGTGGTTCTCAAATGG - Intronic
1144518578 17:15938614-15938636 TTATATCAGAGTTTCCCAGTAGG + Intergenic
1148961804 17:51399564-51399586 GTAAATCATAGCTTACCAGTTGG - Intergenic
1149472206 17:56926074-56926096 GGAAATCAGAGATTCTCTGGAGG - Intergenic
1149489515 17:57073003-57073025 CTAATTCAGAGGGTCCCAGTTGG - Intergenic
1150202523 17:63372148-63372170 GTAGACCAGAGGTTTTCAGGAGG - Intronic
1151185751 17:72362778-72362800 CTAAATCAGTGGTTCTCAACTGG + Intergenic
1153313895 18:3703266-3703288 GTGAATCAAAGGCTCTCAGTTGG - Intronic
1155111863 18:22723527-22723549 GCAAACCAAAGGTTATCAGTGGG + Intergenic
1158212640 18:55068199-55068221 ATAAATAAGTGGTTCTCAGCTGG - Intergenic
1158216923 18:55110185-55110207 GAAACTCAGAGGATCTGAGTAGG + Intergenic
1158283570 18:55853557-55853579 CTAAAACAGTGCTTCTCAGTTGG - Intergenic
1163943408 19:20515214-20515236 GTAAACCAGATGTCCTCAGCCGG + Intergenic
1165874823 19:38998839-38998861 CTAAAGCAGTGGTTTTCAGTTGG + Intronic
1168208415 19:54870139-54870161 GTAAATCTGAGATACTCAGGAGG + Intergenic
1168593938 19:57659141-57659163 GTAAATCAGGTGTTCATAGTAGG - Intergenic
928149678 2:28814714-28814736 TGCATTCAGAGGTTCTCAGTAGG + Intronic
928241924 2:29593946-29593968 TTAAATCAGTGCTTCTCACTGGG + Intronic
930491827 2:52083397-52083419 GTAAGTCAGAAGATCACAGTAGG - Intergenic
931158400 2:59661318-59661340 TTAGAGTAGAGGTTCTCAGTTGG - Intergenic
931607581 2:64067456-64067478 TTAGATCAGAGGTTCTCAACTGG + Intergenic
931801437 2:65762023-65762045 ATAGAACAGTGGTTCTCAGTTGG + Intergenic
935095042 2:99936175-99936197 ATGAATTAGAGGATCTCAGTTGG + Intronic
935109342 2:100077518-100077540 GAAAATCAGAAGTCCACAGTGGG - Intronic
936708446 2:115103127-115103149 CTAAAACAGGGGTTTTCAGTTGG + Intronic
939137019 2:138308856-138308878 GTAGGACAGTGGTTCTCAGTTGG - Intergenic
939329898 2:140744019-140744041 CTAAAACAGTGGTTATCAGTGGG + Intronic
940343311 2:152603442-152603464 GTAACGCACATGTTCTCAGTAGG + Intronic
940584096 2:155622202-155622224 GTAGTTCAGTGGTTCTCAATAGG + Intergenic
941766456 2:169302424-169302446 CTAAATCAGTGGTTCTCAACTGG + Intronic
943008108 2:182411627-182411649 CTAAATCAATGGTTCTCAATTGG + Intronic
943611112 2:190035607-190035629 ATAAATCAGTGGTTTTCAGGAGG - Intronic
943744134 2:191443623-191443645 TTAAATTAGTGGTTCTCAGCTGG + Intergenic
944195561 2:197049736-197049758 GTAAATCCTAGATTCTCAGGAGG - Intronic
945220513 2:207478834-207478856 GTAAGACAGTGGTTCTCAATGGG + Intergenic
948471942 2:238187996-238188018 GTACATCAGTGATTCTCAGCTGG - Intronic
1169159291 20:3362736-3362758 TTAAGTCAGTGGTTCTCAGTCGG - Intronic
1169720415 20:8670063-8670085 TAAAATTAGAGGTTCTCAGAGGG - Intronic
1170333073 20:15236933-15236955 CTAAACCAGTGGTTCTCAGTGGG + Intronic
1172179448 20:32992284-32992306 CTAAATCAGTGGTTCTCAATTGG - Intronic
1173171179 20:40725134-40725156 GTACATCATAGGTTCTCCATAGG + Intergenic
1173216161 20:41086395-41086417 GTAAATTAGAGGTTATTATTGGG + Intronic
1173835979 20:46126042-46126064 TTAAACCAGAGGTTCTCAACAGG + Intronic
