ID: 1187895838

View in Genome Browser
Species Human (GRCh38)
Location X:23978729-23978751
Sequence GCTGCTAGCAACTCAAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187895837_1187895838 -9 Left 1187895837 X:23978715-23978737 CCTCTTCATTTTTGGCTGCTAGC No data
Right 1187895838 X:23978729-23978751 GCTGCTAGCAACTCAAGAACAGG No data
1187895831_1187895838 17 Left 1187895831 X:23978689-23978711 CCCATGCAATTTCCCCTGGCACA No data
Right 1187895838 X:23978729-23978751 GCTGCTAGCAACTCAAGAACAGG No data
1187895834_1187895838 4 Left 1187895834 X:23978702-23978724 CCCTGGCACAAATCCTCTTCATT No data
Right 1187895838 X:23978729-23978751 GCTGCTAGCAACTCAAGAACAGG No data
1187895832_1187895838 16 Left 1187895832 X:23978690-23978712 CCATGCAATTTCCCCTGGCACAA No data
Right 1187895838 X:23978729-23978751 GCTGCTAGCAACTCAAGAACAGG No data
1187895835_1187895838 3 Left 1187895835 X:23978703-23978725 CCTGGCACAAATCCTCTTCATTT No data
Right 1187895838 X:23978729-23978751 GCTGCTAGCAACTCAAGAACAGG No data
1187895833_1187895838 5 Left 1187895833 X:23978701-23978723 CCCCTGGCACAAATCCTCTTCAT No data
Right 1187895838 X:23978729-23978751 GCTGCTAGCAACTCAAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187895838 Original CRISPR GCTGCTAGCAACTCAAGAAC AGG Intergenic
No off target data available for this crispr