ID: 1187894099

View in Genome Browser
Species Human (GRCh38)
Location X:23964741-23964763
Sequence CAGTCGTATTTTCTGTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187894099_1187894105 30 Left 1187894099 X:23964741-23964763 CCAAACAACAGAAAATACGACTG No data
Right 1187894105 X:23964794-23964816 CTCATTTAACATAAAGTGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187894099 Original CRISPR CAGTCGTATTTTCTGTTGTT TGG (reversed) Intergenic
No off target data available for this crispr