1174214928 20:48909049-48909071 CTAAATCTGAGGTCATCAGTGGG - Intergenic
1174734992 20:52957349-52957371 TTACATCAGTGGTTCTCAGATGG + Intergenic
1175476712 20:59280548-59280570 GTACATCAGTGGTACTCAGCTGG - Intergenic
1176925218 21:14740936-14740958 GTAAATCAGAGGTTAGCTGCAGG - Intergenic
1177695334 21:24564409-24564431 GTGAATCAAAAGTTCTGAGTAGG - Intergenic
1178268098 21:31163996-31164018 GTAACACAGAGGTTTTAAGTTGG + Intronic
1179070459 21:38066149-38066171 CTAGATCAGGGGTTCTCACTGGG + Intronic
1179240839 21:39590205-39590227 AAAAATCAGAGATTGTCAGTTGG + Intronic
1181159683 22:20951605-20951627 GTAAATGAAAGCTACTCAGTAGG - Exonic
1182308650 22:29388826-29388848 GCAAATCTGAGGTTCTAAGAGGG + Intronic
1182886090 22:33775481-33775503 CTAAGTCAGTGGTTCTCAATAGG + Intronic
1183888619 22:40906490-40906512 GTAGGTCAGTGATTCTCAGTGGG + Intronic
949558141 3:5176817-5176839 CTACATCAGTGGTTCTCAATGGG + Intronic
949620528 3:5806474-5806496 GTAAAGCAGTGGTTCTCAACTGG - Intergenic
952495336 3:33910923-33910945 ATAAATAAAAGGATCTCAGTAGG + Intergenic
955062846 3:55508104-55508126 GAAAATCAGAAGTTCACATTAGG - Intergenic
955531080 3:59873743-59873765 CTAGACCAGTGGTTCTCAGTTGG - Intronic
955981781 3:64534690-64534712 CTAAATCAGTGGTTCTCAACAGG + Intronic
956127848 3:66027952-66027974 CTGAATCAGTGGTTCTCAGCTGG - Intronic
956844503 3:73170006-73170028 TTACAGCAGAGGTCCTCAGTGGG + Intergenic
959417283 3:106090761-106090783 CTAAACCAGAGGTTCTCAAAAGG - Intergenic
959521082 3:107323720-107323742 GTAAATCAGAAGTTCATGGTTGG - Intergenic
961661541 3:128471207-128471229 CTAAATCAGTGGTTCTCAACAGG + Intergenic
963574497 3:147042859-147042881 TTAATTCAGTGGTTCTCAATAGG - Intergenic
964288656 3:155150709-155150731 CTAACTCAGGGGTTCTCACTTGG - Intronic
964487059 3:157196975-157196997 GTAAATTACATGTACTCAGTAGG - Intergenic
965167824 3:165219086-165219108 CTATACCAGTGGTTCTCAGTTGG - Intergenic
970064930 4:12082556-12082578 GTAAATCAGTAGATCTCTGTTGG + Intergenic
971509819 4:27410375-27410397 CTCAATCAGTGGTTCTCAGCAGG - Intergenic
971730805 4:30377071-30377093 GTCAATCAGAGATACTCAGAGGG - Intergenic
971862112 4:32121389-32121411 GTATATCAGATGTTTTTAGTAGG + Intergenic
974983232 4:68988365-68988387 GTAAATCAGAAATTTTCTGTGGG + Intergenic
975660383 4:76682569-76682591 GCATATAACAGGTTCTCAGTAGG + Intronic
977324750 4:95561078-95561100 CTAAAGCAGAGCTTCACAGTGGG - Intergenic
977593536 4:98852672-98852694 CTAAATCAGTGGTTCTCAACTGG - Intergenic
977963150 4:103108757-103108779 GGAAATCAGAGGGTAACAGTTGG - Intronic
978742420 4:112152173-112152195 CTAAATCAGTGGTTCTCAACTGG + Intronic
982652748 4:158107971-158107993 CTAACCCAGTGGTTCTCAGTTGG + Intergenic
983373304 4:166892979-166893001 TTAAAGCAGAGGTTTTCAGCTGG + Intronic
984568470 4:181360577-181360599 GTCAATCAGACGTTATCAGGAGG - Intergenic
984649699 4:182257242-182257264 ATTAAGCAGAGGTTCTCAATGGG - Intronic
985334103 4:188873033-188873055 GTATATCAGAGCTCCTCGGTGGG + Intergenic
986135298 5:4971472-4971494 GTAAATCAGAGATCCCCAGATGG - Intergenic
987588056 5:19884027-19884049 GTAAAGCATGGGTTGTCAGTTGG + Intronic
989735312 5:44696259-44696281 GGAAGTCAGTGGTTCTCAATGGG - Intergenic
991468815 5:66945397-66945419 GTAAATGATAAGTCCTCAGTTGG + Intronic
994639602 5:102390454-102390476 GTAAATCAGAGGTTCTAAAATGG + Intronic
994848161 5:105017333-105017355 CTAAATCAGTGGTTCTAAGTTGG - Intergenic
996564477 5:124864996-124865018 GTAGAGCAGAGGTTACCAGTGGG + Intergenic
998843174 5:146277964-146277986 CTAAAGCAGTGGTTCTCAATTGG - Intronic
999155934 5:149457603-149457625 GTGTATCAGAGGGTCTCAGGAGG + Intergenic
1000316627 5:160098650-160098672 GTAAAACAGATTTTCTAAGTAGG + Intronic
1001454538 5:171850650-171850672 TTAAAGCAGTGGTTCTCAATGGG + Intergenic
1004166650 6:13262627-13262649 GGAACTCATAGGTTCTCAGGAGG + Intronic
1004838646 6:19557393-19557415 GTCACTCAGAGGTTTACAGTGGG + Intergenic
1008761031 6:54851334-54851356 GTAAATCAGAAGGACTCAGAAGG - Intronic
1011026827 6:82878601-82878623 CTAGGTCAGGGGTTCTCAGTGGG + Intergenic
1011164128 6:84426688-84426710 TTAAAGCAGAGGTTCTTAGAAGG - Intergenic
1011388095 6:86819499-86819521 CTAAATCAGTGGTTCTCAATTGG + Intergenic
1011720804 6:90154840-90154862 GTACACAAGAGGCTCTCAGTGGG - Intronic
1012313944 6:97762023-97762045 ATAAATTAGTGGTTCTCAGTAGG + Intergenic
1013912274 6:115290635-115290657 CTAACTCAGAGCTTCTCAGAGGG + Intergenic
1013987749 6:116216247-116216269 GGAAATCACAGGCTCTCAGAGGG - Intronic
1014131456 6:117838907-117838929 GTAAGTCAGTGGTTCTCAGTGGG - Intergenic
1014452201 6:121594366-121594388 CTAAACCAGAGGTTCTCCATCGG - Intergenic
1016469353 6:144359325-144359347 TTATATCAGGGGTTCTCAGCTGG - Intronic
1017648970 6:156563768-156563790 GTCAAGCAGTGGTTCTCAGCCGG - Intergenic
1018602735 6:165562782-165562804 TTAAATCATAAGTTCTCAGCTGG + Intronic
1020665686 7:11039029-11039051 TTAAACTAGAGGTTCTCAGTAGG - Intronic
1021031173 7:15738470-15738492 GAATATCAGAGTTTCTCAGCAGG + Intergenic
1021409741 7:20316462-20316484 GTAAGGCAGAGGTTTTCAGTAGG - Intergenic
1021799254 7:24287589-24287611 CTAAATCAGTGGTTCTCAACTGG + Intronic
1022146526 7:27547514-27547536 GTACATAAGAGATTCTCAGGAGG + Intronic
1022379837 7:29849485-29849507 TTAAATCAAAAGTTCCCAGTTGG + Intronic
1024402032 7:48935481-48935503 GTGAAGCTGAGGTTCACAGTAGG + Intergenic
1025805989 7:64835324-64835346 CTAAATCAGAGGTTGGCAGTTGG + Intergenic
1026065972 7:67073175-67073197 TTAAATCAGTGGTTCTCAACTGG + Intronic
1026710907 7:72738675-72738697 TTAAATCGGTGGTTCTCAGCTGG - Intronic
1028044762 7:86104480-86104502 CTAACTCAGAGATTCTGAGTTGG + Intergenic
1028214988 7:88120378-88120400 ATAAAACAGTGGTTCTCACTTGG - Intronic
1028243156 7:88445739-88445761 CTAGATCAGTGGTTCTTAGTGGG + Intergenic
1029798093 7:102916371-102916393 CTAAACCAGAGGTTCTTAGCTGG - Intronic
1030266008 7:107622642-107622664 GTAAATCAGTAGTTCTCAACAGG + Exonic
1031227627 7:119060771-119060793 GGAAATCAGAGATTCTCTGGAGG + Intergenic
1032299408 7:130672833-130672855 GGCAGCCAGAGGTTCTCAGTGGG + Exonic
1034397788 7:150840318-150840340 GTAGACCAGAAGTTCTCAGCAGG + Intronic
1035775017 8:2181615-2181637 GAAATTCAGAGGTTATCAGGGGG + Intergenic
1037408149 8:18565779-18565801 CTAAAGCAGTGGTTCTCAATAGG + Intronic
1037573824 8:20181720-20181742 CTACATCAGTGTTTCTCAGTGGG - Intronic
1040969048 8:53114100-53114122 ATAAATCTGGGGTTCTCAGGGGG - Intergenic
1041704037 8:60826261-60826283 GCTAATCAGAGCTTCCCAGTTGG - Intronic
1043108467 8:76147052-76147074 GGAAATCAGAGGTTCTGCCTTGG + Intergenic
1045254255 8:100506402-100506424 GTAGAGCAGAGGCTCTCAGGTGG - Intergenic
1045576890 8:103432251-103432273 GTAATTCAGTGTTTCTCAATGGG - Intronic
1047191770 8:122684924-122684946 CTAAATCTGTGGTTCTCAGTTGG + Intergenic
1047298522 8:123592274-123592296 GTAAATCAGTGGTCCTTAATTGG + Intergenic
1048198545 8:132352530-132352552 CTAAATCAGAGGTTGCCTGTGGG + Intronic
1048347029 8:133583719-133583741 CCAAGTAAGAGGTTCTCAGTTGG + Intergenic
1049733700 8:144192226-144192248 GTCAATCAGAGCCTCCCAGTTGG - Intronic
1051544882 9:18262627-18262649 ATAATTCAGAGATTCTCATTTGG + Intergenic
1053512760 9:38702956-38702978 GTAAGTCATTGGTTCTCAATCGG + Intergenic
1055661747 9:78511002-78511024 GTAAATCAGAGGCTCCAAGCAGG + Intergenic
1058257576 9:102787969-102787991 GTAACTCAGTGGTTCTCAGCTGG - Intergenic
1058682573 9:107452923-107452945 ATAAATCAGAAATTCTCAGGGGG + Intergenic
1059901547 9:118932946-118932968 TTAAATCAGAAGCTCTGAGTAGG + Intergenic
1059925743 9:119207627-119207649 GTAAATCAGTGGTTCTCACTTGG - Intronic
1060953064 9:127617207-127617229 GCACATCATAGGTTCTCAGTAGG - Intronic
1061229757 9:129308387-129308409 GAAAATCAGAGCTTCTCGGCCGG + Intergenic
1186486525 X:9937975-9937997 GTAAGACAGCTGTTCTCAGTGGG + Intronic
1187377244 X:18766271-18766293 GTAAATCAGAGATCATCAGATGG - Intronic
1187737225 X:22317156-22317178 TTAAATCAGTGGTTCTCAGCTGG - Intergenic
1187753237 X:22490765-22490787 GTAAGTCAGTGGTTCTCAAAGGG + Intergenic
1187885616 X:23886165-23886187 GTAAATCAGAGGTTCTCAGTGGG - Intronic
1187947314 X:24438971-24438993 CTAAATCAGAGATTCTAAATGGG + Intergenic
1188018426 X:25130195-25130217 ATAAATCAGTGGTTCTCAAAAGG - Intergenic
1189144972 X:38646453-38646475 GTAAAACAGGGGTTCTTAGCAGG + Intronic
1189715200 X:43857968-43857990 TTAGATCAGAGGTTCTAAATTGG - Intronic
1194305216 X:92236994-92237016 GAAAATCACAGTTTCTAAGTTGG - Intronic
1196375848 X:115031636-115031658 GTAAATAAGAGGATATAAGTGGG + Intergenic
1196929375 X:120665912-120665934 CTAAATCAGATGATCTGAGTTGG - Intergenic
1197004362 X:121478824-121478846 CTAAATCAGTGTTTCTCAATAGG + Intergenic
1200390236 X:155937241-155937263 GTAAAACAGTGGTTGACAGTGGG + Intronic
1200782730 Y:7231548-7231570 GTAAGTCAGAAGTTCTTAATGGG + Intergenic
1201770672 Y:17614538-17614560 CTAAATCAGAGGTTGGCAGTTGG - Intergenic
1201830883 Y:18291448-18291470 CTAAATCAGAGGTTGGCAGTTGG + Intergenic
1202168587 Y:22017656-22017678 GAAAAGCAGAGCTTCTCATTTGG - Intergenic
1202222774 Y:22568712-22568734 GAAAAGCAGAGCTTCTCATTTGG + Intergenic
1202320341 Y:23626948-23626970 GAAAAGCAGAGCTTCTCATTTGG - Intergenic
1202550426 Y:26043108-26043130 GAAAAGCAGAGCTTCTCATTTGG + Intergenic